Test on-line:
|
The programs usage in Scientific publications
3D-Match
Bacterial Genome Explorer
BESTORF
BestPal
BPROM
CpGFinder
CTL epitope-Finder
CYS_REC
EST_map
Fex
FGENES
FGENES-M
FGENESB
FGENESH 2016
FGENESH 2015
FGENESH 2014
FGENESH 2013
FGENESH 2012
FGENESH 2011
FGENESH 2010
FGENESH 2009
FGENESH 2008
FGENESH 2007
FGENESH 2006
FGENESH 2005
FGENESH 2002-2004
FGENESH_GC
FGENESH-M
FGENESH+
FGENESH++
FGENESH-C
FGENESH-2
FGENESH++C
FGENESV, FGENESV0
FindMiRNA
FindTerm
FoldRNA
FPROM
FSPLICE
Genome Comparison Browser
Genome Explorer
GetAtoms
Human-mouse synteny
Human-mouse-rat synteny
MaliN
MaliP
MolQuest
NNSSP
NSITE
NSITE-PL
NSITEM
OligoZip
PATTERN
Pdisorder
PlantProm
POLYAH
PROMH
PROTCOMP
PROT_MAP
PSITE
PSSFinder
Rat-mouse synteny
RegSite
RNASPL
SCAN2
ScanWM-P
SPL
SPLM
SPLICEDB
SSP
SSPAL
TSSG
TSSP
TSSW
Various programs
FGENESH 2016
Insect Molecular Biology
2016 DOI: 10.1111/imb.12262
Ion transport peptide (ITP) regulates wing expansion and cuticle melanism in the brown planthopper, Nilaparvata lugens
Yu, B. et al.,
State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Science, Zhejiang University, Hangzhou, China
... The ORF regions of the detected ITP/ITPL transcripts were analysed using fgenesh
(http://linux1.softberry.com/berry.phtml?topic = fgenesh&group = programs&subgroup=gfind).
The 3' UTR, 5' UTR and ORF region of each N. lugens ITP/ITPL transcript were obtained. ...
BioMed Research International
2016 Article ID 7496569, 11 pages http://dx.doi.org/10.1155/2016/7496569
ChSte7 Is Required for Vegetative Growth and Various Plant Infection Processes in Colletotrichum higginsianum
Yuan, Q. et al.,
The Key Laboratory of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan, Hubei 430070, China
... All primers used in this work were designed with primer premier 5.0 (http://www.
premierbiosoft.com/primerdesign/). Open reading frames were further analyzed using the
gene prediction program FGENESH (Softberry Inc., Mount Kisco, NY, USA). ...
Theoretical and Applied Genetics
2016, DOI 10.1007/s00122-016-2752-9
The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit
Gao, M., Hu, L., Li, Y., Weng, Y
1. College of Life Science, Agriculture and Forestry, Qiqihar University, Qiqihar, 161006, China
2. Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA
... Gene annotation within this region was performed with FGENESH (http:// sunl.softberry.com/) and
function prediction was conducted with BLASTx at the NCBI website (http://blast.ncbi.nlm. ...
Fungal Genetics and Biology
2016, 92, 50-64. http://dx.doi.org/10.1016/j.fgb.2016.05.002
Construction of a genetic linkage map and analysis of quantitative trait loci associated with the agronomically important traits of Pleurotus eryngii
Im, C. H. et al.,
a Environment-friendly Research Division, Gyeongsangnam-do Agricultural Research and Extension Services, Jinju, Republic of Korea
b Department of Horticultural Bioscience, Pusan National University, Milyang, Republic of Korea
c US Forest Products Laboratory, Madison, WI, USA
... LOD and R 2 score) was obtained using a P. eryngii genome browser
(http://112.220.192.2/per/) and analyzed using the FGENESH (http://www.softberry.com/), UniProt ...
Developmental & Comparative Immunology
2016, 65, 268-279. http://dx.doi.org/10.1016/j.dci.2016.07.018
Identification of a fourth ancient member of the IL-3/IL-5/GM-CSF cytokine family, KK34, in many mammals
Yamaguchi, T., Schares, S., Fischer, U., & Dijkstra, J. M.
a Laboratory of Fish Immunology, Institute of Infectology, Friedrich-Loeffler-Institut, Sudufer 10, Greifswald-Insel Riems 17493, Germany
b Institute for Comprehensive Medical Science, Fujita Health University, Dengakugakubo 1-98, Toyoake, Aichi 470-1192, Japan
... were made based on using the specialized software GENSCAN,
http://genes.mit.edu/GENSCAN.html, and FGENESH, http://www.softberry.com/berry ...
New Phytologist
2016 DOI: 10.1111/nph.14110
Rye B chromosomes encode a functional Argonaute?like protein with in vitro slicer activities similar to its A chromosome paralog
Ma, W. et al.,
Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben, Stadt Seeland, Germany
Institute of Bioinformatics and Systems Biology/Munich Information Center for Protein Sequences, Helmholtz Center Munich, German Research Center for Environmental Health, Neuherberg, Germany
National Bioinformatics Infrastructure Sweden, Department of Clinical and Experimental Medicine, Linkoping University, Linkoping, Sweden
... The gene structure with putative intronic and exonic regions was
predicted by FGENESH (http://linux1.softberry.com/berry.phtml) based on the A-located ...
Fungal Genetics and Biology
2016, 87, 54-63 http://dx.doi.org/10.1016/j.fgb.2015.12.013
MAT–gene structure and mating behavior of Hymenoscyphus fraxineus and Hymenoscyphus albidus
Wey, T., Schlegel, M., Stroheker, S., Gross, A.
Forest Pathology and Dendrology, Institute of Integrative Biology (IBZ), ETH Zurich, Universitatsstrasse 16, 8092 Zurich, Switzerland
... The gene prediction tool FGENESH (http://linux1.
softberry.com/berry.phtml) was used for the Botryotinia fuckeliana or Sclerotinia sclerotiorum-
specific gene-finding parameters to identify genes on the additional sequence fragment. ...
Fish & Shellfish Immunology
2016, 56, 70-83. http://dx.doi.org/10.1016/j.fsi.2016.06.049
Molecular and functional characterization of Toll-like receptor (Tlr) 1 and Tlr2 in common carp (Cyprinus carpio)
Fink, I. R. et al.,
a Cell Biology and Immunology Group, Department of Animal Sciences, Wageningen University, PO Box 338, 6700 AH, Wageningen, The Netherlands
b Department of Infectious Diseases and Immunology, Utrecht University, Yalelaan 1, 3584 CL, Utrecht, The Netherlands
... Exon-intron structure was studied by multiple alignments and open reading frame
predictions (FGENESH at http://linux1.softberry.com/berry.phtml?topic=fgenesh&group ...
Chromosome Research
2016, 24(2), 197-216. DOI: 10.1007/s10577-015-9515-3
Highly distinct chromosomal structures in cowpea (Vigna unguiculata), as revealed by molecular cytogenetic analysis
Iwata-Otsubo, A., Lin, J. Y., Gill, N., Jackson, S. A.
Center for Applied Genetic TechnologiesUniversity of Georgia
Department of BiologyUniversity of Pennsylvania
... 1998; Gordon
et al. 1998). FGENESH (www.?softberry.?com/?) was used for de novo gene prediction. ...
Frontiers in plant science
2016, 7: 284. doi: 10.3389/fpls.2016.00284
Diverse evolutionary trajectories for small RNA biogenesis genes in the oomycete genus Phytophthora
Bollmann, S. R., Fang, Y., Press, C. M., Tyler, B. M., Grunwald, N. J.
1Horticultural Crop Research Unit, USDA-Agricultural Research Service, Corvallis, OR, USA
2Department of Botany and Plant Pathology and Center for Genome Biology and Biocomputing, Oregon State University, Corvallis, OR, USA
.. homologs were isolated and coding sequences were manually identified or confirmed using
Genscan (Burge and Karlin, 1997) or FGENESH (linux1.softberry.com/berry ... in-frame fused with
GFP by inserting into the blunt site Stu I in the plasmid pYF2-GFP (Fang and Tyler, 2016). ...
Frontiers in genetics
2016, 7: 38. doi: 10.3389/fgene.2016.00038
Microsomal omega-3 fatty acid desaturase genes in low linolenic acid soybean line RG10 and validation of major linolenic acid QTL
Reinprecht, Y., & Pauls, K. P.
Department of Plant Agriculture, University of Guelph, Guelph, ON, Canada
... The gene structure was also analyzed
with the FGenesh 2.6 (http://linux1.softberry.com; Salamov and Solovyev, 2000). ...
Front. Plant Sci
08 August 2016 7, 1140. | http://dx.doi.org/10.3389/fpls.2016.01140
Analysis of Magnaporthe oryzae Genome Reveals a Fungal Effector, Which Is Able to Induce Resistance Response in Transgenic Rice Line Containing Resistance Gene, Pi54
Ray, S. et al.,
1National Research Centre on Plant Biotechnology, Pusa Campus, New Delhi, India
2Chaudhary Sarwan Kumar Himachal Pradesh Agricultural University, Palampur, India
... The supercontigs obtained after assembling the sequence reads were used for gene prediction using
FGENESH 8 taking Magnaporthe as reference database for gene prediction. ...
Developmental & Comparative Immunology
2016, 61, 208-224. http://dx.doi.org/10.1016/j.dci.2016.04.004
Evolution of IFN-? in tetrapod vertebrates and its functional characterization in green anole lizard (Anolis carolinensis)
Chen, S. N. et al.,
a State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China
b University of the Chinese Academy of Sciences, Beijing 10049, China
... Putative transcripts were predicted from the lizard genome
sequences using the FGENESH program (http://linux1.softberry.com/berry.phtml). ...
Current Biotica
9(4):306-312, 2016
Expression profiling of anthocyanin pathway genes in popular tomato cultivars of India
Aumreetam Dinabandhu and Bidya Bhushan Gupta
ICAR-National Research Center on Plant Biotechnology, Pusa Campus, New Delhi-110 012, India
#Present address: Department of Biotechnology, Indian Institute of Technology, Roorkee –
247 667, Haridwar dt., Uttarakhand, India
... sequence of International Tomato Annotation Group release was used from http://solgenomics.
net/ and anthocyanin genes were predicted by using BLAST- Basic Local Alignment Search Tool
(http://blast.ncbi.nlm.nih.gov/ Blast.cgi) and FGENESH (www.softberry.com) gene ...
Applied Biochemistry and Biotechnology
2016 doi:10.1007/s12010-016-2164-y
Cloning and Expression Analysis of Eight Upland Cotton Pentatricopeptide Repeat Family Genes
Han, Z. et al.,
Cotton Research Centre Shandong Academy of Agricultural Sciences; School of Biological Science and TechnologyUniversity of Jinan
... Potential genes of the retrieved bacterial artificial chromosome (BAC) sequences were predicted
by a program FGENESH (http://www.softberry.com/), and the predicted proteins were used
subsequently as input for BLASTP searches against the non- redundant GenBank protein ...
Functional & integrative genomics
July 2016, Volume 16, Issue 4, pp 429-439 doi:10.?1007/?s10142-016-0494-z
Structural organization of fatty acid desaturase loci in linseed lines with contrasting linolenic acid contents
Thambugala, D., Ragupathy, R., Cloutier, S.
1. Department of Plant Science, University of Manitoba, 66 Dafoe Rd, Winnipeg, MB, R3T 2N2, Canada
2. Ottawa Research and Development Centre, 960 Carling Ave, Ottawa, ON, K1A 0C6, Canada
.. Gene annotation. Gene prediction algorithm of FGENESH
(http://?www.?softberry.?com/?) and the previously predicted ab initio gene sequences of the
WGS sequence of CDC Bethune were further verified using FLAX GFF3 (Wang et al. ...
The Plant Journal
2016 DOI: 10.1111/tpj.13214
Rapid evolutionary dynamics in a 2.8?Mb chromosomal region containing multiple prolamin and resistance gene families in Aegilops tauschii
Dong, L. et al.,
United States Department of Agriculture-Agricultural Research Service, Western Regional Research Center, Albany, California
Department of Plant Sciences, University of California, Davis, CA, USA
... In addition, FGENESH (http://www.softberry
.com/nucleo.html), GeneMark, and GeneScan were used for gene prediction. ...
Journal of Bioscience and Bioengineering
2016 doi:10.1016/j.jbiosc.2016.05.003
Heterologous production of an acidic thermostable lipase with broad-range pH activity from thermophilic fungus Neosartorya fischeri P1
Sun, Q. et al.,
1 Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
2 Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, College of Bioengineering, Tianjin University of Science & Technology, Tianjin 300457, PR China
... strand of cDNA
as template, the exon-intron boundaries were predicted using the online software GENSCAN
(http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/berry ...
Scientific reports
2016, 6: 25107. doi: 10.1038/srep25107
Comprehensive analysis of the polygalacturonase and pectin methylesterase genes in Brassica rapa shed light on their different evolutionary patterns
Duan, W. et al.,
1State Key Laboratory of Crop Genetics and Germplasm Enhancement/Key Laboratory of Biology and Germplasm Enhancement of Horticultural Crops in East China, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China
2Center of Genomics and Computational Biology, College of Life Sciences, North China University of Science and Technology, Tangshan, Hebei 063000, China
... splicing errors, and missed or extra exons, manual
reannotation was performed using the FGENESH program (http://linux1.softberry.com/berry ...
Applied and environmental microbiology
2016, 82(4), 1196-1204. doi: 10.1128/AEM.03168-15
A fivefold parallelized biosynthetic process secures chlorination of Armillaria mellea (honey mushroom) toxins
Wick, J. et al.,
aDepartment of Pharmaceutical Microbiology, Hans Knoll Institute, Friedrich-Schiller-Universitat Jena, Jena, Germany
bDepartment of Biomolecular Chemistry, Leibniz Institute for Natural Product Research and Infection Biology-Hans Knoll Institute, Jena, Germany
... for 3 min. In silico sequence and phylogenetic analysis.To identify exon-intron
junctions in silico, we used FGENESH (Softberry, Mount Kisco, NY) and Augustus
(26) software as described previously (27). Primary sequences ...
The Plant Genome
2016 doi:10.3835/plantgenome2015.09.0084
Fine Mapping of Two Wheat Powdery Mildew Resistance Genes Located at the Pm1 Cluster
Liang, J. et al.,
a The Applied Plant Genomics Laboratory of Crop Genomics and Bioinformatics Centre, Nanjing Agricultural University, Nanjing 210095, Jiangsu, China
b current address, Crop Research Institute, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, Jiangsu, China
... Gene prediction was performed using the gene predictor
program FGENESH (http://www.softberry.com) complemented with BLASTn search against dbEST ...
Frontiers in Plant Science
2016, 7: 967. doi: 10.3389/fpls.2016.00967
HyPRP1 Gene Suppressed by Multiple Stresses Plays a Negative Role in Abiotic Stress Tolerance in Tomato
Li, J. et al.,
1Key Laboratory of Horticulture Science for Southern Mountainous Regions, Ministry of Education; College of Horticulture and Landscape Architecture, Southwest University, Chongqing, China
2Key Laboratory of Horticultural Plant Biology (MOE), Huazhong Agricultural University, Wuhan, China
... Both SlHyPRP1 and SpHyPRP1 encoded 262 amino
acids predicted by the FGENESH program (http://linux1.softberry.com/berry.phtml). ...
Theoretical and Applied Genetics
2016, 1-12. DOI: 10.1007/s00122-016-2740-0
The Solanum demissumR8 late blight resistance gene is an Sw-5 homologue that has been deployed worldwide in late blight resistant varieties
Vossen, J. H. et al.,
Wageningen UR Plant BreedingWageningen University and Research
... Gene structures
were predicted using FGENESH 2.6(Softberry) and protein sequences were deduced
by translation of ORF using the standard genetic code. ...
Plant, Cell & Environment
2016 DOI: 10.1111/pce.12779
Different cytokinin histidine kinase receptors regulate nodule initiation as well as later nodule developmental stages in Medicago truncatula
Boivin, S. et al.,
... Prediction of gene structures using FGENESH (http://linux1.softberry.
com/) revealed that the MtCHK1/MtCRE1 transcript contains 11 predicted exons ...
G3: Genes| Genomes| Genetics
2016, 6(5), 1179-1189. doi: 10.1534/g3.115.026229
Sequence of the Gonium pectorale Mating Locus Reveals a Complex and Dynamic History of Changes in Volvocine Algal Mating Haplotypes
Hamaji, T. et al.,
*Donald Danforth Plant Science Center, St Louis, Missouri 63132
†Department of Biological Sciences, Graduate School of Science, University of Tokyo 113-0033, Japan
‡Department of Ecology and Evolutionary Biology, University of Arizona, Tucson, Arizona 85721
... Gene models were generated using Fgenesh (Salamov and Solovyev 2000) (http://linux1.softberry.
com/berry.phtml) with the “Chlamydomonas” option, and then manually edited based on similarity
to C. reinhardtii (JGI V4 protein models: http://genome.jgi-psf.org/Chlre4 ... 2016). ...
Biotechnology for Biofuels
2016 9:147 DOI: 10.1186/s13068-016-0560-8
Engineering a highly active thermophilic ?-glucosidase to enhance its pH stability and saccharification performance
Xia, W. et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences
College of Animal Science, Zhejiang University
... Genes, introns, exons and transcription initiation sites were predicted using the online software
FGENESH (http://linux1.softberry.com/berry.phtml). ...
PloS one
2016, 11(3), e0150988. DOI: 10.1371/journal.pone.0150988
Missed, not missing: Phylogenomic evidence for the existence of Avian FoxP3
Denyer, M. P., Pinheiro, D. Y., Garden, O. A., Shepherd, A. J.
Department of Clinical Sciences and Services, The Royal Veterinary College, London, United Kingdom, Institute of Structural and Molecular Biology and Department of Biological Sciences, Birkbeck, University of London, London, United Kingdom
Institute of Structural and Molecular Biology and Department of Biological Sciences, Birkbeck, University of London, London, United Kingdom
... Gene prediction software such as Softberry FGENESH [41] still predicts that
foxp3 is present in the inter-genic region between ppp1r3f and ccdc22 (S1 File). ...
Immunogenetics
2016, 68(1), 77-82. DOI: 10.1007/s00251-015-0885-7
Assembly and characterization of the MHC class I region of the Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis)
Ruan, R., Wan, X. L., Zheng, Y., Zheng, J. S., Wang, D.
1. Key Laboratory of Aquatic Biodiversity and Conservation of the Chinese Academy of Sciences, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China
2. University of Chinese Academy of Sciences, Beijing, 100039, China
... KP994094. First, Genscan (http://genes.mit.edu/GENSCAN.html) and Fgenesh
(http://www.softberry.com/) (Burge and Karlin 1997; Salamov and Solovyev 2000) were
used to predict genes pre- senting in the YFP MHC class I region. ...
Molecular Genetics and Genomics
2016, 291: 1137–1154. doi:10.1007/s00438-016-1169-0
Genome-wide analysis of CrRLK1L gene family in Gossypium and identification of candidate CrRLK1L genes related to fiber development
Niu, E. et al.,
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Hybrid Cotton R&D Engineering Research Center, Ministry of EducationNanjing Agricultural University
...he CrRLK1L sequences were obtained after being confirmed by the online FGENESH
(http://www.softberry.com/berry. phtml; Solovyev et al. 2006) and SMART (http://smart. ...
Plant biotechnology journal
2016 DOI: 10.1111/pbi.12577
Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat
Bonneau, J., Baumann, U., Beasley, J., Li, Y., Johnson, A. A.
School of BioSciences, The University of Melbourne, Melbourne, Vic., Australia
Australian Centre for Plant Functional Genomics, The University of Adelaide, Adelaide, SA, Australia
... genes. Matching sequences from the IWGSC portal were annotated using the TriAnnot-v1.4
(http://wheat-urgi.versailles.inra.fr) and FGENESH (http://www.softberry.com/) pipelines ...
South African Journal of Botany
2016, 102, 142-152. doi:10.1016/j.sajb.2015.06.012
YUCCA type auxin biosynthesis genes encoding flavin monooxygenases in melon: Genome-wide identification and developmental expression analysis.
Zheng, L. et al.,
a Forestry and Fruit Research Institute, Shanghai Key Laboratory of Protected Horticultural Technology, Shanghai Academy of Agricultural Sciences, Shanghai 201403, China
b School of Life Sciences, Taizhou University, Taizhou, Zhejiang 317000, China
... Thereafter, HMM-based gene structure prediction was carried out using the FGENESH
program (default values) at http://linux1.softberry.com/berry.phtml. ...
Journal of insect physiology
2016, 58(4), 570-579. doi:10.1016/j.jinsphys.2011.12.009
Localization of two Na+-or K+-H+ antiporters, AgNHA1 and AgNHA2, in Anopheles gambiae larval Malpighian tubules and the functional expression of AgNHA2 in yeast
Xiang, M. A., Linser, P. J., Price, D. A., & Harvey, W. R.
a Division of Nephrology and Hypertension, Department of Medicine, University of Florida-Jacksonville, Jacksonville, FL 32206, USA
b Whitney Mosquito Biology Group, University of Florida, 9505 Ocean Shore Boulevard, St. Augustine, FL 32080, USA
... gambiae
that were applied to FGENESH at the Softberry site (http://www.softberry.com/berry.phtml) identified
a cDNA from a genomic region of ?30 kb; it included the originally predicted ...
Tree Genetics & Genomes
2016, 12: 2. DOI: 10.1007/s11295-015-0962-y
Homologs of the FB_MR5 fire blight resistance gene of Malus? robusta 5 are present in other Malus wild species accessions
Wohner, T et al.,
Julius Kuhn-Institut, Institute for Breeding Research on Fruit Crops,
Medical Theoretical Center (MTZ), Experimental Center, Faculty of Medicine Carl Gustav CarusTechnical University Dresden
... Gene and protein predictions were made with FGENESH (www.?softberry.?com)
using the organism-specific parameters for Solanum lycopersicum. ...
Theoretical and Applied Genetics
2016, 129(3), 507-516. DOI: 10.1007/s00122-015-2644-4
Fine mapping of a dominantly inherited powdery mildew resistance major-effect QTL, Pm1.1, in cucumber identifies a 41.1 kb region containing two tandemly arrayed cysteine-rich receptor-like protein kinase genes
Xu, X. et al.,
1. School of Horticulture and Plant Protection, Yangzhou University, Yangzhou, 225009, Jiangsu, China
2. USDA-ARS Vegetable Crops Research Unit, Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA
... al. 2012). Gene prediction and sequence annotation The genomic DNA region
harboring the PMR locus was annotated with FGENESH (http://sunl.softberry.com/)
and InterProScan (http://www.ebi.ac.uk/InterProScan). Genes ...
Theoretical and Applied Genetics
2016, 129(1), 53-64. DOI: 10.1007/s00122-015-2608-8
Map-based cloning reveals the complex organization of the BnRf locus and leads to the identification of BnRf b, a male sterility gene, in Brassica napus
Deng, Z. et al.,
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China
2. Institute of Crop Science, Anhui Academy of Agricultural Science, Hefei, 230031, China
.. Bioinformatics analysis The website-based software FGENSH (http://www.soft- berry.com)
was used to predict putative ORFs from the candidate region. The genomic or coding
sequences of predicted genes were submitted to NCBI (http://www. ...
Crop and Pasture Science
2016, 67(5), 541-552. doi: 10.1071/CP15165
NB-LRR gene family required for Rsc4-mediated resistance to Soybean mosaic virus
Li, N. et al.,
National Center for Soybean Improvement, National Key Laboratory for Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Weigang 1, Nanjing 210095, P.R. China.
... The online program Fgenesh
(www.softberry.com/) was used to predict open reading frames (ORFs). ...
Sci Rep.
2016; 6: 29072. doi: 10.1038/srep29072
Expansion of amphibian intronless interferons revises the paradigm for interferon evolution and functional diversity
Sang, Y. et al.,
Departments of Anatomy and Physiology, College of Veterinary Medicine, Kansas State University, Manhattan, USA
2Diagnostic Medicine and Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, USA
3Arthropod-Borne Animal Diseases Research Unit, Center for Grain and Animal Health Research, Agricultural Research Service, United States Department of Agriculture, Manhattan, KS, USA
...Programs interactively used for gene prediction include GenomeScan (http://genes.mit.edu/genomescan.html)
and FGENESH (http://www.softberry.com), and were further manually annotated for confirmation. ...
... Regulatory elements in the putative proximal promoters were examined against both human/animal TFD Database using program Nsite (Version 5.2013, at http://www.softberry.com)39. ...
Insect molecular biology
Volume 25, Issue 3 June 2016 Pages 191–201 DOI: 10.1111/imb.12210
The transformer genes in the fig wasp Ceratosolen solmsi provide new evidence for duplications independent of complementary sex determination
Jia, L. et al.,
Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, China
Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, Hainan, China
... local BLAST searches (Altschul
et al., 1990) using previously published protein sequences of Tra from closely related species
and predicted gene structures with FGENESH1 in the SOFTBERRY software package (ht ...
Environmental and Experimental Botany
2016, 121, 121-131. doi:10.1016/j.envexpbot.2015.05.016
FTL2 expression preceding bud set corresponds with timing of bud set in Norway spruce under different light quality treatments
Opseth, L. et al.,
Department of Plant Sciences, Norwegian University of Life Sciences, P.O. Box 5003, N-1432 As, Norway
... 2.6. Phylogenetic analysis. The coding DNA
sequences of the PaPHYs and PaCRYs were translated into protein using GENSCAN
(http://genes.mit.edu/GENSCAN.html) and FGENESH (http://sun1.softberry.com/berry.phtml). ...
Fungal Biology
2016 doi:10.1016/j.funbio.2016.06.005
Cytochrome P450 complement (CYPome) of Candida oregonensis, a gut-associated yeast of bark beetle, Dendroctonus rhizophagus
Hernandez-Martinez, F., Briones-Roblero, C. I., Nelson, D. R., Rivera-Orduna, F. N., & Zuniga, G.
a Departamento de Zoologia, Escuela Nacional de Ciencias Biologicas, Instituto Politecnico Nacional, Prolongacion de Carpio y Plan de Ayala, Col. Sto. Tomas, Mexico D.F. CP 11340, Mexico
b Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, 858 Madison Ave. Suite G01, Memphis, TN 38163, USA
... in both processes have been documented (DiGuistini et al., 2011, Adams et al., 2013, Lah et
al., 2013 and Xu et al., 2016). ... based (HMM) gene structure prediction was performed using the
Fgenesh program (Solovyev 2007) in the MolQuest package v 2.4.5.1135 (SoftBerry Inc. ...
Microbiological Research
2016, 192, 142-147. doi:10.1016/j.micres.2016.06.010
Identification of genes associated with asexual reproduction in Phyllosticta citricarpa mutants obtained through Agrobacterium tumefaciens transformation
Goulin, E. H. et al.,
a Department of Genetics, Universidade Federal do Parana, P.O. BOX 19071, CEP: 81531-980 Curitiba, PR, Brazil
b Fund for Citrus Protection, Fundecitrus, Av. Dr. Adhemar Pereira de Barros, 201, CEP: 14807-040 Araraquara, SP, Brazil
... in which the T-DNA insertion was located were
selected for gene prediction using FGENESH software (http://www.softberry.com/berry ...
PloS one
2016, 11(1), e0147486. doi: 10.1371/journal.pone.0147486
Two Horizontally Transferred Xenobiotic Resistance Gene Clusters Associated with Detoxification of Benzoxazolinones by Fusarium Species
Glenn, A. E. et al.,
USDA, ARS, Richard B. Russell Research Center, Toxicology & Mycotoxin Research Unit, Athens, Georgia, United States of America
University of Georgia, Department of Plant Pathology, Athens, Georgia, United States of America
... Manual
annotation of cluster genes was done by comparison to F. verticillioides and other annotated
species and by using FGENESH [29] through www.softberry.com. ...
PloS one
2016, 11(7), e0160197. doi: 10.1371/journal.pone.0160197
Identification of Novel Transcribed Regions in Zebrafish (Danio rerio) Using RNA-Sequencing
Wang, J., Vesterlund, L., Kere, J., Jiao, H.
Department of Biosciences and Nutrition, Science for Life Laboratory, Karolinska Institutet, Stockholm, Sweden
Clinical Research Centre, Karolinska University Hospital, Huddinge, Sweden
... Besides using junction information to clarify hypothetical exon
boundaries within clusters, we also used gene models provided by GENSCAN [16] and open
reading frame (ORF) predicted using FGENESH software (http://www.softberry.com) to ...
Mycoscience
2016, 57(2), 136-143 doi:10.1016/j.myc.2015.12.003
Cloning and characterization of cuticle-degrading serine protease from nematode-trapping fungus Arthrobotrys musiformis
Tzean, Y. et al.,
a Department of Plant Pathology and Microbiology, College of Bio-Resources and Agriculture, National Taiwan University, Taipei 10617, Taiwan, ROC
b Department of Energy, Plant Research Laboratory, Michigan State University, East Lansing, MI 48824-1312, USA
... The
5?UTR was predicted using Softberry FGENESH gene prediction software. ...
Theoretical and Applied Genetics
2016, 129(2), 305-316. DOI: 10.1007/s00122-015-2628-4
Identification and mapping of Tril, a homeodomain-leucine zipper gene involved in multicellular trichome initiation in Cucumis sativus
Wang, Y. L. et al.,
1. School of Agriculture and Biology, Shanghai Jiao Tong University, 800 Dongchuan Road, Minhang District, Shanghai, 200240, China
2. Hunan Vegetable Research Institute, Hunan Academy of Agriculture Sciences, Changsha, 410125, China
... The functions of candi- date genes were retrieved from the NCBI website (http:// archive-dtd.ncbi.
nlm.nih.gov/). According to dicot plant (Arabidopsis)-based gene structure prediction (http://
linux1.softberry.com/), the Cucsa.045360 gene structure was identified in the tril mutant. ...
Genome biology and evolution
2016, 8(2), 302-316. doi: 10.1093/gbe/evv259
Retention, Molecular Evolution, and Expression Divergence of the Auxin/Indole Acetic Acid and Auxin Response
Factor Gene Families in Brassica Rapa Shed Light on Their Evolution Patterns in Plants
Huang, Z. et al.,
1State Key Laboratory of Crop Genetics and Germplasm Enhancement, Key Laboratory of Biology and Germplasm Enhancement of Horticultural Crops in East China, College of Horticulture of Nanjing Agricultural University, Nanjing, P.R. China
2Center of Genomics and Computational Biology, College of Life Sciences, North China University of Science and Technology, Tangshan, Hebei, China
... Then, the FGENESH program (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=
programs&subgroup=gfind) was used to rectify incorrect start codon predictions, splicing errors,
and missed or extra exons; manual reannotation was performed. ...
Genes & Genomics
2016, 38(2), 109-117. DOI: 10.1007/s13258-015-0356-4
Identification and evolutionary history of the DD41D transposons in insects
Zhang, H. H., Shen, Y. H., Xiong, X. M., Han, M. J., Zhang, X. G.
1. College of Pharmacy and Life Science, Jiujiang University, Jiujiang, 332000, China
2. State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing, 400715, China
... Potential open reading frame (ORF) of rosa and Lsra transposons identified in this study was
predicted using FGENESH (http://?linux1.?softberry.?com/?berry.?phtml), GENSCAN
(http://?genes.?mit.?edu/?GENSCAN.?html) or getorf in EMBOSS-6.3.1 package (Rice et al. ...
Mycologia
2016, 15-200. doi: 10.3852/15-200
mrskn7, a putative response regulator gene of Monascus ruber M7, is involved in oxidative stress response, development and mycotoxin production
Shao, Y., Yang, S., Zhang, Z., Zhou, Y., Chen, F.
1 Huazhong Agricultural University, Wuhan, Hubei
3Hubei Academy of Agricultural Sciences, Wuhan, Hubei
4Huazhong Agricultural University, Wuhan, Hubei, 430070, China
... BLAST webserver (http://blast.ncbi.nlm.nih.Gov/Blast.cgi). The mrskn7 protein sequence
was deduced using SoftBerry's FGENESH program (http://linuxl.softberry.com/berry.
phtml). Homology analysis was subsequently performed ...
Plant Cell Reports
2016, 1-12. DOI: 10.1007/s00299-016-2008-9
Reduction of GIGANTEA
Kim, J. A. et al.,
1. Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural Development Administration, 370, Nongsaengmyeong-ro, Wansan-gu, Jeollabuk-do, Jeonju-si, 560-500, Korea
2. Department of Biological Sciences, Dartmouth College, Hanover, NH, 03755-3563, USA
.. A bacterial artificial chromosome (BAC) clone containing the ortholog of GI was identified
(http://www.brassica-rapa.org), and the GI structure and sequence were predicted using the
web-based gene prediction software FGENE-SH Arabidopsis (http://www.softberry.com/berry ...
Genetica
2016, 144(2), 229-241. DOI: 10.1007/s10709-016-9893-2
Comparative analysis of genome-wide Mlo gene family in Cajanus cajan and Phaseolus vulgaris
Deshmukh, R., Singh, V. K., Singh, B. D.
1. Faculty of Science, School of Biotechnology, Banaras Hindu University, Varanasi, 221005, India
2. Faculty of Science, Centre for Bioinformatics, School of Biotechnology, Banaras Hindu University, Varanasi, 221005, India
... The Fgenesh (http://linux1.softberry.com/) and GENSCAN (http://genes.mit.edu/; Burge and Karlin
1997) online ser- vers were used to detect/confirm the Mlo gene structures and the positions
of transcription start sites and polyA tails in the Mlo members from the two species. ...
Gene
2016, 585(2), 196-204. doi:10.1016/j.gene.2016.02.034
Identification and evolution of two insulin receptor genes involved in Tribolium castaneum development and reproduction
Sang, M., Li, C., Wu, W., Li, B.
Jiangsu Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210023, China
... http://beetlebase.org) (Kim et al., 2010). The initial search results were further
analyzed using the gene prediction software FGENESH (http://linux1.softberry.com/
berry.phtml). Based on the predicted sequences, we designed ...
PloS one
2016, 11(3), e0151323. http://dx.doi.org/10.1371/journal.pone.0151323
An Approach to Function Annotation for Proteins of Unknown Function (PUFs) in the Transcriptome of Indian Mulberry
Dhanyalakshmi, K. H. et al.,
Department of Crop Physiology, University of Agricultural Sciences, GKVK, Bengaluru, 560065, India National Centre for Biological Sciences, TIFR, GKVK campus, Bengaluru, 560065, India
... The gene prediction was carried out using available online tools like Softberry's HMM-based
ab-initio gene structure prediction by FGENESH [15] with Populus trichocarpa as reference
genome and AUGUSTUS (A. thaliana), a HMM-based eukaryotic gene prediction server [16 ...
Scientific reports
2016, 6: 25591. doi: 10.1038/srep25591
Directional Selection from Host Plants Is a Major Force Driving Host Specificity in Magnaporthe Species
Zhong, Z. et al.,
1Fujian-Taiwan Joint Center for Ecological Control of Crop Pests, Fujian Agriculture and Forestry University, Fuzhou, 350002, China
2Fujian University Key Laboratory for Functional Genomics of Plant Fungal Pathogens, Fujian Agriculture and Forestry University, Fuzhou, 350002, China
... Gene predictions was conducted through a combination of evidence-based prediction by
Exonerate 58 (version 2.2.0) with M. oryzae 70-15 genes as reference and de novo prediction
with Fgenesh from SoftBerry (http://linux1.softberry.com/berry.phtml) with Magnaporthe as ...
Genetics and molecular research: GMR
2016, 15(1). DOI http://dx.doi.org/10.4238/gmr.15017507
Regulation of bolting and identification of the ?-tubulin gene family in Brassica rapa L. ssp pekinensis
Zhang, Y. W. et al.,
1 College of Horticulture, Northeast Agricultural University, Harbin, China
2 Key Laboratory of Biology and Genetic Improvement of Horticultural Crops
(Northeast Region), Ministry of Agriculture, Harbin, China
... Each TUA gene loci in A. thaliana was used to search all the TUA gene sequences of B.
rapa present in BRAD. Each predicted B. rapa TUA gene sequence was confirmed using
FGENESH (http://www.softberry.com/berry.phtml?topic=fgenesh). ...
Brazilian journal of microbiology
2016, 47(2), 468-479. http://dx.doi.org/10.1016/j.bjm.2016.01.004
Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism
Yao, L. et al.,
aKey Laboratory of Molecular and Cytogenetics and Genetic Breeding of Heilongjiang Province, Harbin Normal University, Harbin, PR China
bDepartment of Life Science and Engineering, Harbin Institute of Technology, Harbin, PR China
... http://www.phrap.org/). The potential open reading frames (ORFs) of the two PKSs
were scanned using FGENESH as the matrix (http://linux1.softberry.com) and
compared with T. virens gene sequences. The conserved PKS ...
heoretical and Applied Genetics
2016, Volume 129, Issue 7 , pp 1247-1256 DOI: 10.1007/s00122-016-2700-8
Map-based cloning, identification and characterization of the w gene controlling white immature fruit color in cucumber (Cucumis sativus L.)
Liu, H. et al.,
1. College of Horticulture, Northwest A&F University, Yangling, Shaanxi, 712100, China
... Sequence analyses Gene prediction was performed using the online program FGENESH
(http://linux1.softberry.com/berry.phtml) (Salamov and Solovyev 2000) and Cucumber
Genome Browser (http://www.icugi.org/cgi-bin/ICuGI/index.cgi). ...
Biotechnology letters
2016, 38(1), 71-79. DOI: 10.1007/s10529-015-1943-9
Characterization of a farnesyl diphosphate synthase gene from Penicillium brevicompactum MUCL 19011
Sharifirad, A. et al.,
1. Department of Systems Biotechnology, Institute of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
... www.?genomatix.?de/?cgi-bin/?eldorado/?main.?pl ). ORF features were predicted
using the web-based software FGENESH (http://?linux1.?softberry.?com/?berry.?
phtml). The PbFDS was subjected to multiple alignments ...
Heredity
116, 491-501 (June 2016) | doi:10.1038/hdy.2016.5
The cacao pathogen Moniliophthora roreri (Marasmiaceae) possesses biallelic A and B mating loci but reproduces clonally
Diaz-Valderrama, J. R., Aime, M. C.
Institute
... In addition, the genomic surrounding areas of receptors were explored to find linked potential
B pheromone precursor sequences by manually identifying the conserved motifs (Riquelme et
al., 2005) in small polypeptides detected by FGENESH (http://www.softberry.com/). ...
Frontiers in plant science
2016, 7: 244. doi: 10.3389/fpls.2016.00244
Functional characterization of novel chitinase genes present in the sheath blight resistance QTL: qSBR11-1 in rice line Tetep
Richa, K. et al.,
1 ICAR-National Research Centre on Plant Biotechnology, New Delhi, India
2 Department of Bioscience and Biotechnology, Banasthali Vidyapith, Vanasthali, India
3 School of Agriculture and Food Sciences, The University of Queensland, Brisbane, QLD, Australia
... Computational analysis of the genes. Full length nucleotide sequence of 11 defense response
genes was retrieved from the rice genome database (www.gramene.org). FGENESH gene
prediction software (www.softberry.com) was used to predict the candidate gene structures. ...
PloS one
2016, 11(5), e0156199. http://dx.doi.org/10.1371/journal.pone.0156199
Dimerization and Transactivation Domains as Candidates for Functional Modulation and Diversity of Sox9
Geraldo, M. T., Valente, G. T., Nakajima, R. T., Martins, C.
Integrative Genomics Laboratory, Department of Morphology, Institute of Biosciences, Sao Paulo State University–UNESP, Botucatu, SP, 18618–000, Brazil
Systems Biology and Genomics Laboratory, Department of Bioprocess and Biotechnology, Agronomical Science Faculty, Sao Paulo State University–UNESP, Botucatu, SP, 18610–307, Brazil
... Elmer). Finally, a prediction of introns, exons and amino acid sequences were performed
using the online program Softberry FGENESH (http://www.softberry.com/). Phylogenetic
analyses: HMG box, SoxE and Sox9. Three phylogenetic ...
Journal of Plant Biochemistry and Biotechnology
2016, 1-9. DOI: 10.1007/s13562-016-0362-x
Candidate gene prediction and expression profiling of near isogenic lines (NILs) carrying stay-green QTLs in rabi sorghum
Chaudhari, G. N., Fakrudin, B.
1. Institute of Agri-Biotechnology, University of Agricultural Sciences, Dharwad, 580005, India
2. Department of Biotechnology and Crop Improvement, UHS Campus, GKVK Post, Bengaluru, 560 065, India
... The retrieved QTL regions were surveyed for the presence of putative candidate genes using
algorithms such as FGENESH (http://?linux1.?softberry.?com), GENSCAN (http://?genes.?mit.?
edu/?GENSCAN.?html) and GENMARK (http://?exn.?gatech.?edu/?eukhmm.?cgi ...
Angewandte Chemie
2016, 128(2), 674-678. DOI: 10.1002/ange.201509345
Production of New Cladosporin Analogues by Reconstitution of the Polyketide Synthases Responsible for the Biosynthesis of this Antimalarial Agent
Cochrane, R. V. et al.,
Department of Chemistry, University of Alberta, Edmonton, Alberta, T6G 2G2 (Canada)
Department of Chemical and Biomolecular Engineering and Department of Chemistry and Biochemistry, University of California, Los Angeles, CA 90095 (USA)
... Spliced gene sequences contained within this gene cluster were identified using the hidden
Markov model (HMM) based software FGENESH (Softberry),23 and the resulting intron-less
sequences were analyzed individually by BLAST (NCBI; Figure 1). Figure 1. Figure 1. ...
Journal of plant research
2016, 129(3), 499-512. DOI: 10.1007/s10265-016-0797-0
Characterization of triterpenoid profiles and triterpene synthase expression in the leaves of eight Vitis vinifera cultivars grown in the Upper Rhine Valley
Pensec, F. et al.,
1. Laboratoire Vigne Biotechnologies et Environnement EA 3391, Universite de Haute Alsace, 33 rue de Herrlisheim, 68000, Colmar, France
2. Department of Plant Biochemistry, Faculty of Biology, University of Warsaw, ul. Miecznikowa 1, 02-096, Warsaw, Poland
... The gene named VvTTPS3 was first characterized as two different genes (GSVIVT01029481001
and GSVIVT01029482001), but the study of these sequences using the FGENESH function of
Softberry (http://linux1.softberry.com/berry.phtml) indi- cated that the two sequences ...
Theoretical and Applied Genetics
2016, 1-9. DOI: 10.1007/s00122-016-2722-2
Fine mapping of the dialytic gene that controls multicellular trichome formation and stamen development in tomato
Chang, J. et al.,
1. Key Laboratory of Horticultural Plant Biology (Ministry of Education), Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... 1987; Lincoln et al. 1992). Gene prediction The predicted genes in the target region were
downloaded from SGN (ftp://sgn.cornell.edu). These genes were further analyzed with FGENESH
(http://linux1.softberry.com/) and GENESCAN (http://genes.mit.edu/). ...
Journal of experimental botany
2016, erw187. doi: 10.1093/jxb/erw187
WAX INDUCER1 (HvWIN1) transcription factor regulates free fatty acid biosynthetic genes to reinforce cuticle to resist Fusarium head blight in barley spikelets
Kumar, A. et al.,
1 Plant Science Department, McGill University, Sainte-Anne-de-Bellevue, QC H9X3V9, Canada
2 Centre de Recherche sur les Grains Inc., 740, chemin Trudeau, Saint-Mathieu-de-Beloeil, QC J3G0E2, Canada
... The contigs were downloaded and genes were predicted using the SoftBerry FGENESH program
(http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). RNA
extraction, cDNA synthesis and quantitative real-time PCR analysis. ...
Chromosoma
2016, 1-11 DOI 10.1007/s00412-016-0601-x
The repetitive DNA element BncDNA, enriched in the B chromosome of the cichlid fish Astatotilapia latifasciata, transcribes a potentially noncoding RNA
Ramos E. et al.,
1. Department of Morphology, Institute of Biosciences, Sao Paulo State University, 18618-689, Botucatu, SP, Brazil
2. Allied Health Sciences Department and Institute for Systems Genomics, University of Connecticut, 06269, Storrs, CT, USA
... janelia.org; Finn et al. 2011), pfam (www.pfam.xfam.org; Finn et al. 2014) and UniProt
(http://www.uniprot.org/blast/; The UniProt Consortium 2015); in addition, gene predictions were
performed using FGENESH at softberry (http://www. softberry.com; Solovyev et al. 2006). ...
Euphytica
2016, Volume 209, Issue 3, pp 725-737 DOI 10.1007/s10681-016-1666-6
Identification and validation of novel alleles of rice blast resistant gene Pi54, and analysis of their nucleotide diversity in landraces and wild Oryza species
Ramkumar, G. et al.,
Crop Improvement Section, Indian Institute of Rice Research
... default settings. Gene structure (length of open reading frame (ORF) and number
of exons/introns, etc. and protein sequences were derived using online tool,
softberry-FGENESH (http://?linux1.?softberry.?com). Numbers of ...
Theoretical and Applied Genetics
2016, 1-16. DOI 10.1007/s00122-016-2723-1
Fine mapping and identification of candidate genes for the sy-2 locus in a temperature-sensitive chili pepper (Capsicum chinense)
Liu, L. et al.,
1. Department of Plant Science and Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, Korea
2. Department of Agronomy and Horticultural Science, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan
... Gene coding regions of the tomato scaffold were predicted by FGENESH+ (http://linux1.softberry.
com). ... repeatmasker.org) and JDotter (http://athena.bioc.uvic.ca). The gene coding regions were
predicted with FGENESH (http://linux1.softberry.com) and BLASTX (https://blast. ...
Ecotoxicology and environmental safety
2016, 124, 363-368. doi:10.1016/j.ecoenv.2015.11.008
Functional and transcript analysis of a novel metal transporter gene EpNramp from a dark septate endophyte (Exophiala pisciphila)
Wei, Y. F. et al.,
a Key Laboratory of Conservation and Utilization for Bioresources and Key Laboratory of Microbial Diversity in Southwest China, Ministry of Education, Yunnan University, Kunming, 650091 Yunnan, PR China
b Kunming Police Dog Base of the Ministry of Public Security, Kunming, 650204 Yunnan, PR China
... different fungi. ORF was also predicted using both ORF Finder (http://www.ncbi.nlm.
nih.gov/gorf/orfig.cgi) and SoftBerry-FGENESH (http://linux1.softberry.com/berry.phtml?
topic=fgenesh&group=programs&;subgroup=gfind). Then ...
Fish & shellfish immunology
2016, 49, 154-162. doi:10.1016/j.fsi.2015.12.009
Genome-wide identification of Hsp70 genes in channel catfish and their regulated expression after bacterial infection
Song, L. et al.,
a Marine Science and Engineering College, Qingdao Agricultural University, Qingdao, 266109, China
b Fish Molecular Genetics and Biotechnology Laboratory, Aquatic Genomics Unit, School of Fisheries, Aquaculture and Aquatic Sciences, Program of Cell and Molecular Biosciences, Auburn University, Auburn, AL 36849, USA
... database using TBLASTN program. The retrieved genome scaffolds were then
predicted by FGENESH in SoftBerry (http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&subgroup=gfind). The amino acid ...
PloS one
2016, 11(2), e0148422. http://dx.doi.org/10.1371/journal.pone.0148422
A new glabrous gene (csgl3) identified in trichome development in cucumber (Cucumis sativus L.).
Cui, J. Y. et al.,
Institute
... The FGENESH program (Softberry, Inc., Mount Kisco, NY, USA) was used on the 19.6 kb genomic DNA region in scafflold000002 of the 9930 draft genome delimited by dCAPs-19 and dCAPs-21....
... Candidate genes prediction. Potential candidate genes in the target genomic region
were identified using Softberry (http://linux1.softberry.com/all.htm) and the Cucumber
Genome Database (http://www.icugi.org/cgi-bin/ICuGI/index.cgi). ...
Applied biochemistry and biotechnology
2016, 1-28. DOI 10.1007/s12010-016-2114-8
The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding
Ayadi, M. et al.,
1. Laboratory of Extremophile Plants. Center of Biotechnology of Borj-Cedria (CBBC), BP 901, Hammam-lif, 2050, Tunisia
2. Laboratory of Molecular and Cellular Screening Processes, Center of Biotechnology of Sfax, University of Sfax, Sidi Mansour Road, P.O. Box 1177, 3018, Sfax, Tunisia
... net/clementine). All gene structures (exon-intron organization) were predicted by
FGENESH Softberry (http://linux1.softberry.com/berry.phtml) [36]. Multiple Sequence
Alignment, Structural and Phylogenetic Analysis To gain ...
Fish & shellfish immunology
2016, 49, 110-121. doi:10.1016/j.fsi.2015.12.022
Septin genes in channel catfish (Ictalurus punctatus) and their involvement in disease defense responses
Fu, Q. et al.,
a State Key Laboratory of Estuarine and Coastal Research, East China Normal University, Shanghai, 200062, China
b The Fish Molecular Genetics and Biotechnology Laboratory, Aquatic Genomics Unit, School of Fisheries, Aquaculture and Aquatic Sciences, Auburn University, Auburn, AL, 36849, USA
... with a cutoff E-value of 1e ?10 . Fgenesh program of Molquest software (Softberry
Int.) was used to predict the genes from retrieved genomic scaffold sequences [56].
The simple modular architecture research tool (SMART http ...
Acta Physiologiae Plantarum
2016, 38(6), 1-14. DOI 10.1007/s11738-016-2152-4
The plasma membrane proton pump gene family in cucumber
Wdowikowska, A., Klobus, G.
1. Department of Plant Molecular Physiology, Institute of Experimental Biology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland
... sequences of new genes, promoter sequences and 5? untranslated region (5? UTR) as well
as encoded amino acid sequences were predicted and analyzed using the FGENESH program
(hidden Markov model (HMM)-based gene prediction program; softberry.com) with ...
Journal of General Plant Pathology
2016, 82(3), 121-131. DOI 10.1007/s10327-016-0656-9
The global regulator LaeA controls biosynthesis of host-specific toxins, pathogenicity and development of Alternaria alternata pathotypes
Takao, K. et al.,
1. The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan
2. Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan
... 2004) as a query. Softberry FGENESH (http://?linux1.?softberry.?com/?berry.?
phtml) was then used to predict the amino acid sequence of the LaeA homolog in
the tomato pathotype of A. alternata. The conserved domain of ...
Journal of General Plant Pathology
2016, Volume 82, Issue 2 , pp 82-88 DOI 10.1007/s10327-016-0647-x
Functional characterization of putative G protein-coupled receptors in the tomato pathotype of Alternaria alternata
Takao, K., Akagi, Y., Tsuge, T., Kodama, M.
1. The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan
2. Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori, 680-8553, Japan
... al. 2006; Xue et al. 2008) as queries. Softberry FGENESH (http://?linux1.?softberry.?
com/?berry.?phtml) was then used to predict the amino acid sequences of the GPCR
homologs in the A. alternata tomato pathotype. The ...
FGENESH 2015
Biotechnology and Bioengineering
2015 DOI 10.1002/bit.25864
Engineering Rhodosporidium toruloides for increased lipid production
Zhang et al.,
1: Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America.
2: Department of Bioengineering, University of California, Berkeley, California, United States of America.
... Genome annotation was performed using an automated software pipeline FGENESH++
(http://www.softberry.com) version 3.1.1. Genes were first predicted ab initio using FGENESH... Gene prediction
parameters were obtained from Softberry and were based on Puccinia spp. ...
Insect biochemistry and molecular biology
2015, 65, 1-9. doi:10.1016/j.ibmb.2015.07.009
Alternatively spliced orcokinin isoforms and their functions in Tribolium castaneum
Jiang, H., Kim, H. G., Park, Y
a Key Laboratory of Entomology and Pest Control Engineering, College of Plant Protection, Southwest University, Chongqing 40071, People's Republic of China
b Department of Entomology, Kansas State University, Manhattan, KS 66506, United States
... Kim et al., 2010). A manual OK-A prediction was performed in the region near
TC005944 and was assisted by the FGENESH program ( Solovyev et al., 2006) from
the Softberry website (http://www.softberry.com). To confirm the ...
Journal of applied genetics
2015, 1-12. DOI: 10.1007/s13353-015-0271-z
Structural characteristics of ScBx genes controlling the biosynthesis of hydroxamic acids in rye (Secale cereale L.)
Bakera et al.,
1. Department of Plant Genetics, Breeding and Biotechnology, Warsaw University of Life Sciences, 159 Nowoursynowska Str, 02-776, Warsaw, Poland
2. Plant Breeding and Acclimatization Institute (IHAR) - National Research Institute, Radzikow, 05-870, Blonie, Poland
... Bioinformatic analyses were performed by means of the pro- grams listed below using default
settings except for SoftBerry/ FGENESH when monocot plant specific gene-finding param- eters
and Blastn when the selection of nucleotide collection (in Bother databases^ section ...
Physiology and Molecular Biology of Plants
2015, 21(2), 301-304. DOI: 10.1007/s12298-015-0284-
Nucleotide variation and identification of novel blast resistance alleles of Pib by allele mining strategy
Ramkumar, G., Madhav, M. S., Devi, S. R., Prasad, M. S., Babu, V. R
1. Crop Improvement Section, Directorate of Rice Research, Rajendranagar, Hyderabad, 500030, India
... In that analysis, standard error was calculated by bootstrap value with 1000 replicates. Phylogenic
tree was constructed with MEGA - Neighbor- Joining (NJ) method. Gene structure was annotated
using on- line tool softberry- FGENESH (http://linux1.softberry.com). ...
IUBMB Life
2015, Volume 68, Issue 2, pages 122–135, February 2016 DOI: 10.1002/iub.1464
Identification of differentially expressed three novel transcript variants of mouse ARNT gene
Ishqi, H. M., Ur Rehman, S., Sarwar, T., Husain, M. A., Tabish, M.
Institute
... finding tools. Gene finding tools used in our study were HMM gene (http://www.cbs.
dtu.dk/services/HMMgene/), Genebuilder (http://www.itba.mi.cnr.it/webgene/) and
FGENESH (http://linux1.softberry.com/berry.phtml). "Fex" available ...
Journal of basic microbiology
2015, 55(5), 591-600. DOI: 10.1002/jobm.201300814
Thc6 protein, isolated from Trichoderma harzianum, can induce maize defense response against Curvularia lunata
Fan, L et al.,
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China
... After predicting online on the softberry website (http://linux1.softberry.com/berry.phtml?
topic=fgenesh&group=programs&subgroup=gfind) and using PCR for confirmation, we
cloned a 710 bp cDNA fragment containing the T-DNA insertion site. ...
Theoretical and Applied Genetics
2015, 128(10), 2099-2111. DOI: 10.1007/s00122-015-2570-5
Fine mapping of powdery mildew resistance genes PmTb7A. 1 and PmTb7A. 2 in Triticum boeoticum (Boiss.) using the shotgun sequence assembly of chromosome 7AL
Chhuneja, P et al.,
1. School of Agricultural Biotechnology, Punjab Agricultural University, Ludhiana, 141 004, India
2. Institute of Plant Biology, University of Zurich, Zurich, Switzerland
... softberry.com/berry.phtml?topic=fgenesh&group=progra ms&subgroup=gfind). ... The Prot_Map
(http://linux1.soft- berry.com/berry.phtml?topic=prot_map&group=program s&subgroup=xmap)
was used to align protein sequences with their corresponding nucleotide sequences. ...
Biotechnology letters
2015, 37(4), 907-919 DOI: 10.1007/s10529-014-1733-9
GhDRIN1, a novel drought-induced gene of upland cotton (Gossypium hirsutum L.) confers abiotic and biotic stress tolerance in transgenic tobacco
Dhandapani, G. et al.,
1. National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi, 110012, India
2. Department of Plant Science, Bharathidasan University, Tiruchirappalli, 620024, Tamil Nadu, India
... Invitrogen). The ORF was identified by the FGENESH analysis using softberry software
(www.?softberry.?com). ... sequenced. The ORF of the gene was identified by FGENESH
of softberry online software using aligned sequence. ...
Plant Science
2015, Volume 234, May 2015, Pages 50–59, doi:10.1016/j.plantsci.2015.02.005
Modification of plasma membrane NADPH oxidase activity in cucumber seedling roots in response to cadmium stress
Jakubowska, D., Janicka-Russak, M., Kabala, K., Migocka, M., Reda, M.
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Kanonia Street 6/8, 50-328 Wroclaw, Poland
... homologs of genes encoding NADPH oxidase. Identified sequences were then
analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New
York; www.softberry.com). ClustalW was used to perform the ...
Molecular Genetics and Genomics
2015, 290(2), 443-460. DOI: 10.1007/s00438-014-0927-0
Molecular evolution and functional divergence of X-intrinsic protein genes in plants
Venkatesh, J., Yu, J. W., Gaston, D., Park, S. W.
1. Department of Molecular Biotechnology, Konkuk University, 1, Hwayang-dong, Gwangjin-gu, Seoul, Republic of Korea
2. Department of Pathology, Dalhousie University, Halifax, NS, Canada
... GmXIP1;1, GmXIP1;3, LuXIP2;2, RcXIP1;1, RcXIP2;1, RcXIP2;2 and SlXIP1;6), gene
structures were predicted using FGENESH softberry tool (http://linux1.softberry.
com/berry.phtml) due to uncertainty in the original gene models. ...
Marine genomics
Volume 24, Part 2, December 2015, Pages 147–157 doi:10.1016/j.margen.2015.03.010
Discovery of germline-related genes in Cephalochordate amphioxus: A genome wide survey using genome annotation and transcriptome data
Yue, J. X., Li, K. L., Yu, J. K.
a Ecology and Evolutionary Biology, Department of BioSciences, Rice University, 6100 Main Street, Houston, TX 77005, USA
b Institute of Cellular and Organismic Biology, Academia Sinica, 128 Academia Road, Section 2, Nankang, Taipei, 11529, Taiwan
... We carried out the re-annotation using Softberry's FGENESH program (http://www.
softberry.com/berry.phtml?topic=fgenesh) ( Salamov and Solovyev, 2000) with B.
floridae specific gene discovery parameters provided by Softberry. ...
Journal of Applied Microbiology
2015 DOI: 10.1111/jam.13036
Occidiofungin is an Important Component Responsible for the Antifungal Activity of Burkholderia pyrrocinia Strain Lyc2
Wang, X. Q. et al.,
Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai'an, Shandong, China
Collaborative Innovation Centre for Annually High Yield and High Efficiency Production of Wheat and Corn, Shandong Agricultural University, Tai'an, Shandong, China
... Biosciences, Carlsbad, CA) and Geneious R8 (Biomatters Ltd.). Open reading frames (ORFs)
and genes were predicted by the Softberry FGENESH program (Salamov and Solovyev ... prediction
was accomplished using the web-based software BRROM in the Softberry Page 9. ...
Applied biochemistry and biotechnology
2015, 177(1), 207-216. DOI: 10.1007/s12010-015-1738-4
Expression of Finger Millet EcDehydrin7 in Transgenic Tobacco Confers Tolerance to Drought Stress
Singh et al.,
1. National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi, 110012, India
2. Institute of Biotechnology, Acharya N.G. Ranga Agricultural University, Hyderabad, 500030, India
... USA). Full-length ORF was obtained with the help of gene finding online tool FGENESH
(softberry.?com). ... sequenced. The coding region of the gene was identified by FGENESH
of softberry online software using aligned sequence. ...
Molecular biology reports
2015, 42(7), 1163-1174. doi:10.?1007/?s11033-015-3853-2
Genome-wide identification and expression profiling of the late embryogenesis abundant genes in potato with emphasis on dehydrins
Charfeddine, S., Saidi, M. N., Charfeddine, M., & Gargouri-Bouzid, R.
Unite Enzymes et Bioconversion, Ecole Nationale d’Ingenieurs de Sfax; Centre de Biotechnologie de Sfax
.. Proteins without any appropriate motif were re-predicted and corrected using Fgenesh
software (http://?linux1.?softberry.?com/?berry.?phtml) using dicotyledon plant
models. Proteins with no reliable prediction were removed. ...
Molecular medicine reports
2015, 11(4), 3069-3077. DOI: 10.3892/mmr.2014.3054
DHA-1 plasmid-mediated AmpC ?-lactamase expression and regulation of Klebsiella pnuemoniae isolates
Luan, Y. et al.,
Department of Medicine Laboratory, Second Affiliated Hospital of Harbin Medical University, Harbin, Heilongjiang 150086, P.R. China, Medicine Laboratory, Department of Urology Surgery, Daqing Oilfield General Hospital, Daqing, Heilongjiang 163001, P.R. China
... form pT-AmpD, whose sequence was also detected. The site of the AmpD gene
promoter was predicted by Softberry Fgenesh (http://www.softberry.com) for sequence
analysis. The AmpDP PCR procedure was performed with ...
Gene
2015, 556(2), 106-112. doi:10.1016/j.gene.2014.11.035
Molecular cloning, characterisation and mRNA expression of the ryanodine receptor from the peach-potato aphid, Myzus persicae
Troczka, B. J. et al.,
a Biological Chemistry and Crop Protection Department, Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK
b Institute of Molecular & Experimental Medicine, Cardiff University School of Medicine, Wales Heart Research Institute, Heath Park, Cardiff CF14 4XN, UK
... The intron/exon boundaries were determined using Spidey (http://www.ncbi.nlm.nih.gov/spidey/)
and Softberry FGENESH (http://linux1.softberry.com/all.htm) software and by manual sequence
analysis using Geneious v5.5 (Biomatters Ltd). 3. Results and discussion. 3.1. ...
Transgenic research
2015, 24(5), 847-858. DOI: 10.1007/s11248-015-9878-4
Identification of candidate MLO powdery mildew susceptibility genes in cultivated Solanaceae and functional characterization of tobacco NtMLO1
Appiano, M. et al.,
1. Laboratory of Plant Breeding, Wageningen University, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands
2. Department of Plant, Soil and Food Science, Section of Genetics and Plant Breeding, University of Bari Aldo Moro, Via Amendola 165/A, 70126, Bari, Italy
... The number of transmembrane domains was predicted using the online software TMHMM
(http://?www.?cbs.?dtu.?dk/?services/?TMHMM/?). The putative number of introns was obtained
using the online service FGENESH of Softberry (http://?www.?softberry.?com/?). ...
Annals of Forest Science
2015, 72(8), 1043-1052. DOI: 10.1007/s13595-015-0502-9
Molecular marker associated with a deleterious recessive anomaly in Eucalyptus grandis seedlings
Fuchs, M. C. et al.,
1. Departamento de Genetica, Instituto de Biociencias, Universidade Estadual Paulista (UNESP), Distrito de Rubiao Jr s/n, Botucatu, SP, 18618-970, Brazil
2. Departamento de Biologia, Campus Sorocaba, Universidade Federal de Sao Carlos (UFSCar), Rod. Joao Leme dos Santos, Km 110, Sorocaba, SP, 18052-780, Brazil
... 1997 ). The identified ESTs with high identity were translated by ExPASy translate
tool (http://?expasy.?org) (Gasteiger et al. 2003 ) and analyzed using FGENESH
(Softberry, http://?www.?softberry.?com) to predict the protein. ...
Current Biotica
2015, 8(4), 351-358.
A comprehensive computational analysis of cis-regulatory elements for anthocyanin biosynthesis genes in tomato (Solanum lycopersicum L.)
Dinabandhu, A.
ICAR- National Research Center on Plant Biotechnology, Pusa Campus, New Delhi-110012
... of International Tomato Annotation Group release 2.4 version was used from http://solgenomics.
net/ and anthocyanin genes were predicted by using BLAST- Basic Local Alignment Search Tool
(http://blast.ncbi.nlm.nih.gov/ Blast.cgi) and FGENESH (www.softberry.com) gene ...
FGENESH 2014
International Biodeterioration & Biodegradation, 93, 186-194.
2014, 93, 186-194. DOI: 10.1016/j.ibiod.2014.06.001
Purification and characterization of a thermotolerant laccase isoform in Trametes trogii strain and its potential in dye decolorization
Yan J. et al.,
a Biotechnology Research Center of Life Science and Technology College, Kunming University of Science and Technology, Kunming Yunnan 650500, PR China
b College of Life Science, the Southwest Forest University, Kunming Yunnan 650224, PR China
... The gene structure and amino acid sequences of full laccase were predicted and analyzed
with Soft Berry-FGENSH/HMM-based gene structure prediction (http://linux1.softberry.com/
berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ...
Tree Genetics & Genomes
2014, 10(2), 251-260. DOI: 10.1007/s11295-013-0678-9
Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance
Schouten H. J. et al.,
1. Plant Breeding, Wageningen University and Research Centre, P.O. Box 386, 6700 AJ, Wageningen, The Netherlands
2. Inova Fruit, P.O. Box 222, 4190 CE, Geldermalsen, The Netherlands
... 2010b) was copied from the NCBI database (accession number GU295057.1). The
Vr2-A, Vr2-B, and Vr2-C amino acid sequences in GMAL 2473 were predicted by means
of the publicly available software FGENESH from SoftBerry. ...
PloS one
2014, 9(4), e93560. DOI: 10.1371/journal.pone.0093560
Whole Genome and Global Gene Expression Analyses of the Model Mushroom Flammulina velutipes Reveal a High Capacity for Lignocellulose Degradation
Park Y. J. et al.,
Department of Biomedical Chemistry, Konkuk University, Chung-Ju, Republic of Korea; Macrogen Inc., Seoul, Republic of Korea
... Gene identification was carried out using several methods, including ab initio gene structure
prediction (Fgenesh; http://www.softberry.com), a homology-based approach (Fgenesh+;
http://www.softberry.com), and transcriptome-based gene identification (Cufflinks; http://cufflinks ..
Cellular signalling
2014, 26(6), 1155-1165. DOI: 10.1016/j.cellsig.2014.02.003
Mature miR-183, negatively regulated by transcription factor GATA3, promotes 3T3-L1 adipogenesis through
inhibition of the canonical Wnt/b -catenin signaling pathway by targeting LRP6
Chen C. et al.,
a Key Laboratory of Swine Genetics and Breeding of Agricultural Ministry and Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, College of Animal Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China
... BDGP (http://www.fruitfly.org/seq_tools/promoter.html) and SoftBerry (http://linux1.softberry.com/
berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) computer programs were utilized
to analyze miR-183 gene structure, including TSS, CDS, and polyA signal. ...
Euphytica
2014, 196(3), 341-348. DOI: 10.1007/s10681-013-1037-5
Fine mapping of the uniform immature fruit color gene u in cucumber (Cucumis sativus L.)
Yang X et al.,
1. School of Agriculture and Biology, Shanghai Jiao Tong University, Dongchuan Road, Minhang District, Shanghai, 200240, China
2. Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences, Chenshan Botanical Garden, Shanghai, 201602, China
... (Voorrips 2002 ). Gene prediction in the target genomic DNA regions was performed
using the program FGENESH (Salamov and Solovyev 2000 ) (http://?linux1.?softberry.?
com/?), and the results were checked manually. Results. ...
Molecular Breeding
2014, 1-13. DOI: 10.1007/s11032-014-0088-1
Fine genetic mapping of a locus controlling short internode length in melon (Cucumis melo L.)
Hwang J. et al.,
1. Department of Horticultural Bioscience, Pusan National University, Miryang, 627-706, Republic of Korea
2. Gyeongnam Agricultural Research and Extension Services, Jinju, 663-985, Republic of Korea
... market type cucumber inbred line “9930” (Li et al. 2011b ) were determined using
FGENESH software (Softberry Inc., Mount Kisco NY, USA; http://?sunl.?softberry.?
com/?). Primer pairs were designed to amplify these exon ...
Fungal biology
2014, 118(2), 228-241. DOI: 10.1016/j.funbio.2013.12.001
The Podosphaera fusca TUB2 gene, a molecular “Swiss Army knife” with multiple applications in powdery mildew research
Vela-Corcia, D., Bellon-Gomez, D., Lopez-Ruiz, F., Tores, J. A., & Perez-Garcia, A.
a Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” - Universidad de Malaga - Consejo Superior de Investigaciones Cientificas (IHSM-UMA-CSIC), Departamento de Microbiologia, Universidad de Malaga, Bulevar Louis Pasteur 31 (Campus Universitario de Teatinos), 29071 Malaga, Spain
b Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” - Universidad de Malaga - Consejo Superior de Investigaciones Cientificas (IHSM-UMA-CSIC), Estacion Experimental “La Mayora”, 29750 Algarrobo-Costa, Malaga, Spain
... Potential open reading frames (ORFs), introns, and exons were predicted using
FGENESH software from SoftBerry (http://linux1.softberry.com/berry.phtml). Amino acid
alignments were performed with the CLC Main Workbench (Aarhus). ...
Gene
2014, 534(2), 204-217. DOI: 10.1016/j.gene.2013.10.058
Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes
Noh J. Y. et al.,
a Division of Plant Biotechnology, Institute of Environmentally-Friendly Agriculture (IEFA), College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea
b Department of Life Science and Biotechnology, College of Natural Sciences, Soonchunhyang University, Asan City 336-745 Republic of Korea
... sequencing method (see above). The fosmid library sequence information was used
for predicting TmapoLp-III gene architecture using FGENESH 2.6 software from Softberry
(http://linux1.softberry.com/berry.phtml/). The sequence of ...
Developmental & Comparative Immunology
2014, 46(2), 208-221. DOI: 10.1016/j.dci.2014.04.009
Gene structure, cDNA characterization and RNAi-based functional analysis of a myeloid differentiation factor 88 homolog in Tenebrio molitor larvae exposed to Staphylococcus aureus infection
Patnaik B. B. et al.,
a Division of Plant Biotechnology, Institute of Environmentally-Friendly Agriculture (IEFA), College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea
b Department of Life Science and Biotechnology, College of Natural Sciences, Soonchunhyang University, Asan City 336-745, Republic of Korea
... sequencing method (see above). 2.4. Sequence analysis. The fosmid clone
corresponding to TmMyD88 was analyzed using the FGENESH 2.6 program at
Softberry (http://linux1.softberry.com/berry.phtml/). The 5?-flanking ...
The ScientificWorld Journal
Volume 2014, Article ID 619746, 7 pages DOI: /10.1155/2014/619746
Genetic diversity analysis of Hypsizygus marmoreus with target region amplification polymorphism.
Qiu, C., Yan, W., Deng, W., Song, B., Li, T.
1 Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Open Laboratory of
Applied Microbiology, State Key Laboratory of Applied Microbiology South China, Guangdong Institute of Microbiology,
Guangzhou 510070, China
2Department of Biology, Chengdu Normal University, Chengdu 611130, China
... introns of sequence analyses were predicted by web-based program FGENESH [37-39]
(http://linux1.softberry.com/berry.phtml) Page 6. ... function proteins based on BLAST prediction
and open reading frame (ORF) analysis by web-based SoftBerry (Supplementary files 2). ...
Gene
Volume 546, Issue 2, 10 August 2014, Pages 250–256 DOI: 10.1016/j.gene.2014.06.001
Nucleotide diversity of Pita, a major blast resistance gene and identification of its minimal promoter.
Ramkumar G. et al.,
a Biotechnology, Crop Improvement, DRR-ICAR, Hyderabad-30, India
b Plant Pathology, DRR-ICAR, Hyderabad-30, India
... other default settings. Gene structure (length of open reading frame (ORF), number
of exons/introns, etc.) and protein sequences were predicted using online tool
softberry — FGENESH (http://linux1.softberry.com). Number of ...
Fungal biology
2014, 118(5), 453-461. DOI: 10.1016/j.funbio.2014.03.003
Molecular cloning and functional analysis of a H< sup>+-dependent phosphate transporter gene from the ectomycorrhizal fungus Boletus edulis in southwest China
Wang J. et al.,
Laboratory of Conservation and Utilization for Bioresources, Key Laboratory of Microbial Diversity in Southwest China, Ministry of Education, Yunnan University, Kunming, Yunnan Province, PR China
... Bioinformatic analysis. The open reading frame (ORF) was predicted using the ORF Finder
(http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi) and the SoftBerry-FGENESH database
(http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ...
Crop Science
2014, 54(3), 873-881. DOI: 10.2135/cropsci2013.09.0598
Fine Mapping of the Maize Cross-Incompatibility Locus Gametophytic Factor 1 (ga1) Using a Homogeneous Population.
Liu, X et al.,
2. Ajinomoto-Genetika Research Institute, 1st Dorozhny Pr. 1-1, 117545, Moscow, Russia
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
... The maize gene set (www.maizesequence.org) and website-based software FGENSH
(www.softberry.com) was applied to predict and filter the putative genes from the mapping interval.
RESULTS. The Homogeneous Population Mapping Approach for Ga1-S Allele. ...
Applied microbiology and biotechnology
2014, 98(1), 285-296. DOI: 10.1007/s00253-013-5289-8
MpigE, a gene involved in pigment biosynthesis in Monascus ruber M7
Liu Q et al.,
1. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China
3. National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China
... Amino acid sequence encoded by MpigE was predicted using SoftBerry's FGENESH
program (http://linux1.softberry. com/berry.phtml), and the MpigE functional regions were
analyzed using the Pfam 27.0 program (http://pfam.sanger.ac. uk/). ...
Gene
2014 DOI: 10.1016/j.gene.2014.01.008
The homoeologous genes encoding chalcone-flavanone isomerase in Triticum aestivum L.: structural characterization and expression in different parts of wheat plant
Shoeva, O. Y., Khlestkina, E. K., Berges, H., & Salina, E. A.
a Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia
b Novosibirsk State University, 630090, Russia
c INRA-CNRGV, Toulouse, 31326, France
... Gene annotation was performed by FGENESH program (Softberry Inc.,
linux1.softberry.com/berry.phtml) and confirmed by comparison of genomic nucleotide
sequence with available ESTs. MEGA v5.1 software (Tamura et al. ...
Applied microbiology and biotechnology
2014,Volume 98, Issue 11, pp 4987-4994. DOI: 10.1007/s00253-014-5509-x
A promiscuous prenyltransferase from Aspergillus oryzae catalyses C-prenylations of hydroxynaphthalenes in the presence of different prenyl donors
Pockrandt, D., Sack, C., Kosiol, T., & Li, S. M.
1. Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037, Marburg, Germany
... Computer-assisted sequence analysis The software FGENESH (Softberry, Inc; http://www.
softberry.com/berry.phtml) was used for prediction of exon and intron sequences. Alignments
of amino acid sequences were carried out by using the program BLAST (http://blast. ...
Marine genomics
2014, 13, 1-9. DOI: 10.1016/j.margen.2013.10.004
Presence of two tumor necrosis factor ( tnf)-? homologs on different chromosomes of zebrafish ( Danio rerio) and medaka ( Oryzias latipes)
Kinoshita, S., Biswas, G., Kono, T., Hikima, J., Sakai, M.
a Faculty of Agriculture, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan
b Interdisciplinary Graduate School of Agriculture and Engineering, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan
c Interdisciplinary Research Organization, University of Miyazaki, 1-1 Gakuenkibanadai-nishi, Miyazaki 889-2192, Japan
... For medaka tnf-n, the nucleic acid sequence was retrieved from medaka chromosome 16
(25694643-25698981) (Ensembl release 72) and amino acid (aa) sequence, exons and introns
were predicted using FGENESH in SoftBerry (http://linux1.softberry.com/berry.phtml). ...
Physiologia plantarum
, 150(1), 32-45. DOI: 10.1111/ppl.12064
Transcriptional regulation of the V?ATPase subunit c and V?PPase isoforms in Cucumis sativus under heavy metal stress
Kabala K. et al.,
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland
... cucumber sequences were then analyzed using gene finding programs identifying full-length
cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/
eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...
Journal of basic microbiology
28 APR 2014 DOI: 10.1002/jobm.201300814
Fan, L., Fu, K., Yu, C., Li, Y., Li, Y., & Chen, J. (2014). Thc6 protein, isolated from Trichoderma harzianum, can induce maize defense response against Curvularia lunata
Fan L. et al.,
Department of Resource and Environmental Science, School of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, China
... After predicting online on the softberry website (http://linux1.softberry.com/berry.phtml?
topic=fgenesh&group=programs&subgroup=gfind) and using PCR for confirmation, we
cloned a 710 bp cDNA fragment containing the T-DNA insertion site. ...
Plant Molecular Biology Reporter
2014, 1-21 DOI: 10.1007/s11105-014-0729-x
A Gene Encoding Cold-Circadian Rhythm-RNA Binding-Like Protein (CCR-Like) from Upland Cotton (Gossypium hirsutum L.) Confers Tolerance to Abiotic Stresses in Transgenic Tobacco
Dhandapani G. et al.,
1. National Research Centre on Plant Biotechnology, LBS Building, Pusa Campus, New Delhi, 110012, India
2. Department of Plant Science, Bharathidasan University, Tiruchirappalli, Tamil Nadu, India
... The amplified cDNA was cloned in pGEM T-Easy vector and sequenced. The full- length cDNA
sequence and coding sequence (CDS) were identified by the FGENESH analysis of softberry
software (www.softberry.com/) and the sequence has been submitted to the GenBank. ...
Journal of experimental botany
2014, eru041. DOI: 10.1093/jxb/eru041
Sixteen cytosolic glutamine synthetase genes identified in the Brassica napus L. genome are differentially regulated depending on nitrogen regimes and leaf senescence.
Orsel M. et al.,
1 INRA, UMR 1349 Institut de Genetique, Environnement et Protection des Plantes, INRA, Agrocampus Ouest, Universite de Rennes 1, F-35653 Le Rheu, France
2 INRA, UMR 1345 Institut de Recherche en Horticulture et Semences, F-49071 Beaucouze, France
...The deduced mRNA sequences (Supplementary Data File S5), obtained using FGENESH software available on the SoftBerry website (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group =programs&subgroup=gfind), showed very a high similarity with the contig sequences (Table 4) and allowed the gene structures to be deduced (Fig. 2). ...
Mycobiology
2014, 42(1), 34-40. DOI:10.5941/MYCO.2014.42.1.34
Three New Non-reducing Polyketide Synthase Genes from the Lichen-Forming Fungus Usnea longissima
Wang, Y., Wang, J., Cheong, Y. H., Hur, J. S.
1 Laboratory of Forest Plant Cultivation and Utilization, Yunnan Academy of Forestry, Kunming 650-204, China.
2 Korean Lichen Research Institute, Sunchon National University, Suncheon 540-742, Korea.
... Ltd. (Seoul, Korea). The potential open reading frame (ORF) was scanned with FGENESH [22]
using Aspergillus as the matrix (http://linux1.softberry.com). The putative function of these ORFs
was determined using a basic local alignment search tool (BLAST). ...
Molecular Breeding
2014, 33(4), 953-959. DOI:10.1007/s11032-013-0009-8
Intron loss in the chalcone-flavanone isomerase gene of rye
Khlestkina E. K., Shoeva O. Y.
1. Institute of Cytology and Genetics SB RAS, Lavrentjeva Ave. 10, 630090, Novosibirsk, Russia
2. Novosibirsk State University, Novosibirsk, Russia
... Gene structure was determined by FGENESH software (http://?linux1.?softberry.?com/?berry.?
phtml, Solovyev 2007 ) and confirmed by comparison of nucleotide sequence with the rye
expressed sequence tag BE705313 (http://?www.?ncbi.?nlm.?nih.?gov/?Database/?). ...
Food chemistry
2014, 148, 381-387 DOI: 10.1016/j.foodchem.2013.10.062
Two xylose-tolerant GH43 bifunctional ?-xylosidase/?-arabinosidases and one GH11 xylanase from Humicola insolens and their synergy in the degradation of xylan
Yang X. et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
b Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... deduce the amino acid sequences, respectively. The online software FGENESH
(http://linux1.softberry.com/berry.phtml) was used to predict the transcription initiation
sites, introns and exons. SignalP4.0 server (http://www.cbs ...
Acta Biochimica Polonica
2014, 61(1), 19-22. on-line at: www.actabp.p
Conversion of a diversity arrays technology marker differentiating wild and cultivated carrots to a co-dominant cleaved amplified polymorphic site marker
Macko-Podgorni A. et al.,
1 Institute of Plant Biology and Biotechnology, University of Agriculture Krakow, Krakow, Poland;
2 Department of Horticulture, University of
Wisconsin-Madison, Madison, USA;
3 USDA-Agricultural Research Service, Vegetable Crops Research Unit, University of Wisconsin, Madison, USA
... reported by Iorizzo et al. (2012) with blastn on a local BLAST server. The identified
con- tig was searched for presence of coding regions using FGENESH
(http://linux1.softberry.com/berry.phtml). The sequence was searched for ...
Molecular biology reports
July 2014, Volume 41, Issue 7, pp 4305-4312 DOI:10.1007/s11033-014-3301-8
RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.)
Patade V. Y. et al.,
1. Defence Institute of Bio-Energy Research, Haldwani-263 139, Nainital, Uttarakhand, India
... commercially (Eurofins, India). The sequence was analyzed for homology using Blast
program [ 22 ]. The gene structure was predicted using FGENESH 2.6 tool
(http://?linux1.?softberry.?com/?berry.?phtml). The Motif scanning ...
Nature
2014, 511(7508), E7-E9. DOI:10.1038/nature13446
TH2 and Treg candidate genes in elephant shark
Dijkstra, J. M.
Institute for Comprehensive Medical Science, Fujita Health University, Dengaku-gakubo 1-98, 470-1192 Toyoake, Aichi, Japan
... 2, the loop between ?-helices A and B; exon 3, ?-helices B and C; exon 4, ?-helix D. Genes without
messenger RNA reports were predicted from genomic DNA sequences using GENSCAN
(http://genes.mit.edu/GENSCAN.html) or FGENESH (http://linux1.softberry.com/berry ...
Plant Breeding
Volume 133, Issue 4, pages 470–479, August 2014 DOI:10.1111/pbr.12190
Genetic and functional analysis of tocopherol biosynthesis pathway genes from rapeseed (Brassica napus L.)
Fritsche S. et al.,
1 Plant Breeding Institute, Christian-Albrechts University of Kiel, Kiel, Germany
2 National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, China
... Institute 2012). Sequence comparisons were performed with the basic local
alignment search tool (BLAST). Intron–exon structures were predicted with the
bioinformatic tool FGENESH (SoftBerry FGENESH 2007). The NCBI ...
Plant molecular biology
2014, 84(1-2), 95-110 DOI:10.1007/s11103-013-0121-5
Association of jacalin-related lectins with wheat responses to stresses revealed by transcriptional profiling
Song M. et al.,
1. Crop Genomics and Bioinformatics Center and National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, People’s Republic of China
2. Guizhou Rapeseed Institute, Guizhou Academy of Agricultural Sciences, 270-0061, Baiyun Road, Guiyang, 550008, People’s Republic of China
... overlapped regions. Gene prediction was then performed using the gene-finding
program FGENESH (http://?www.?softberry.?com/?), and the coding DNA sequences
were verified by alignment with the homologous ESTs. Domain ...
DNA Research
2014, dsu016 DOI:10.1093/dnares/dsu016
Evolutionary History of Trihelix Family and Their Functional Diversification
Qin Y. et al.,
1 State Key Laboratory of Crop Biology, College of Agronomy, Shandong Agricultural University, 61 Daizong Street, Tai'an, Shandong 271018, People's Republic of China
2 Division of Biotechnology, College of Life Sciences and Biotechnology, Korea University, Seoul 136-713, Republic of Korea
... a cut-off value of e ?10 . As for confirmation of the predicted genes, manual correction
was performed using the online web server FGENESH (http://linux1.softberry.com/
berry.phtml). 28 The confirmed sequences were further ...
Gene
2014, 544(1), 83-92 DOI:10.1016/j.gene.2014.04.046
Genome-wide analysis of terpene synthases in soybean: functional characterization of GmTPS3
Liu J. et al.,
a National Center for Soybean Improvement, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Weigang 1, Nanjing 210095, China
b Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, National Engineering Research Center of Edible Fungi, Shanghai 201403, China
... soybean genome sequence assembly using TBLASTN. The gene prediction program
FGENESH (http://www.softberry.com) was used to predict the open reading frames
of putative TPS genes. Protein sequences deduced from the ...
Frontiers in Plant Science | Plant Genetics and Genomics
2014, 5, 339. DOI:10.3389/fpls.2014.00339
Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris)
Jackson, S.
1 Center forAppliedGeneticTechnologies,UniversityofGeorgia,Athens,GA,USA
2 US DepartmentofEnergyJointGenomeInstitute,WalnutCreek,CA,USA
... carry an extra ORF coding envelope-like proteins, the internal regions of 65 Ty1-copia and 78
Ty3-gypsy families were annotated using FGENESH (http://linux1.softberry.com) and ...
(http://linux1.softberry.com) and GENSCAN (http://genes.mit.edu/GENSCAN.html) programs. ...
Plant Molecular Biology Reporter
2014, 32(2), 476-486. DOI: 10.1007/s11105-013-0666-0
Molecular Cloning and Characterization of a Novel Polygalacturonase Gene, BcMF24, Involved in Pollen Development of Brassica campestris ssp. chinensis
Yu Y. et al.,
1. Laboratory of Cell and Molecular Biology, Institute of Vegetable Science, Zhejiang University, Hangzhou, 310058, China
... Full CDS sequences were analyzed by FGENESH (http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&subgroup=gfind), and the molecular characteristic of the deduced
protein was viewed on the ExPASy (http://web.expasy.org/compute_pi/). ...
Middle-East Journal of Scientific Research
2014, 20(3), 391-395. DOI:10.5829/idosi.mejsr.2014.20.03.11465
An Integrated Approach to Functional Genomics: Construction of a Novel Reporter Genomic Library for Osmium baselicum Plant.
Shah, G. C., Gupta, V., Khanuja, S. P. S.
1 Rajiv Gandhi College Satna M.P. India 2 Entral Institute of Medicinal and Aromatic Plant Lucknow U.P. India
... a new family, the oxidatively stable proteases previously p a r a m e t e r s thought to be present
only in bacteria. Phylogenetic http:linux1.softberry.coberry.phtml?topic=fgenesh&grp= studies
showed that many gene duplications and loss ograms&sub group=gfind. ...
Applied microbiology and biotechnology
2014, 98(11), 5019-5028. DOI:10.1007/s00253-014-5533-x
A novel bifunctional pectinase from Penicillium oxalicum SX6 with separate pectin methylesterase and polygalacturonase catalytic domains
Tu T. et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China
... as Lu and Moriyama (2004) described. Transcription initiation sites, intron, and exon
were predicted using the online software FGENESH (http://linux1.softberry.
com/berry.phtml/). Nucleotide and deduced amino acid sequence ...
Journal of industrial microbiology & biotechnology
2014, 41 (7), 1071-1083. DOI:10.1007/s10295-014-1453-0
A new acidophilic endo-b-1, 4-xylanase from Penicillium oxalicum: cloning, purification, and insights into the influence of metal ions on xylanase activity
Liao H. et al.,
1. Jiangsu Provincial Key Lab for Organic Solid Waste Utilization, Nanjing Agricultural University, Nanjing, 210095, China
2. Institute of Bast Fiber Crops and Center of Southern Economic Crops, Chinese Academy of Agricultural Sciences, Changsha, China
... Putative signal peptides were predicted using signalP (http://www.cbs.dtu.dk/services/
signalP/). The exon–intron structure of the full-length gene was predicted using the online
software fgenesh (http://linux1.softberry.com/ berry.phtml). ...
Crop and Pasture Science
2014, 65(1), 38-45. DOI:10.1071/CP13140
Isolation and characterisation of cytosolic glutamine synthetase (GSe) genes and association with grain protein content in durum wheat
Gadaleta, A. et al.,
A Department of Soil, Plant and Food Sciences, Section of Genetics and Plant Breeding, University of Bari ‘Aldo Moro’, Via G. Amendola 165/A – 70126 Bari, Italy.
... Genes prediction was conducted with the FGENESH program (http://linux1.softberry.com/berry.
phtml?topic=fgenes handgroup=programsandsubgroup=gfind). Consensus exon/ introns
boundaries were confirmed using grass expressed sequence tag sequences aligned to the ...
ChemBioChem
2014, 15(1), 108-116. DOI:10.1002/cbic.201300610
AstPT Catalyses both Reverse N1?and Regular C2 Prenylation of a Methylated Bisindolyl Benzoquinone
Tarcz S. et al.,
Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie und Biotechnologie, Deutschhausstrasse 17A, 35037 Marburg (Germany)
... Computer-assisted sequence analysis: The software packages DNASIS (version 2.1; Hitachi
Software Engineering, San Bruno, CA, USA) and FGENESH (Softberry, Inc; http://www.softberry.
com/berry.phtml) were used for intron prediction and sequence analysis, respectively. ...
Molecular biology reports
2014, 1-12. DOI:10.1007/s11033-014-3360-x
GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.)
Cai C. et al.,
1. State Key Laboratory of Crop Genetics & Germplasm Enhancement, Hybrid Cotton R & D Engineering Research Center, Ministry of Education, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, China
... Gene prediction was performed using the Fgenesh program in MolQuest software v1.3.1
(http://?linux1.?softberry.?com/?berry.?phtml), and predicted genes and their GO (Gene Ontology)
categories were annotated with the Blast2GO program ([ 18 ], http://?www.?blast2go ...
PloS one
2014, 9(1), e87723. DOI:10.1371/journal.pone.0087723
Citrus sinensis Annotation Project (CAP): A Comprehensive Database for Sweet Orange Genome
Wang, J. et al.,
Center for Bioinformatics, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, P.R. China, School of Science, Huazhong Agricultural University, Wuhan, P.R. China
... 8, detailed information includes the final gene model, RNA-seq and RNA-PET data from different
tissues, ESTs from sweet orange and other citrus species, and four ab initio gene prediction tools,
ie, Genscan [17], GeneID [18], FgeneSH (http://linux1.softberry.com/berry.phtml ...
Genome biology and evolution
2014, evu112 DOI: 10.1093/gbe/evu112
Recurrent horizontal transfers of Chapaev transposons in diverse invertebrate and vertebrate animals
Zhang, H. H., Feschotte, C., Han, M. J., Zhang, Z.
1School of Life Sciences, Chongqing University, Chongqing 400044, China
2 College of Life Sciences, Jiujiang University, Jiujiang 332000, China
... Sequence analysis Potential open reading frame (ORF) of Chapaev elements used in this study
was predicted using FGENESH (http://linux1.softberry.com/berry.phtml), GENSCAN
(http://genes.mit.edu/GENSCAN.html) or getorf in EMBOSS-6.3.1 package (Rice et al. 2000) ...
Molecular Genetics and Genomics
April 2014. DOI:10.1007/s00438-014-0848-y
High-resolution genetic mapping of rice bacterial blight resistance gene Xa23
Wang C. et al.,
1. National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI) Institute of Crop Science, Chinese Academy of Agriculture Sciences (CAAS), Beijing, 100081, People’s Republic of China
2. Liaocheng University, Liaocheng, 252059, Shandong Province, People’s Republic of China
... Based on the targeted region of Xa23 locus, genomic sequence of nipponbare between the
markers lj138 and a83B4 was downloaded from nCBI (http://www.ncb i.nlm.nih.gov) and
analyzed using the online software FGeneSH (http://linux1.softberry.com/). ...
FGENESH 2013
Applied Microbiology and Biotechnology
October 2013 DOI: 10.1007/s00253-013-5289-8
MpigE, a gene involved in pigment biosynthesis in Monascus ruber M7
Liu, et al.,
1. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China
3. National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China
... Amino acid sequence encoded by MpigE was predicted using SoftBerry's FGENESH
program (http://linux1.softberry. com/berry.phtml), and the MpigE functional regions were
analyzed using the Pfam 27.0 program (http://pfam.sanger.ac. uk/). ...
New Phytologist
200: 820–833. doi: 10.1111/nph.12396
Plant Defensin type 1 (PDF1): protein promiscuity and expression variation within the Arabidopsis genus shed light on zinc tolerance acquisition in Arabidopsis halleri.
Shahzad et al.,
1Biochimie et Physiologie Moleculaire des Plantes, Unite Mixte de Recherche Montpellier, SupAgro/CNRS/INRA/Universite Montpellier II, Montpellier Cedex 1, France
2Montpellier SupAgro, UMR AGAP, Montpellier, France
... Genes were predicted using the FGENESH program (Salamov & Solovyev, 2000)
under the SOFTBERRY software (www.softberry.com) and were annotated based
on BLAST similarity searches (Altschul et al., 1990). The presence ...
Cell Stress and Chaperones
Volume 18, Issue 3 , pp 321-331 DOI:10.1007/s12192-012-0384-9
Functional relevance of J-protein family of rice (Oryza sativa)
Neelam K Sarkar, Upasna Thapar, Preeti Kundnani, Priyankar Panwar, Anil Grover
1. Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, 110021, India
... FGENESH analysis of genomic sequence of Os03g12236 at softberry (www.softberry.
com/) revealed presence of one gene having 10 exons coding for 462 amino acid
protein. The amino acid sequence deduced from softberry ...
Phytopathology
November 2013, Volume 103, Number 11 Pages 1162-1168 http://dx.doi.org/10.1094/PHYTO-02-13-0044-R
Fine Mapping and Identification of Blast Resistance Gene Pi-hk1 in a Broad-Spectrum Resistant japonica Rice Landrace
Wu et al.,
State Key Laboratory of Crop Genetics & Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China. Y. Wu and Y. Bao contributed equally to this work.
... (http://genes.mit.edu/GENSCAN.html) and softberry (http://linux1.softberry.com/berry.phtml).
The predicted introns about 200-500bp were ... Page 7 of 28 Page 8. 8 FGENESH (http://linux1.
softberry.com/) and RiceGAAS (http://rgp.dna.affrc.go.jp) software (32). ...
Biotechnology Letters
Volume 35, Issue 9 , pp 1425-1432 DOI:10.1007/s10529-013-1219-1
Deletion of pigR gene in Monascus ruber leads to loss of pigment production
Nana Xie, Qingpei Liu, Fusheng Chen
1. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei, China
2. State Key Laboratory of Agricultural Microbiology, Wuhan, 430070, Hubei, China
... agitation. Three replicates of each sample were carried out. Sequence analysis. Amino
acid sequence encoded by pigR was predicted using the SoftBerry's FGENESH
program (http://linux1.softberry.com/berry.phtml). Homology ...
Heredity
(2013) 111, 57–65; doi:10.1038/hdy.2013.19; published online 3 April 2013
The discovery of Foxl2 paralogs in chondrichthyan, coelacanth and tetrapod genomes reveals an ancient duplication in vertebrates
M T Geraldo 1, G T Valente 1, A SK Braz 2 and C Martins 1
1Integrative Genomics Laboratory, Department of Morphology, Institute of Biosciences, Sao Paulo State University–UNESP, Botucatu, Sao Paulo, Brazil
2Laboratory of Computational Biology and Bioinformatics, Center of Natural and Human Sciences, Federal University of ABC–UFABC, Santo Andre, Sao Paulo, Brazil
... The sequences acquired were inserted into the online program Softberry FGENESH
(http://www.softberry.com/) using T. rubripes as the reference genome to recover the whole gene
transcriptional region and confirm the identification of genes in these syntenic regions ...
Microbiological Research
Volume 168, Issue 6, 19 July 2013, Pages 340–350 DOI: 10.1016/j.micres.2013.01.005
Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis
Cai et al.,
a Environment and Plant Protection College, Hainan University, Danzhou, Hainan 571737, China
b Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences (CATAS), Danzhou, Hainan 571737, China
... Sixteen T-DNA integration sites of transformants impaired in pathogenicity were identified, and
in most cases T-DNA integrated into a predicted ORF of putative genes based on gene structure
prediction by FGENESH program (Softberry Inc., Mount Kisco, NY, USA, http://linux1 ...
Cell Biology International
(2013) 37: 687–693. doi: 10.1002/cbin.10080
Computational prediction and characterisation of ubiquitously expressed new splice variant of Prkaca gene in mouse.
Banday, A. R., Azim, S., Hussain, M. A., Nehar, S. and Tabish, M.
1Faculty of Life Sciences, Department of Biochemistry, A.M. University, Aligarh, Uttar Pradesh, India
2P.G. Department of Zoology, Ranchi University, Ranchi, Jharkhand, India
.. were used at HMM gene (http://www.cbs.dtu.dk/services/HMMgene) (Lukashin and Borodovsky,
1998), Genescan (http://genes.mit.edu/GENSCAN.html), GeneSplicer (http://cbcb.umd.edu/
software/GeneSplicer/) (Pertea et al., 2001), FGENESH (http://www.softberry.com/berry ...
Nucl. Acids Res.
(1 January 2013) 41 (D1): D1192-D1198.
doi: 10.1093/nar/gks1090
OrysPSSP: a comparative Platform for Small Secreted Proteins from rice and other plants
Pan et al.,
Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, 2Shanghai Center for Bioinformation Technology, Shanghai 200235 and 3Tarim University, Alar, Xinjiang 843300, China
... Constructing the starting dataset of small peptides (25–250 aa in length) by combining
data from whole-genome screening and from gene modeling using Augustus (v2.5.5)
and FGENESH (Softberry, http://www.softberry.com) (34). ...
Trends in Bioinformatics
2013, Vol. 6 Issue 3, p62-90. 29p.
In-silico Study of Transcription Factor Binding Elements of Human PAX Gene Family Members
Rashmi et al.,
... For study of cis-acting elements-4000 upstream regions were retrieved using NCBI.
Cis-acting elements analysis were done using fgenesh tool of softberry server
(http://linuX1 .softberry.com/berry.phtml; Solovyev and Salamov, 1997). ...
Genes & Genomics
Volume 35, Issue 2 , pp 159-166 DOI:10.1007/s13258-013-0075-7
Nucleotide diversity of the upstream region of the putative MADS-box gene controlling soybean maturity
Jungmin Ha, Puji Lestari, Suk-Ha Lee
1. Department of Plant Science and Research Institute for Agriculture and Life Science, Seoul National University, Seoul, 151-921, Korea
2. Indonesian Center for Agricultural Biotechnology and Genetic Resources Research and Development, Jl. Tentara Pelajar No. 3A, Bogor, 16111, Indonesia
... BLAST algorithm. Any putative genes were also investigated with the FGENESH
software (http://linux1.softberry.com/berry.phtml) using the dicot plant option
(Arabidopsis). Primer design and PCR amplification. To amplify the ...
Physiologia Plantarum
Volume 150, Issue 1, pages 32–45, January 2014 DOI:10.1111/ppl.12064
Transcriptional regulation of the V-ATPase subunit c and V-PPase isoforms in Cucumis sativus under heavy metal stress
Katarzyna Kabala*, Malgorzata Janicka-Russak, Malgorzata Reda, Magdalena Migocka
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland
.. cucumber sequences were then analyzed using gene finding programs identifying full-length
cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/
eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...
Russian Journal of Plant Physiology
Volume 60, Issue 5 , pp 713-719 DOI:10.1134/S102144371305004X
Cloning and characterization of ethylene-insensitive 2 (EIN2) gene from Cucumis melo
F. Gao, J. Hao, Y. Yao, X. Wang, A. Hasi
1. College of Life Sciences, Inner Mongolia University, Hohhot, 010021, P.R. China
2. Inner Mongolia Key Laboratory of Herbage and Endemic Crop Biotechnology, Hohhot, 010021, P.R. China
... tigs that contain the genomic DNA sequence of the putative CsEIN2. (3) The gene prediction
program Softberry of FGENESH (http://linux1.soft berry.com/berry.phtml) was used to predict
multiple (alternative splice) variants of potential CsEIN2 genes in the cucumber genome ...
European Journal of Plant Pathology
Volume 137, Issue 1 , pp 55-65 DOI:10.1007/s10658-013-0216-5
Mining of rice blast resistance gene Pi54 shows effect of single nucleotide polymorphisms on phenotypic expression of the alleles
Kumari et al.,
1. National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, Room No 39, LBS Centre, Pusa Campus, New Delhi, 110012, India
2. Division of Crop Improvement, Indian Institute of Pulses Research, Kanpur, 208 024, Uttar Pradesh, India
... Eur J Plant Pathol Page 3. using Primer 3 software (www.softberry.com). The ... Eur J
Plant Pathol Page 4. performed to predict gene structure and ORF region using
FGENESH software trained for monocot (www.softberry.com). The ...
Phil. Trans. R. Soc. B
19 September 2013 vol. 368 no. 1626 20130047 DOI:10.1098/rstb.2013.0047
Functional endogenous viral elements in the genome of the parasitoid wasp Cotesia congregata: insights into the evolutionary dynamics of bracoviruses
Bezier et al.,
1Institut de Recherche sur la Biologie de l'Insecte, CNRS UMR 7261, Universite Francois Rabelais, Parc de Grandmont, 37200 Tours, France
2Commissariat a l'Energie Atomique, Genoscope (Centre National de Sequencage), 2 rue Gaston Cremieux, CP 5706, 91057 Evry Cedex, France
... For both Cotesia spp., gene predictions were performed using a combination of FGENESH and
FGENESH+ software from the SoftBerry platform with the Apis mellifera training set
(http://linux1.softberry.com/all.htm) and from the EMBL-EBI platform using Wise2 algorithms (http ...
Theoretical and Applied Genetics
Volume 126, Issue 1 , pp 219-229 DOI:10.1007/s00122-012-1975-7
Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.)
Huang et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, College of Life Science and Technology, Agricultural College, Guangxi University, Nanning, 530005, China
2. Rice Research Institute, Plant Protection Institute and Guangxi Rice Genetic Improvement and Biotechnology Lab, Guangxi Academy of Agricultural Sciences, Nanning, 530007, China
... The putative open reading frame (ORF) in the target region was predicted by the online
software GENESCAN and FGENESH of Softberry (www.softberry.com/berry.phtml) with
monocot plants as the model organism. Host selection behavior ...
Microbiology
October 2013 vol. 159 no. Pt 10 2169-2179 DOI:10.1099/mic.0.069542-0
CdpC2PT, a reverse prenyltransferase from Neosartorya fischeri with a distinct substrate preference from known C2-prenyltransferases
Kathrin Mundt 1,2 and Shu-Ming Li 1,2
1Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037 Marburg, Germany
2Zentrum fur Synthetische Mikrobiologie, Philipps-Universitat Marburg, 35032 Marburg, Germany
... al., 1988). Computer-assisted sequence analysis. For intron prediction and sequence
analysis, fgenesh (http://linux1.softberry.com) and dnasis (v. 2.1; Hitachi Software
Engineering) were used, respectively. Sequence identities ...
Molecular Genetics and Genomics
Volume 288, Issue 3-4 , pp 111-129 DOI:10.1007/s00438-013-0733-0
Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato
Zejun Huang, Jason Van Houten, Geoffrey Gonzalez, Han Xiao, Esther van der Knaap
1. Department of Horticulture and Crop Science, The Ohio State University/OARDC, 217A Williams Hall, 1680 Madison Avenue, Wooster, OH, 44691, USA
... solgenomics.net). We identified nine genes that were not in database ITAG Release
2.3 but appear to have protein coding potential based on annotation by FGENESH
(http://linux1.softberry.com/berry.phtml). Initial evidence ...
Euphytica
December 2013 DOI:10.1007/s10681-013-1037-5
Fine mapping of the uniform immature fruit color gene u in cucumber (Cucumis sativus L.)
Yang et al.,
1. School of Agriculture and Biology, Shanghai Jiao Tong University, Dongchuan Road, Minhang District, Shanghai, 200240, China
2. Shanghai Chenshan Plant Science Research Center, Chinese Academy of Sciences, Chenshan Botanical Garden, Shanghai, 201602, China
... (Voorrips 2002 ). Gene prediction in the target genomic DNA regions was performed
using the program FGENESH (Salamov and Solovyev 2000 ) (http://linux1.softberry.
com/), and the results were checked manually. Results. ...
Plant and Soil
Volume 364, Issue 1-2 , pp 245-260 DOI:10.1007/s11104-012-1345-x
The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber
M. Migocka, A. Warzybok, G. Klobus
1. Institute of Experimental Biology, Department of Plant Physiology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland
... AtNRT1 cDNAs were retrieved from the database and further analyzed using FGENESH and
FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www. ... The structure of each gene was
determined using FGENESH or FGENESH+ programs available on softberry.com ...
Tree Genetics & Genomes
November 2013 DOI:10.1007/s11295-013-0678-9
Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance
Schouten et al.,
1. Plant Breeding, Wageningen University and Research Centre, P.O. Box 386, 6700 AJ, Wageningen, The Netherlands
2. Inova Fruit, P.O. Box 222, 4190 CE, Geldermalsen, The Netherlands
3. Plant Pathology, Institute of Integrative Biology (IBZ), ETH Zurich, Universitatstrasse 2, 8092, Zurich, Switzerland
... 2010b) was copied from the NCBI database (accession number GU295057.1). The
Vr2-A, Vr2-B, and Vr2-C amino acid sequences in GMAL 2473 were predicted by means
of the publicly available software FGENESH from SoftBerry. ...
Applied Biochemistry and Biotechnology
Volume 169, Issue 3 , pp 941-949 DOI:10.1007/s12010-012-0048-3
Molecular Cloning and Expression of a Novel b-Glucosidase Gene from Phialophora sp. G5
Xuejun Li et al.,
1. Key Laboratory of Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China
2. Beijing Challenge Bio-Technology Co., Ltd., Beijing, 100081, People’s Republic of China
... designed on the assembled sequence. Sequence Analysis The introns, exons, and
transcription initiation sites were analyzed by FGENESH (http:// www.softberry.com/
berry.phtml/). Amino acid and nucleotide sequence alignments ...
Immunogenetics
Volume 65, Issue 7 , pp 531-541 DOI:10.1007/s00251-013-0692-y
IgH loci of American alligator and saltwater crocodile shed light on IgA evolution
Susana Magadan-Mompo, Christian Sanchez-Espinel, Francisco Gambon-Deza
1. Servicio Gallego de Salud (SERGAS) Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo, 36210, Pontevedra, Spain
3. Oceanographic Center of Vigo, Spanish Institute of Oceanography (IEO), Subida a Radio Faro 50, 36390, Vigo, Pontevedra, Spain
... Exons coding for the CH immunoglobulin domains were identified by aligning genomic and
predicted amino acid sequences with previously published reptile immunoglobu- lin sequences.
Limits were deduced using the FGENESH (www.softberry.com) (Solovyev et al. ...
Applied Microbiology and Biotechnology
Volume 97, Issue 4 , pp 1649-1660 DOI:10.1007/s00253-012-4130-0
Identification of a brevianamide F reverse prenyltransferase BrePT from Aspergillus versicolor with a broad substrate specificity towards tryptophan-containing cyclic dipeptides
Suqin Yin, Xia Yu, Qing Wang, Xiao-Qing Liu, Shu-Ming Li
1. College of Life Sciences, Capital Normal University, No.105 Xisanhuan Beilu, Beijing, 100048, China
2. Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037, Marburg, Germany
... Computer-assisted sequence analysis FGENESH (Softberry, Inc.) and the DNASIS
software pack- age (version 2.1: Hitachi Software Engineering, San Bruno, CA) were
used for intron prediction and sequence analysis, respectively. ...
PloS one
July 09, 2013DOI: 10.1371/journal.pone.0068260
A Superfamily of DNA Transposons Targeting Multicopy Small RNA Genes
Kenji K. Kojima, Jerzy Jurka
Genetic Information Research Institute, Mountain View, California, United States of America
... copies. Exon-intron boundaries were predicted with the aid of SoftBerry FGENESH:
(http://linux1.softberry.com/berry.phtml??topic=fgenesh&group=programs&subgroup=
gf?ind) and GENEID (http://genome.crg.es/geneid.html). ...
International Journal of Genomics and Proteomics
Volume 4, Issue 1, 2013, pp.-64-71 Available online at http://www.bioinfopublication.org/jouarchive.php?opt=&jouid=BPJ0000227
MOLECULAR MODELING OF ?-AMYLASE FROM GERMINATED SOYBEAN (Glycine max) AND
ITS FUNCTIONAL DIVERSITY
KUMARI A. 1, SINGH V.K. 2 AND KAYASTHA A.M. 1
1School of Biotechnology, Faculty of Science, Banaras Hindu University, Varanasi-221 005, UP, India.
2Centre for Bioinformatics, School of Biotechnology, Faculty of Science, Banaras Hindu University, Varanasi-221 005, UP, India.
... It showed similarity with Glycine max strain Wil- liams 82 clone GM_WBb0115J10
(AC235387.1). Full length gene prediction was done for obtained strain using Fgenesh (http://
sun1.softberry.com/berry.phtml) and -1000 upstream region was retrieved for promoter study ...
Food Chemistry
Volume 141, Issue 3, 1 December 2013, Pages 2974–2981 DOI:10.1016/j.foodchem.2013.05.132
High-yield production of a low-temperature-active polygalacturonase for papaya juice clarification
Tao Tu et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
b Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... Multiple alignments of protein sequences were performed using the ClustalW program
(http://www.ebi.ac.uk/clustalW/). Transcription initiation sites, intron, and exon were predicted
using the online software FGENESH (http://linux1.softberry.com/berry.phtml/). ...
Immunogenetics
Volume 65, Issue 5 , pp 387-396 DOI:10.1007/s00251-013-0678-9
Immunoglobulin light chains in medaka (Oryzias latipes)
Susana Magadan-Mompo, Anastasia M. Zimmerman, Christian Sanchez-Espinel, Francisco Gambon-Deza
1. Virologie et Immunologie Moleculaires, Institut National de la Recherche Agronomique (INRA), Domaine de Vilvert, 78352, Jouy-en-Josas, France
2. Department of Biology, College of Charleston, 66 George Street, Charleston, SC, 29424, USA
... 2009; Zimmerman et al. 2008; Bao et al. 2010). Boundaries of exons were deduced
using the software packages FGENESH (www.softberry.com) (Solovyev et al. 2006)
and Augustus (http://augustus.gobics.de/submission) (Stanke et al. ...
Mol Biol Rep.
2013 Mar;40(3):2645-62. doi: 10.1007/s11033-012-2351-z. Epub 2012 Dec 15.
Genome-wide identification, classification, and expression analysis of CDPK and its closely related gene families in poplar (Populus trichocarpa).
Genome-wide identification, classification, and expression analysis of CDPK and its closely related gene families in poplar (Populus trichocarpa). et al.,
CAS Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and BioProcess Technology, Chinese Academy of Sciences, Qingdao, Shandong, People's Republic of China.
... Local blast was performed using Arabid- opsis CDPK and its closely related kinase proteins as
queries for the identification of genes from Populus. Manual reanno- tation was also performed
using online web server FGENESH (http://linux1.softberry.com/berry.phtml). ...
Process Biochemistry
Volume 48, Issue 12, December 2013, Pages 1879–1885 DOI:10.1016/j.procbio.2013.08.020
A novel thermophilic xylanase from Achaetomium sp. Xz-8 with high catalytic efficiency and application potentials in the brewing and other industries
Zhao et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
b College of Life Science, Capital Normal University, Beijing 100048, PR China
... Genes, introns, exons and transcription initiation site were predicted using the online software
FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted using
SignalP 4.1 Server (http://www.cbs.dtu.dk/services/SignalP/). ...
Plant Molecular Biology Reporter
October 2013 DOI:10.1007/s11105-013-0666-0
Molecular Cloning and Characterization of a Novel Polygalacturonase Gene, BcMF24, Involved in Pollen Development of Brassica campestris ssp. chinensis
Youjian Yu, Meiling Lv, Ying Liang, Xingpeng Xiong, Jiashu Cao
1. Laboratory of Cell and Molecular Biology, Institute of Vegetable Science, Zhejiang University, Hangzhou, 310058, China
... Full CDS sequences were analyzed by FGENESH (http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&subgroup=gfind), and the molecular characteristic of the deduced
protein was viewed on the ExPASy (http://web.expasy.org/compute_pi/). ...
J. Agric. Food Chem.,
2013, 61 (28), pp 6880–6889DOI: 10.1021/jf4001296
Two Family 11 Xylanases from Achaetomium sp. Xz-8 with High Catalytic Efficiency and Application Potentials in the Brewing Industry
Zhao et al.,
† Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, People’s Republic of China
‡ College of Life Science, Capital Normal University, Beijing 100048, People’s Republic of China
... Genes, introns, exons, and transcription initiation sites were predicted using the online
software FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted
using SignalP 4.0 Server (http://www.cbs.dtu.dk/services/SignalP/). ...
Applied Microbiology and Biotechnology
Volume 97, Issue 18 , pp 8121-8128 DOI:10.1007/s00253-012-4656-1
A family 5 b-mannanase from the thermophilic fungus Thielavia arenaria XZ7 with typical thermophilic enzyme features
Lu et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No.12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China
2. College of Biotechnology, Tianjin University of Science and Technology, Tianjin, 3000457, People’s Republic of China
... nih.gov/gorf/gorf/gorf.html). The sequence assembly was per- formed using the Vector NTI
Advance 10.0 software (Invitrogen). Genes, introns, exons, and transcription initia- tion sites were
predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...
Mycorrhiza
Volume 23, Issue 7 , pp 573-584 DOI:10.1007/s00572-013-0498-7
The reduced mycorrhizal colonisation (rmc) mutation of tomato disrupts five gene sequences including the CYCLOPS/IPD3 homologue
Larkan et al.,
1. School of Plant Biology M090, The University of Western Australia, 35 Stirling Highway, Crawley, Perth, Western Australia, 6009, Australia
2. Agriculture and Agri-Food Canada, 107 Science Place, Saskatoon, Saskatchewan, S7N0X2, Canada
3. Donald Danforth Plant Science Centre, 975 N Warson Rd, St Louis, MO, 63132, USA
... Page 6. Genes within this sequence were predicted using FGENESH software (softberry.com). ...
FGENESH gene prediction software (softberry.com) was used to annotate the region and to
determine whether any match to known mycorrhiza-regulating genes could be identified. ...
Eukaryotic Cell
September 2013 vol. 12 no. 9 1214-1224 DOI:10.1128/EC.00159-13
Unraveling the Molecular Basis of Temperature-Dependent Genetic Regulation in Penicillium marneffei
Yang et al.,
Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas, USAa
Department of Microbiology, University of Hong Kong, Hong Kongb
Center for Clinical Laboratory, Zhujiang Hospital, Southern Medical University, Guangzhou, People's Republic of China
... Genes with a false discovery rate (FDR) of <0.05 as reported by all three packages were
considered to be differentially expressed. Gene prediction and identification of orthologs.Ab initio
gene predictions were performed using FGENESH (SoftBerry, Mount Kisco, NY). ...
Crop and Pasture Science
DOI:10.1071/CP13140
Isolation and characterisation of cytosolic glutamine synthetase (GSe) genes and association with grain protein content in durum wheat
Gadaleta et al.,
A Department of Soil, Plant and Food Sciences, Section of Genetics and Plant Breeding, University of Bari ‘Aldo Moro’, Via G. Amendola 165/A – 70126 Bari, Italy.
... Genes prediction was conducted with the FGENESH program (http://linux1.softberry.com/berry.
phtml?topic=fgenes handgroup=programsandsubgroup=gfind). Consensus exon/ introns
boundaries were confirmed using grass expressed sequence tag sequences aligned to the ...
Appl. Environ. Microbiol.
March 2013 vol. 79 no. 6 2038-2047 DOI:10.1128/AEM.03334-12
Characterization of the Biosynthetic Genes for 10,11-Dehydrocurvularin, a Heat Shock Response-Modulating Anticancer Fungal Polyketide from Aspergillus terreus
Xu et al.,
aNatural Products Center, School of Natural Resources and the Environment, College of Agriculture and Life Sciences, The University of Arizona, Tucson, Arizona, USA
bInstitut fur Chemie, Technische Universitat Berlin, Berlin, Germany
... earlier (17). Hidden Markov model (HMM)-based gene models were built with
FGENESH (Softberry) with additional exon/intron boundary refinements in
SPLICEVIEW (http://zeus2.itb.cnr.it/?webgene/wwwspliceview.html). The ...
IJEB
Vol.51(12) [December 2013] pp. 1130-1136
Molecular cloning and mRNA expression profile of Sucrose Transporter Gene BnSUT1C from Brassica napus L.
Li et al.,
... suite (Windows version 5.0.2; DNASTAR, Madison, Wis.). The complete open reading
frame (ORF) was identified with program FGENESH (http://www.softberry.com/berry.
phtml). Primers were designed in the predicted 5' and ...
Advanced BioTech
Volume:12 Issue:11 May 10, 2013
Isolation and in silico Depiction of Novel R2-R3 MYB Transcription Factors from Sugarcane
Pranali A. Kulkarni1, Prabu G.R. and Rachayya M. Devarumath
1. Molecular Biology & Genetic Engineering Division, Vasantdada Sugar Institute, Manjari (Bk.), Tal. Haveli, Pune-412307, Maharashtra, India.
2. Department of Biotechnology, University of Pune, Pune-411005, Maharashtra, India.
3. Department of Biotechnology, School of Life Sciences, Karpagam University, Pollachi Coimbatore – 641021, Tamil Nadu, India.
... The nucleotide sequences of SbMYB18 and SoMYB18 were processed for deducing
the exon and intron pattern online using fGENESH Hidden Markov Model (HMM) based
gene structure prediction tool (www.softberry.com/berry.phtml). ...
Plant Molecular Biology Reporter
Volume 31, Issue 6 , pp 1249-1260 DOI:10.1007/s11105-013-0585-0
Structure, Evolution, and Expression of the b-Galactosidase Gene Family in Brassica campestris ssp. chinensis
Jinlong Liu, Minghui Gao, Meiling Lv, Jiashu Cao
1. Laboratory of Cell & Molecular Biology, Institute of Vegetable Science, Zhejiang University, Hangzhou, 310058, China
... Each of the BGAL gene loci in Arabidopsis was used to obtain all possible BGAL genes in B.
campestris from BRAD (Table 1). Each predicted BGAL gene sequence in B. campestris was
confirmed by FGENESH (http://www.softberry.com/berry.phtml?topic=fgenesh). ...
PloS one
May 28, 2013DOI: 10.1371/journal.pone.0064432
Adaptive Selection on Bracovirus Genomes Drives the Specialization of Cotesia Parasitoid Wasps
Jancek et al.,
Institut de Recherches sur la Biologie de l’Insecte, UMR 7261 CNRS, Universite Francois-Rabelais, UFR Sciences et Techniques, Parc Grandmont, Tours, France
aboratoire Evolution, Genomes et Speciation, CNRS UPR9034, IRD UR 072 and Universite Paris Sud, Gif sur Yvette, France, Unite de Recherche UMR 1272, Physiologie de l’Insecte, Signalisation et Communication, INRA, Versailles, France
... Gene predictions on CskBV newly sequenced contigs and BACs and on CsmBV BACs were
made with SoftBerry's FGENESH de novo prediction tool [37] and FGENESH+ using the honeybee
(Apis mellifera L.) training set and were manually corrected by comparison with ...
Molecular Immunology
Volume 56, Issue 4, 31 December 2013, Pages 745–756 DOI:10.1016/j.molimm.2013.07.012
Accessory molecules for Toll-like receptors in Teleost fish. Identification of TLR4 interactor with leucine-rich repeats (TRIL)
Danilo Pietretti a, Herman P. Spaink b, Alberto Falco a, Maria Forlenza a, Geert F. Wiegertjes a,
a Cell Biology and Immunology Group, Wageningen Institute of Animal Sciences, Wageningen University, PO Box 338, 6700 AH Wageningen, The Netherlands
b Institute of Biology, Leiden University, Einsteinweg 55, 2333 CC Leiden, The Netherlands
... al., 2012). Genomic information was then used to predict nucleotide and protein
sequences using FGENESH version 2.5 (www.softberry.com). Table 1. Accessory
molecules present in teleost fish species. Accessory molecules ...
Theoretical and Applied Genetics
October 2013 DOI:10.1007/s00122-013-2205-7
A putative candidate for the recessive gall midge resistance gene gm3 in rice identified and validated
Sama et al.,
1. Directorate of Rice Research, Rajendranagar, Hyderabad, 500030, Andhra Pradesh, India
2. International Crops Research Institute for the Semi-Arid Tropics, Patancheru, 502324, Andhra Pradesh, India
... The down- loaded sequences were then analyzed using the software package FGeneSH
(http://www.softberry.com) for open reading frames (OrFs) and annotated using BlAST-P utility
(http://www.ncbi.nlm.nih.gov) to identify the puta- tive function of each gene present in the ...
Plant Cell Reports
November 2013, DOI:10.1007/s00299-013-1535-x
Transcriptional regulation of early embryo development in the model legume Medicago truncatula
Sergey Kurdyukov, Youhong Song, Michael B. Sheahan, Ray J. Rose
1. Australian Research Council Centre of Excellence for Integrative Legume Research, School of Environmental and Life Sciences, The University of Newcastle, Callaghan, NSW, 2308, Australia
2. Kolling Institute of Medical Research, Kolling Building, Royal North Shore Hospital, St Leonards, NSW, 2065, Australia
... The corresponding gene loci and protein sequences were obtained from the Mt3.5
genome release (http://www.medicagohapmap.org), or where unavailable, they were
predicted directly using FGENESH (http://www.softberry.com). ...
J Hered
(2013) 104 (1): 134-139. doi: 10.1093/jhered/ess075
Localization of a New Gene for Bitterness in Cucumber
Zhang et al.,
From the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 10081 China (Zhang, Miao, Sun, Wang, Huang, and Gu); and the Department of Horticultural Science, North Carolina State University, Raleigh, NC 27695-7609 (Wehner).
... Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and
verified by FGENESH (http://sunl.softberry.com/) (Salamov and Solovyev 2000), GENESCAN
(http://genes.mit.edu/GENSCAN.html) (Burge and Karlin 1997), TwinScan (http://mblab ...
Arthropod-Plant Interactions
Volume 7, Issue 4 , pp 389-402 DOI:10.1007/s11829-013-9253-4
Hessian fly larval attack triggers elevated expression of disease resistance dirigent-like protein-encoding gene, HfrDrd, in resistant wheat
Subhashree Subramanyam, Cheng Zheng, John T. Shukle, Christie E. Williams
1. Department of Agronomy, Purdue University, West Lafayette, IN, 47907, USA
2. Novartis Pharmaceuticals Corporation, East Hanover, NJ, 07936, USA
... subcellular localization of HFRDRD proteins. Structural analysis of the genomic sequence
was performed using the FGENESH program (http://linux1.softberry.com/berry.phtml).
Phylogenetic analysis. In order to explore the evolutionary ...
Microbial Pathogenesis
Volume 64, November 2013, Pages 6–17 DOI:10.1016/j.micpath.2013.06.001
Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis
Liu et al.,
a The Key Lab of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan 430070, Hubei, PR China
b School of Environmental Sciences, University of Guelph, Guelph, ON N1G 2W1, Canada
c Department of Biology, University of Saskatchewan, Saskatoon S7N 5E2, Canada
... algorithm of the Basic Local Alignment Search Tool [25] hosted by the National Center for
Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov), and open reading frames were
further analyzed using the gene prediction program FGENESH (Softberry Inc., Mount Kisco ...
Planta
Volume 238, Issue 2 , pp 293-305 DOI:10.1007/s00425-013-1891-3
Analysis of nucleotide diversity among alleles of the major bacterial blight resistance gene Xa27 in cultivars of rice (Oryza sativa) and its wild relatives
Bimolata et al.,
1. Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Prof. C. R. Rao Road, Gachibowli, Hyderabad, 500046, India
2. Crop Improvement Section, Directorate of Rice Research, Rajendranagar, Hyderabad, 500030, India
... Based on the sequences obtained from the genotypes under study, the coding regions
and the UTR regions of the new alleles were predicted through the software utility,
FGENESH (http://www.softberry.com) (Salamov and Solovyer 2000 ). ...
G3
March 1, 2013 vol. 3 no. 3 563-572 DOI:10.1534/g3.113.005587
Fine-Mapping and Identification of a Candidate Gene Underlying the d2 Dwarfing Phenotype in Pearl Millet, Cenchrus americanus (L.) Morrone
Parvathaneni et al.,
*Institute of Plant Breeding, Genetics and Genomics, University of Georgia, Athens, Georgia 30602
†Department of Crop and Soil Sciences, University of Georgia, Athens, Georgia 30602
... respectively. The sequence of BAC 293B22 has been deposited in GenBank under
accession number KC463796. Gene prediction was performed using FGENESH
with the monocot training set (www.softberry.com). Repetitive ...
Theoretical and Applied Genetics
Volume 126, Issue 10 , pp 2643-2653 DOI:10.1007/s00122-013-2162-1
Fine mapping of the Ph-3 gene conferring resistance to late blight (Phytophthora infestans) in tomato
Zhang et al.,
1. The Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Zhongguancunnandajie 12, Beijing, 100081, People’s Republic of China
2. Wageningen UR Plant Breeding, Wageningen University and Research Center, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands
... MapQTl 4.0 (Van Ooijen and Maliepaard 1996) was used to perform the QTl analysis. Gene
prediction and sequence analysis The online program FGeneSH was used to pre- dict open
reading frames (OrFs) in the target region (http://linux1.softberry.com/). ...
PloS one
September 24, 2013DOI: 10.1371/journal.pone.0075544
Dynamic Evolution of Rht-1 Homologous Regions in Grass Genomes
Wu et al.,
Key Laboratory of Crop Germplasm Resources and Utilization, Ministry of Agriculture, the National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, the Chinese Academy of Agricultural Sciences, Beijing, China
Plant Germplasm and Genomics Center, Germplasm Bank of Wild Species in Southwest China, Kunming Institute of Botany, the Chinese Academy of Sciences, Kunming, China
... Repeats/ gene_annotation.pdf). Here, gene predictions were performed mainly by
using the program FGENESH with training sets of the monocots including maize,
rice, wheat and barley (http://www.softberry.com). In addition ...
Heredity
110, 570-577 (June 2013) | doi:10.1038/hdy.2013.2
Diversity and abundance of the abnormal chromosome 10 meiotic drive complex in Zea mays
Kanizay et al.,
... Masked contigs were then mapped with BLAST to the non-redundant nucleotide and protein
databases at NCBI with an e-value cutoff of 10 ?5 (Supplementary Table 2). Gene models were
identified using FGenesH (SOFTBERRY) and Augustus (http://bioinf.uni-greifswald.de ...
BMC Genomics.
2013; 14: 169. DOI:10.1186/1471-2164-14-169
Transcriptome analysis of pigeon milk production – role of cornification and triglyceride synthesis genes
Gillespie et al.,
Australian Animal Health Laboratory, CSIRO Animal, Food and Health Sciences, 5 Portarlington Road, Geelong, Victoria, Australia
2School of Life and Environmental Sciences, Deakin University, Pigdons Road, Geelong, Victoria 3216, Australia
...The scaffolds of interest were then submitted to a Hidden Markov Model gene prediction program
(FGENESH, Softberry; http://linux1.softberry.com/berry.phtml) using parameters for chicken (aves) to identify predicted full-length gene sequences. Where scaffolds were too large to be processed by FGENESH, the region of the scaffold with the BLAST match was submitted....
Molecular Biology Reports
Volume 40, Issue 2 , pp 1385-1396 DOI:10.1007/s11033-012-2182-y
Characterization of the NADP-malic enzymes in the woody plant Populus trichocarpa
Yu et al.,
1. State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, 26 Hexing Road, Harbin, 150040, China
... We performed the PtNADP-ME4 gene structure (exons and introns) prediction using the
FGENESH program on the SoftBerry server (http://www.soflberry.corn/berry.phtml), and
present new predicted PtNADP-ME4 gene sequences (Table S1). ...
Front Plant Sci.
2013; 4: 318. DOI:10.3389/fpls.2013.00318
A comparison of the molecular organization of genomic regions associated with resistance to common bacterial blight in two Phaseolus vulgaris genotypes
Perry et al.,
1Department of Plant Agriculture, University of Guelph, Guelph, ON, Canada
2Department of Biological Sciences, University of Windsor, Windsor, ON, Canada
...The sequence data was examined for open reading frames using FGENESH (http://www.softberry.org), with the Medicago gene model....
New Phytologist
197: 595–605. doi: 10.1111/nph.12043
The Brassica napus blackleg resistance gene LepR3 encodes a receptor-like protein triggered by the Leptosphaeria maculans effector AVRLM1.
Larkan et al.,
1Saskatoon Research Centre, Agriculture and Agri-Food Canada, Saskatoon, SK, Canada
2School of Plant Biology, University of Western Australia, Crawley, WA, Australia
3The UWA Institute of Agriculture, University of Western Australia, Crawley, WA, Australia
... Identification, cloning and transformation of candidate gene. A B. rapa BAC spanning the
LepR3 interval was annotated for gene content using fgenesh software (www.softberry.
com) trained to 'Dicot plants (Arabidopsis)' to predict gene content. ...
Theoretical and Applied Genetics
Volume 126, Issue 8 , pp 2187-2196 DOI:10.1007/s00122-013-2128-3
Fine mapping of the pleiotropic locus B for black spine and orange mature fruit color in cucumber identifies a 50 kb region containing a R2R3-MYB transcription factor
Yuhong Li, Changlong Wen, Yiqun Weng
1. Horticulture College, Northwest A&F University, Yangling, 712100, China
2. Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA
... with preceding fragment. Gene prediction in target genomic DNA regions was
performed with the computer program FGENESH (Salamov and Solovyev 2000)
(http://sunl.softberry.com/) and checked manually. Candidate gene ...
The Plant Cell
July 2013 vol. 25 no. 7 2536-2544 DOI:10.?1105/?tpc.?113.?111856
Formation and Expression of Pseudogenes on the B Chromosome of Rye
Ali Mohammad Banaei-Moghaddam, Karla Meier, Raheleh Karimi-Ashtiyani and Andreas Houben 1
Leibniz Institute of Plant Genetics and Crop Plant Research, 06466 Gatersleben, Germany
... Therefore, the genomic sequences of all fragments were BLASTed against the rye EST
database (Haseneyer et al., 2011) and analyzed using FGENESH software
(http://linux1.softberry.com/berry.phtml) (see Supplemental Figure 1 online). ...
Front Plant Sci.
2013; 4: 258. DOI:10.3389/fpls.2013.00258
Investigating the beneficial traits of Trichoderma hamatum GD12 for sustainable agriculture—insights from genomics
Studholme et al.,
1Biosciences, Molecular Plant Pathology, College of Life and Environmental Sciences, University of Exeter, Exeter, UK
2Plant Biology and Crop Science, Rothamsted Research, Harpenden, UK
Edited by: Corne M. J. Pieterse, Utrecht University, Netherlands
... (1991). Bioinformatics methods. We used Velvet version 1.1.04 (Zerbino and Birney, 2008)
for de novo assembly of genome sequence. For ab initio gene prediction we used FgenesH
(http://linux1.softberry.com/berry.phtml?topic=fgenesh). ...
Plant Science
Volume 210, September 2013, Pages 241–249 DOI:10.1016/j.plantsci.2013.06.003
Mutation of OsDET1 increases chlorophyll content in rice
Huang et al.,
a Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, 174 Shazheng Street, Shapingba District, Chongqing 400030, China
b Institute of Rice, Chongqing Academy of Agricultural Sciences, Chongqing, China
... mapped to a 87-kb DNA region (Fig. 1a). Eight annotated candidate genes were located
in the DNA region using the program FGENESH 2.2 (www.softberry.com). Further
amplification of the relevant DNA fragments and sequence ...
G3
January 1, 2013 vol. 3 no. 1 41-63 doi: 10.1534/g3.112.004044
Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Manning et al.,
*Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331
†Department of Forest Sciences, University of British Columbia, Vancouver, British Columbia, Canada, V6T 1Z4
‡Carbone/Ferguson Laboratories, Division of Neuroscience, Oregon National Primate Research Center (ONPRC), Beaverton, Oregon 97006
...Protein-encoding genes were annotated using a combination of manual curation, EST alignments, and ab initio gene predictions made by
FGENESH, FGENESH+ (http://linux1.softberry.com) and GENEID (http://genome.crg.es/software/geneid). ...
Physiological and Molecular Plant Pathology
Volume 84, October 2013, Pages 76–85 DOI:10.1016/j.pmpp.2013.07.007
Foatf1, a bZIP transcription factor of Fusarium oxysporum f. sp. cubense, is involved in pathogenesis by regulating the oxidative stress responses of Cavendish banana (Musa spp.)
Xingzhu Qi b, Lijia Guo a, c, Laying Yang a, c, Junsheng Huang a, c,
a Institute of Environment and Plant Protection, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
b College of Agriculture Hainan University, Haikou 570228, China
c Key Laboratory of Monitoring and Control of Tropical Agricultural and Forest Invasive Alien Pests, Ministry of Agriculture, Haikou 571101, China
... The protein-encoding gene sequence was submitted to a gene-finding program (FGENESH A,
Softberry Inc.) to perform automated annotation and obtain the putative mRNA sequence of Foatf1.
The PCR primers were designed based on the putative mRNA sequence of Foatf1. ...
PloS one
December 16, 2013DOI: 10.1371/journal.pone.0082353
Mating Type Locus of Chinese Black Truffles Reveals Heterothallism and the Presence of Cryptic Species within the T. indicum Species Complex
Beatrice Belfiori, Claudia Riccioni, Francesco Paolocci, Andrea Rubini
Institute of Biosciences and BioResources - Perugia Division, National Research Council, Perugia, Italy
... www.geneious.com). Gene prediction analyses were performed using FGENESH
(http://linux1.softberry.com/berry.phtml). RNA Isolation and Reverse-transcription
Polymerase Chain Reaction Analysis. Total RNA was isolated ...
Plant Disease
February 2013, Volume 97, Number 2 Pages 245-251 http://dx.doi.org/10.1094/PDIS-11-11-0941-RE
Chromosomal Mapping and QTL Analysis of Resistance to Downy Mildew in Cucumis sativus
S. P. Zhang et al.,
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China;
... Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and
veriWed by FGENESH (http://linuxl.softberry.com/) (40), GENESCAN (http://genes.mit.edu/
GENSCAN.html) (4), TwinScan (http:// mblab.wustl.edu/software/download/) (24), and then ...
Phytopathology
June 2013, Volume 103, Number 6 Pages 594-599 http://dx.doi.org/10.1094/PHYTO-10-12-0260-R
Functional Analysis of Pid3-A4, an Ortholog of Rice Blast Resistance Gene Pid3 Revealed by Allele Mining in Common Wild Rice
Qiming Lv et al.,
Rice Research Institute, Sichuan Agricultural University, Chengdu 611130, China
... 9-bp deletion, in addition to many SNPs, compared with that of Pid3. According to the computer
program FGENESH (http://www.softberry.com), the two genes should have predicted promoter
regions beginning 900-bp from their respective start codons, ...
BMC Plant Biology
2013, 13:162 doi:10.1186/1471-2229-13-162
Combined linkage and association mapping reveals candidates for Scmv1, a major locus involved in resistance to sugarcane mosaic virus (SCMV) in maize
Tao et al.,
1 National Maize Improvement Center, China Agricultural University, 2 West Yuanmingyuan Road, Beijing 100193, People’s Republic of China
2 Department of Agronomy, Iowa State University, 1204 Agronomy Hall, Ames, Iowa 50011, USA
3 Research Center Flakkebjerg, University of Aarhus, 4200, Slagelse, Denmark
... We used Fgenesh software (http://linux1.softberry.com/berry.phtml, version 2.6) to predict ten
putative genes from the masked sequence, including seven genes with putative functions, two
hypothetical genes, and one gene without significant similarity to known genes (Figure 3C ...
J Hered
(2013) 104 (2): 273-286. doi: 10.1093/jhered/ess102
Identification and Characterization of a Homologue to the Arabidopsis INDEHISCENT Gene in Common Bean
Tania Gioia, Giuseppina Logozzo, James Kami, Pierluigi Spagnoletti Zeuli and Paul Gepts
From the Scuola di Scienze Agrarie, Forestali, Alimentari ed Ambientali, Universita degli Studi della Basilicata, Viale dell’Ateneo Lucano 10, 85100 Potenza, Italy (Gioia, Logozzo, Spagnoletti Zeuli); and the Department of Plant Sciences/MS1, University of California, 1 Shields Avenue, Davis, CA 95616–8780 (Kami and Gepts).
... with AtIND. Gene structure was predicted using the software FGENESH
(http://linux1.softberry.com/berry.phtml), whereas the search for ORFs was performed
using ORF finder (http://www.ncbi.nlm.nih.gov/projects/gorf/). To identify ...
J. Exp. Bot.
(2013) 64 (2): 651-663. doi: 10.1093/jxb/ers363
Identification of differentially methylated regions during vernalization revealed a role for RNA methyltransferases in bolting
Hebrard et al.,
1 Universite d’Orleans, UFR/Faculte des Sciences, UPRES EA 1207 Laboratoire de Biologie des Ligneux et des Grandes Cultures, INRA USC1328 ARCHE, rue de Chartres, BP6759, 45067 Orleans cedex 2, France
2 SESVanderHave N.V./S.A., Soldatenplein Z2 nr15, Industriepark, B-3300 Tienen, Belgium
... The identification of potential transposable elements (TEs) in the RLGS genomic sequences
was realized by the identification of potential coding sequences (FGENESH on http://linux1.
softberry.com/berry.phtml) followed by BLASTP analysis and the search of dispersed ...
Ann Bot
(2013) 111 (2): 305-315. doi: 10.1093/aob/mcs260
A triallelic genetic male sterility locus in Brassica napus: an integrative strategy for its physical mapping and possible local chromosome evolution around it
Lu et al.,
1National Key Laboratory of Crop Genetic Improvement, Key Laboratory of Rapeseed Genetic Improvement (Ministry of Agriculture), Huazhong Agricultural University, Wuhan 430070, China
2Dandong Academy of Agricultural Sciences, Fengcheng 118109, P.R. China
... Polymerase (Finnzymes Oy, Espoo, Finland). The website-based software FGENSH
(http://www.softberry.com) was employed to predict the putative open reading frames
(ORFs) located in the target region. The Plant Repeat Databases ...
Molecular Genetics and Genomics
December 2013 DOI:10.1007/s00438-013-0795-z
A systematic exploration of high-temperature stress-responsive genes in potato using large-scale yeast functional screening
Baniekal Hiremath Gangadhar, Jae Woong Yu, Kappachery Sajeesh, Se Won Park
1. Department of Molecular Biotechnology, Konkuk University, Seoul, 143701, South-Korea
... FGeneSH (http://linux1.softberry.com/berry.phtml?topic=fgenesh &group=programs&subgroup=
gfind) was used for those sequences for which we could not able to find possible OrF using
GenSCan (Burge and Karlin 1998; Salamov and Solovyev 2000). ...
Crop Science
27 Nov. 2013; doi: 10.2135/cropsci2013.09.0598
Fine Mapping of the Cross-incompatibility Locus Gametophytic Factor 1 (ga1) Using a Homogeneous Maize Population 2
Liu et al.,
1 State Key Laboratory of Crop Biology, Shandong Agricultural University, Daizong Street 61, Taian, Shandong, 271018, CHINA
2 College of Life Science, Shandong University, Shanda South Street 27, Jinan, 250100, CHINA
... polyacrylamide gel and visualized with ethidium bromide staining. The maize gene 18 set
(www.maizeequence.org) and website-based software FGENSH 19 (http://www.softberry.com)
was applied to predict and filter the putative genes from 20 the mapping interval. 21 22 ...
Appl. Environ. Microbiol.
June 2013 vol. 79 no. 12 3770-3778 DOI:10.1128/AEM.03833-12
Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens
Aylward et al.,
Department of Bacteriology, University of Wisconsin—Madison, Madison, Wisconsin, USAa
Department of Energy Great Lakes Bioenergy Research Center, University of Wisconsin—Madison, Madison, Wisconsin, USAb
... Amino acid sequences for the nucleotide sequences of these CAZyme genes were
obtained using a combination of 6-frame translation, the software program FGENESH
(Softberry), and BLASTX (27) against the NCBI NR database (44). ...
New Phytologist
197: 416–430. doi: 10.1111/nph.12026
Methylome of DNase I sensitive chromatin in Populus trichocarpa shoot apical meristematic cells: a simplified approach revealing characteristics of gene-body DNA methylation in open chromatin state.
Lafon-Placette et al.,
1Universite d'Orleans, Faculte des Sciences, Laboratoire de Biologie des Ligneux et des Grandes Cultures (LBLGC), Orleans, France
2INRA, USC1328 Arbres et Reponses aux Contraintes Hydriques et Environnementales (ARCHE), Orleans, France
... Identification of transposase was performed using Fgenesh software (http://linux1.softberry.com/
berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) and confirmed by TBlastX
analysis (e-value < 10 ?30 ) on a flowering plant transcripts database. ...
Genetics
September 1, 2013 vol. 195 no. 1 263-273 DOI:10.1534/genetics.113.152330
Cloning and Characterization of a Critical Regulator for Preharvest Sprouting in Wheat
Liu et al.,
*Department of Agronomy, Kansas State University, Manhattan, Kansas 66506
†Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506
‡Faculty of Science, Genomics and Biotechnology Section, Department of Biological Sciences, King Abdulaziz University, Jeddah 21589, Saudi Arabia
... Bobwhite as control. Bioinformatics and statistical analysis. Genomic sequences
from the three BACs covering the Qphs.pseru-3AS region were annotated using
FGENESH (http://linux1.softberry.com/berry.phtml). The promoter ...
New Phytologist
200: 675–690. doi: 10.1111/nph.12414
A metabolic gene cluster in Lotus japonicus discloses novel enzyme functions and products in triterpene biosynthesis
Krokida et al.,
1Department of Biochemistry and Biotechnology, University of Thessaly, Larisa, Greece
2Department of Metabolic Biology, John Innes Centre, Norwich, UK
3Unidad de Biotecnologia, Centro de Investigacion Cientifica de Yucatan, Merida, Yucatan, Mexico
... A region of c. 300 kb flanking each side of the OSC genes was screened and analysed using
FGENESH gene prediction software (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=
programs&subgroup=gfind) and GeneScanwebserver (Burge & Karlin, 1998). ...
BMC Genomics
2013, 14:683 doi:10.1186/1471-2164-14-683
A draft Musa balbisiana genome sequence for molecular genetics in polyploid, inter- and intra-specific Musa hybrids
Davey et al.,
1 Laboratory of Fruit Breeding and Biotechnology, Division of Crop Biotechnics, Department of Biosystems, Katholieke Universiteit Leuven, Willem de Croylaan 42, box 2427B-3001, Heverlee, Leuven, Belgium
2 Centre for Research in Biotechnology for Agriculture and Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur 50603, Malaysia
... B-genome annotation. Ab initio gene prediction was carried out using the FGENESH
software, available online from http://linux1.softberry.com/all.htm webcite and using
the default parameters and the 'monocot model plant' parameters. ...
Acta Physiologiae Plantarum
Volume 35, Issue 2 , pp 483-500 DOI:10.1007/s11738-012-1091-y
Analysis of the expression, subcellular and tissue localisation of phosphoglucan, water dikinase (PWD/GWD3) in Solanum tuberosum L.: a bioinformatics approach for the comparative analysis of two ?-glucan, water dikinases (GWDs) from Solanum tuberosum L.
Orzechowski et al.,
1. Department of Biochemistry, Faculty of Agriculture and Biology, Warsaw University of Life Sciences, SGGW, Nowoursynowska 159, 02-776, Warsaw, Poland
2. Department of Biometrics and Bioinformatics, Faculty of Agriculture and Biology, Warsaw University of Life Sciences, SGGW, Nowoursynowska 159, 02-776, Warsaw, Poland
... Identification of the coding region, open reading frames and the translation of the StGWD3 nucleotide sequence was based on the
FGENESH gene structure prediction based on the Hidden Markov Model (HMM) constructed for Nicotiana tabacum (Solanaceae) genome (http://?linux1.?softberry.?com/?berry.?phtml). ...
Plant Molecular Biology Reporter
Volume 32, Issue 1 , pp 28-41 DOI:10.1007/s11105-013-0597-9
Genome-Wide Identification, Classification, Expression Profiling, and SSR Marker Development of the MADS-Box Gene Family in Citrus
Hou et al.,
1. Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan, 430070, China
... pseudogenes or incorrect annotations because of the lack of a start or stop codon in the open
reading frame, and manual reannotation was performed to correct and reannotate the putative
MADS-box using an online web server FGENESH (http://linux1.softberry.com/ berry.phtml ...
Planta
Volume 237, Issue 1 , pp 279-292 DOI:10.1007/s00425-012-1756-1
Young Leaf Chlorosis 1, a chloroplast-localized gene required for chlorophyll and lutein accumulation during early leaf development in rice
Zhou et al.,
1. National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing, 210095, China
2. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... P0027G10. Within this region, five ORFs were predicted using the program FGENESH
2.2 (http://www. softberry.com) (Fig. 2b). To determine the mutation site, all five cDNA
sequences were separately isolated from young leaves. ...
Fungal Diversity
May 2013, Volume 60, Issue 1, pp 161-170, DOI:10.1007/s13225-013-0228-7
Getting to the bottom of Taxol biosynthesis by fungi
Uwe Heinig, Susanne Scholz, Stefan Jennewein
1. Fraunhofer Institut fur Molekularbiologie und Angewandte Okologie, Forckenbeckstrasse 6, 52074, Aachen, Germany
... Sequence analysis Sequences were analyzed using CLC Combined Workbench v3.6.1,
Lasergene 7 Package, NCBI Blast and CloneManager Professional Suite 8. FGENESH
was use for ORF and protein prediction (http://linux1.softberry.com/). ...
Journal of Plant Interactions
Volume 8, Issue 1, 2013 pages 34-44 DOI:10.1080/17429145.2012.721523
Positive selection pressure on rice blast resistance allele Piz-t makes it divergent in Indian land races
Thakur et al.,
a National Research Centre on Plant Biotechnology , IARI , New Delhi , 110012 , India
b Deparment of Biotechnology , Himachal Pradesh University , Shimla , 171005 , India
... BioEdit Software version 7.0.9.0 (www.mbio.ncsu.edu). Gene coding regions were
predicted with FGENESH (www.softberry.com) using the Piz-t sequence as reference.
The functional domain(s) which play an important role ...
Scientia Horticulturae
Volume 164, 17 December 2013, Pages 323–332 DOI:10.1016/j.scienta.2013.09.040
Transcriptional profile of differentially expressed genes related to abortive flower buds under short light period stress in petunia
Yue et al.,
Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Sciences, Huazhong Agricultural University, No. 1, Shizishan Street, Hongshan District, Wuhan 430070, Hubei Province, China
... 2.7. Sequence and bioinformatics analysis of Phms2. Through EST blast analysis in the
genome database of petunia, we successfully predicted the full-length open reading frame
(ORF) of Phms2 using the FGENESH tool (http://www.softberry.com). ...
Front Plant Sci.
2013; 4: 317. DOI:10.3389/fpls.2013.00317
In silico comparison of genomic regions containing genes coding for enzymes and transcription factors for the phenylpropanoid pathway in Phaseolus vulgaris L. and Glycine max L. Merr
Reinprecht et al.,
1Department of Plant Agriculture, University of Guelph, Guelph, ON, Canada
2Department of Plant Sciences, North Dakota State University, Fargo, ND, USA
Edited by: Georgina Hernandez, Universidad Nacional Autonoma de Mexico, Mexico
Reviewed by: Alejandra A. Covarrubias, Universidad Nacional Autonoma de Mexico, Mexico; Steven B. Cannon, United States Department of Agriculture, USA
... The consensus sequence was analyzed for the presence of coding regions with GENSCAN
(http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/) using Medicago
truncatula and Arabidopsis, respectively as the model organisms. ...
ACS Chem. Biol.
2013, 8 (4), pp 741–748 DOI: 10.1021/cb3006787
Complexity Generation in Fungal Peptidyl Alkaloid Biosynthesis: A Two-Enzyme Pathway to the Hexacyclic MDR Export Pump Inhibitor Ardeemin
Stuart W. Haynes †, Xue Gao ‡, Yi Tang *‡§, and Christopher T. Walsh *†
† Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, 240 Longwood Avenue, Boston, Massachusetts 02115, United States
‡Department of Chemical and Biomolecular Engineering and §Department of Chemistry and Biochemistry, University of California Los Angeles, 420 Westwood Plaza, Los Angeles, California 90095, United States
... Contigs containing candidate clusters were examined using eukaryotic gene predictor
FGENESH (Softberry), and predicted proteins surrounding the candidate
Ant-activating NRPS were examined by repeated BLAST search. ...
Theoretical and Applied Genetics
Volume 126, Issue 7 , pp 1825-1838 DOI:10.1007/s00122-013-2095-8
Fine mapping and identification of candidate genes controlling the resistance to southern root-knot nematode in PI 96354
Anh-Tung Pham, Kaitlin McNally, Hussein Abdel-Haleem, H. Roger Boerma, Zenglu Li
1. Center for Applied Genetic Technologies and Department of Crop and Soil Sciences, University of Georgia, Athens, GA, 30602, USA
2. Institute for Plant Biology, University of Zurich, Zurich, Switzerland
3. Georgia Seed Development Commission, Athens, GA, 30605, USA
... genes. In addition to using soybase's gene model, we also used the programs
Fgenesh (http://linux1.softberry.com) and Expasy (http://web.expasy.org/cgi-bin/
translate/dna_aa) to predict gene structure and protein sequence. ...
Int. J. Mol. Sci.
2013, 14(7), 13559-13576; doi:10.3390/ijms140713559
First Insights into the Large Genome of Epimedium sagittatum (Sieb. et Zucc) Maxim, a Chinese Traditional Medicinal Plant
Liu et al.,
1 Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China
2 University of Chinese Academy of Sciences, Beijing 100039, China
... protein database (NR) [72]. Secondly, ab initio gene prediction was performed on
the ENS dataset using the FGENESH feature (Dicot plants-Arabidopsis) of the
MolQuest software package (softberry) [73]. Thirdly, a local BLAST ...
J. Integr. Plant Biol.
(2013) 55(7):643–653. DOI:10.1111/jipb.12068
Genome-wide analysis of the Sus gene family in cotton.
Zou et al.,
State Key Laboratory of Cotton Biology, Institute of Cotton Research, the Chinese Academy of Agricultural Sciences, Anyang, China
... DNA sequences or were predicted online using FGENESH (http://linux1.softberry.com/berry.
phtml?topic=fgenesh&group=programs &subgroup=gfind). Predicted conserved domains
were screened by SMART (http://smart.embl-heidelberg.de/) and ...
Experimental & Molecular Medicine
(2013) 45, e31; doi:10.1038/emm.2013.59
A known expressed sequence tag, BM742401, is a potent lincRNA inhibiting cancer metastasis
Park et al.,
1Medical Genomics Research Center, KRIBB, Daejeon, Republic of Korea
2Department of Functional Genomics, University of Science and Technology, Daejeon, Republic of Korea
3Department of General Surgery, College of Medicine, Chungnam National University, Daejeon, Republic of Korea
... indicating that our putative lincRNAs are not protein-coding genes: first, when we predicted open
reading frames of our putative lincRNAs using gene prediction programs, such as GeneScan
(http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com/), we ...
PloS one
February 01, 2013DOI: 10.1371/journal.pone.0055185
Genomic and Secretomic Analyses Reveal Unique Features of the Lignocellulolytic Enzyme System of Penicillium decumbens
Liu et al.,
State Key Laboratory of Microbial Technology, Shandong University, Jinan, Shandong, China
Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China
... Gene Finding and Annotation. Gene models were predicted independently with a set
of gene finders including Augustus [58], GeneMark-ES [59], GeneId [60] and SoftBerry
eukaryotic gene finding suite (Fgenesh and Fgenesh+) [61]. ...
Journal of Integrative Plant Biology
Volume DOI:10.1111/jipb.12150
Auxin biosynthesis by the YUCCA6 flavin monooxygenase gene in woodland strawberry (Fragaria vesca)
Liu et al.,
1Forestry and Fruit Tree Research Institute, Shanghai Key Laboratory of Protected Horticultural Technology, Shanghai Academy of Agricultural Sciences (SAAS), Shanghai, China
2Shanghai Key Laboratory of Agricultural Genetics and Breeding, Institute of Biotechnology, SAAS, Shanghai, China
3Departamento de Biologia Moleculary Bioquimica, Universidad de Malaga, Malaga, Spain
... genes (Cheng et al. 2006) as query sequences. Hereafter, HMM-based gene structure
prediction was carried out using the FGENESH program (default values) at
http://linux1.softberry.com/berry.phtml. To confirm these candidates ...
BMC Genomics
2013, 14:60 doi:10.1186/1471-2164-14-60
Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements
Fellers et al.,
1 USDA-ARS, Hard Winter Wheat Genetics Research Unit, Department of Plant Pathology, Manhattan, KS, 66506, USA
2 Agriculture & Agri-Food Canada, Pacific Agri-Food Research Centre, Summerland, BC, V0H 1Z0, Canada
... Louis, MO. BAC clones were cultured, subcloned, shot gun sequenced, and assembled
(Washington University Genome Center, St. Louis, MO). Gene calls were made using FGENESH
with gene models specific to Puccinia (http://linux1.softberry.com/berry.phtml webcite;). ...
BMC plant biology
(2013). 13(1), 89. DOI:10.1186/1471-2229-13-89
Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in the conifer picea abies reveals extensive conservation as well as dynamic patterns.
Hedman, H., Zhu, T., von Arnold, S., & Sohlberg, J. J.
Department of Plant Biology and Forest Genetics, Uppsala BioCenter, Swedish University of Agricultural Sciences and Linnean Center for Plant Biology, PO-Box 7080, Uppsala, SE, 75007, Sweden
... Gene predictions were performed with FGENESH (http://linux1.softberry.com/berry.phtml) trained
with dicot plants (Arabidopsis thaliana). Primer sequences are listed in Additional file 5. Gene and
cDNA accessions are listed in Additional file 6. Phylogenetic analysis ...
ChemBioChem.
(2013). Volume 15, Issue 2, pages 284–292, January 24, 2014 DOI:10.1002/cbic.201300626
Identification of the First Diphenyl Ether Gene Cluster for Pestheic Acid Biosynthesis in Plant Endophyte Pestalotiopsis fici
Xu et al.,
1State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, Beijing 100101 (China)
2Beijing Institute of Pharmacology & Toxicology, 27 Taiping Road, Haidian District, Beijing 100850 (China)
... the accession number KC145148. The ORFs were predicted from the sequence by
using the GENSCAN Web Server at MIT (http://genes.mit.edu/GENSCAN.html) and
FGENESH (Softberry). The deduced proteins of corresponding ...
BMC plant biology
(2013). 13(1), 126. DOI:10.1186/1471-2229-13-126
Molecular cloning and characterisation of SlAGO family in tomato
Xian et al.,
Genetic Engineering Research Center, School of Life Sciences, Chongqing University, Chongqing 400044, People’s Republic of China
... After searching for AGO genes, bioinformatics tools, such as FGENESH (http://linux1.softberry.
com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) was used to analyze and
predict those unknown SlAGOs, and BLASTX of NCBI (http://blast.ncbi.nlm.nih.gov/Blast ...
BMC genomics
(2013). 14(1), 1-11. DOI:
Haplotype analysis of sucrose synthase gene family in three Saccharum species
Zhang, J., Arro, J., Chen, Y., & Ming, R.
(1)College of Life Sciences, Fujian Normal University, Fuzhou, 350108, China
(2)Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA
... For genomic sequences that had not previously been annotated, we supplemented the above methods with the
use of Genscan (http://?genes.?mit.?edu/?GENSCAN.?html)[43] and FGENESH (http://?linux1.?softberry.?com/?berry.?phtml) gene prediction software....
International journal of molecular sciences
(2013). 14(11), 22462-22482. DOI:10.3390/ijms141122462
Cloning, Characterization and Effect of TmPGRP-LE Gene Silencing on Survival of Tenebrio Molitor against Listeria monocytogenes Infection
Tindwa et al.,
1 Division of Plant Biotechnology, Institute of Environmentally-Friendly Agriculture (IEFA), College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Korea
2 National Research Laboratory of Defense Proteins, College of Pharmacy, Pusan National University, Jangjeon Dong, Kumjeong Ku, Busan 609-735, Korea
... 1.0, NetOGlyc, NetPhos 2.0 and NetPhosK 1.0 server respectively (Technical
University of Denmark, Lyngby, Denmark). The potential coding region was predicted
using FGENESH (Softberry, Inc., Mount Kisco, NY, USA) [44]. ...
BMC microbiology
(2013). 13(1), 165. DOI:10.1186/1471-2180-13-165
Conservation of the genes for HC-toxin biosynthesis in Alternaria jesenskae
Wight, W. D., Labuda, R., & Walton, J. D.
1 Department of Energy Plant Research Laboratory, Michigan State University, 612 Wilson Road, Room 210, East Lansing, MI 48824, USA
2 Romer Labs Division Holding GmbH, Technopark 1, Tulln 3430, Austria
... Page 14. (http://www.ebi.ac.uk/Tools/msa/clustalw2/), and SPIDEY (NCBI). Assembly of predicted
protein sequences was performed using DNASTAR Lasergene software with assistance from
FGENESH (www.softberry.com) with Alternaria as the training model. ...
BMC genomics
(2013). 14(1), 335. DOI:10.1186/1471-2164-14-335
Frequent loss of lineages and deficient duplications accounted for low copy number of disease resistance genes in Cucurbitaceae
Lin, X., Zhang, Y., Kuang, H., & Chen, J.
Key Laboratory of Horticulture Biology, Ministry of Education, and Department of Vegetable Crops, College of Horticulture and Forestry, Huazhong Agricultural University, Wuhan 430070, P.R. China
... 3,110 protein sequences with ATP binding domain and 6,979 protein sequences with LRR domain
from NCBI was used to verify the potential NBS- LRR or LRR-LRK encoding genes [3]. All
identified sequences were annotated using FGENESH [www.softberry.com] and ...
BMC genomics
(2013). 14(1), 109. DOI:
Genome-wide analysis of NBS-encoding disease resistance genes in Cucumis sativus and phylogenetic study of NBS-encoding genes in Cucurbitaceae crops
Wan, H., Yuan, W., Bo, K., Shen, J., Pang, X., & Chen, J.
State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, People’s Republic of China
...the upstream and downstream of BLAST hits, were annotated using the FGENESH...
PloS one
(2013). 8(4), e62288. DOI:10.1371/journal.pone.0062288
Genome-Wide Expression Analysis of Soybean MADS Genes Showing Potential Function in the Seed Development
Fan et al.,
MOA Key Lab of Soybean Biology (Beijing), National Key Facility of Crop Gene Resource and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China College of Life Sciences, Henan Agricultural University, Zhengzhou, Henan, China
... The fragment genes were predicted the whole CDS by FGENESH (http://linux1.softberry.com/berry.phtml) or blasting the NCBI Ref-RNA database (Table S1)....
Mobile DNA
(2013). 4(1), 12.
Homologues of bacterial TnpB_IS605 are widespread in diverse eukaryotic transposable elements
Bao, W., & Jurka, J.
Genetic Information Research Institute, 1925 Landings Drive, Mountain View,
CA 94043, USA
... The TE-encoded multiple-exon genes were predicted by FGENESH program (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind), ...
BMC genomics
(2013). 14(1), 79. DOI:10.1186/1471-2164-14-79
Comparative genomics of Lupinus angustifolius gene-rich regions: BAC library exploration, genetic mapping and cytogenetics
Ksiazkiewicz et al.,
1 Institute of Plant Genetics, Polish Academy of Sciences, Strzeszynska 34, 60-479, Poznan, Poland
2 Laboratory of Computational Genomics, Institute of Molecular Biology and Biotechnology, Adam Mickiewicz University, Umultowska 89, 61-614, Poznan, Poland
...BAC sequences with masked repetitive regions were subjected to FGENESH [42,43]in silico gene prediction followed by BLAST against the EST, nr, and Swiss-Prot [44] c...
FGENESH 2012
Nature Genetics
2012 44, 1060–1065. doi:10.1038/ng.2372
Lifestyle transitions in plant pathogenic Colletotrichum fungi deciphered by genome and transcriptome analyses.
O'Connell et al.,
Department of Plant Microbe Interactions, Max Planck Institute for Plant Breeding Research, Cologne, Germany.
Centro Hispano-Luso de Investigaciones Agrarias, Departamento de Microbiologia y Genetica, Universidad de Salamanca, Villamayor, Spain.
...Gene structures were predicted using the Broad Institute automated gene-calling pipeline35
based on a combination of gene models predicted by the programs FGENESH (Softberry Inc., USA),
GENEID36, GeneMark37, SNAP38 and Augustus39 together with EST-based and manually curated gene models.
GENEID, FGENESH, SNAP and Augustus were trained using a set of high-confidence EST-based gene models
generated by clustering Blat-aligned species-specific ESTs....
J. Exp. Bot.
(2012) 63 (1): 203-214. doi: 10.1093/jxb/err264
Molecular characterization of 60 isolated wheat MYB genes and analysis of their expression during abiotic stress
Lichao Zhang,
Guangyao Zhao,
Jizeng Jia,
Xu Liu and
Xiuying Kong *
The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
... Only the sequences that shared >95% matches were considered redundant. The
open reading frames (ORFs) were predicted using FGENESH (http://www.softberry.com) and were translated into amino acid sequences. Finally ...
Applied Microbiology and Biotechnology
June 2012 DOI
10.1007/s00253-012-4130-0
Identification of a brevianamide F reverse prenyltransferase BrePT from Aspergillus versicolor with a broad substrate specificity towards tryptophan-containing cyclic dipeptides
Suqin Yin,
Xia Yu,
Qing Wang,
Xiao-Qing Liu,
Shu-Ming Li
1. College of Life Sciences, Capital Normal University, No.105 Xisanhuan Beilu, Beijing, 100048, China
2. Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037, Marburg, Germany
... Computer-assisted sequence analysis FGENESH (Softberry, Inc.) and the DNASIS
software pack- age (version 2.1: Hitachi Software Engineering, San Bruno, CA) were
used for intron prediction and sequence analysis, respectively. ...
Journal of Industrial Microbiology & Biotechnology
June 2012, Volume 39, Issue 6, pp 869-876 DOI: 10.1007/s10295-012-1087-z
High-level expression of a novel Penicillium endo-1,3(4)-b-d-glucanase with high specific activity in Pichia pastoris
Chen et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China
... respectively. The cod- ing region was predicted online using the FGENESH program
(http://linux1.softberry.com/berry.phtml/). SignalP 4.0 web server (http://www.cbs.dtu.
dk/services/SignalP/) was used to predict the signal peptide. ...
Immunogenetics
DOI: 10.1007/s00251-012-0672-7
Immunoglobulin genes of the turtles
Susana Magadan-Mompo, Christian Sanchez-Espinel &
Francisco Gambon-Deza
Servicio Gallego de Salud (SERGAS) Unidad de Inmunologia,
Hospital do Meixoeiro, Carretera de Madrid s/n,
Vigo 36210, Pontevedra, Spain
Shared Unit of Immunology, Vigo University Hospital Complex
(Hospital Meixoeiro), University of Vigo,
Edificio de Ciencias Experimentales, Rua das Abeleiras,
Campus As Lagoas-Marcosende,
Vigo 36310, Pontevedra, Spain
... Identification
of the exons coding for the constant heavy (CH) domains was performed using the software
FGENESH (www.softberry.com) (Solovyev et al. 2006; Yao et al. ...
Advances in Environment, Computational Chemistry and Bioscience
ISBN: 978-1-61804-147-0
In silico study of non-coding, coding transcription region and domain
interaction for chromosomal translocation sequences
PRAVEEN KUNAR KORLA 1, SHAN-CHIH LEE 2 , JIM SHEU 3, JACK CHENG 3,
KA-LOK NG 1
1 Department of Biomedical Informatics,Asia University, Taichung,TAIWAN 41354
2 School of Medical Imaging and Radiological Sciences, Chung Shan Medical University, Taichung, TAIWAN
40201
... The URL addresses for these web based tools are;Fgenesh (http://linux1.softberry.com/berry.
phtml), Genemark (http://exon.gatech.edu/eukhmm.cgi), Genscan (http://immunax.dfci.harvard.
edu/Tools/genscan.ht ml) and Webgene (http://zeus2.itb.cnr.it/~webgene/genebuilder.html ...
Cereal Research Communications
Volume 40, Number 3/September 2012 pp. 362-372 DOI: 10.1556/CRC.40.2012.3.5
Molecular mapping of quantitative trait loci for flag leaf length and other agronomic traits in rice (Oryza sativa)
Sonah et al.,
1 National Research Centre on Plant Biotechnology New Delhi 110012 India
2 Directorate of Rice Research Hyderabad AP India
... sativa subsp. japonica cv. Nipponbare (http://rice.plantbiology.msu.edu/) was used
for gene prediction. FGENESH gene prediction software (www.softberry.com) was
used to predict genes in this sequence. Predicted genes ...
Animal Science Journal
Volume 83, Issue 5, pages 386–393, May 2012 DOI: 10.1111/j.1740-0929.2011.00975.x
Predictive mutational bioinformatic analysis of variation in the skin and wool associated corneodesmosin (CDSN) gene in sheep
SUBRAMANIAM et al.,
1 Western Australian Biomedical Research Institute (WABRI) & Centre for Health Innovation Research Institute (CHIRI), School of Biomedical Sciences, Curtin University, Perth
2 School of Biological Sciences, Murdoch University, Murdoch, Australia
... Gene prediction tools such as GENSCAN (Burge & Karlin 1997), FGENESH
(http://www.softberry.com), HMM gene (http://www.cbs.dtu.dk/services/HMMgene/),
Augus- tas (Stanke et al. 2006) and GeneMark (Lomsadze et al. ...
Mol Biol Evol
(2012) 29 (2): 861-871.
doi: 10.1093/molbev/msr261
First published online: October 14, 2011
Dynamic Gene Copy Number Variation in Collinear Regions of Grass Genomes
Jian-Hong Xu 1,†, Jeffrey L. Bennetzen 2 and Joachim Messing 1
1 Waksman Institute of Microbiology, Rutgers, The State University of New Jersey
2 Department of Genetics, University of Georgia
... About 100 kb–1 Mb chromosomal regions of alpha setarin gene loci were annotated by
Fgenesh software (http://linux1.softberry.com/berry.phtml) for gene models, and repeats
sequences were masked by Repeatmasker (http://www.repeatmasker.org/). ...
Archives of Insect Biochemistry and Physiology
Volume 79, Issue 2, pages 87–103, February 2012 DOI: 10.1002/arch.21014
ANNOTATION AND EVOLUTION OF THE ANTIOXIDANT GENES IN THE SILKWORM, Bombyx mori
Gui-Qin Shi 1, Quan-You Yu 1, Ze Zhang 1,2
1The Institute of Agricultural and Life Sciences, Chongqing University, Chongqing, China
2The Key Sericultural Laboratory of the Agricultural Ministry of China, Southwest University, Chongqing, China
... If some genome sequences showed even weak sequence similarity to any query sequences,
their flanking regions (1 kb or more long) were manually extracted, and then put them into
Softberry database to predict new genes using FGENESH program. ...
Journal of Microbiological Methods
Volume 91, Issue 3, December 2012, Pages 412–419 DOI: 10.1016/j.mimet.2012.09.014
Rapid screening of an ordered fosmid library to clone multiple polyketide synthase genes of the phytopathogenic fungus Cladosporium phlei
Kum-Kang So et al.,
a Institute for Molecular Biology and Genetics, Chonbuk National University, Jeonju, Chonbuk 561-756, Republic of Korea
b Department of Bio-Environmental Chemistry, Wonkwang University, Iksan, Chonbuk 570-749, Republic of Korea
... The structures of putative PKS genes and proteins were determined using FGENESH
(http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind)
and INTERPROSCAN (http://www.ebi.ac.uk/Tools/pfa/iprscan/), respectively. ...
Fungal Genetics and Biology
Volume 49, Issue 12, December 2012, Pages 977–986 DOI: 10.1016/j.fgb.2012.08.008
Reproductive mode and life cycle of the ash dieback pathogen Hymenoscyphus pseudoalbidus
A. Gross a, P.L. Zaffarano a, A. Duo a, C.R. Grunig b,
a Forest Pathology and Dendrology, Institute of Integrative Biology (IBZ), ETH Zurich, Universitatsstrasse 16, 8092 Zurich, Switzerland
b Microsynth AG, Schutzenstrasse 15, 9436 Balgach, Switzerland
... Initial sequence analysis was conducted with the basic local alignment search tool (BLAST,
http://blast.ncbi.nlm.nih.gov/Blast.cgi) and refined by the gene structure prediction program
FGENESH (http://linux1.softberry.com/berry.phtml) using the matrices of Sclerotinia ...
Applied Microbiology and Biotechnology
August 2012, Volume 95, Issue 4, pp 947-955 DOI: 10.1007/s00253-011-3807-0
A novel thermoacidophilic and thermostable endo-b-1,4-glucanase from Phialophora sp. G5: its thermostability influenced by a distinct b-sheet and the carbohydrate-binding module
Zhao et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, People’s Republic of China
... ncbi.nlm.nih.gov/BLAST/), respectively. Introns, exons, and transcription initiation sites were
predicted using the online software FGENESH (http://linux1.softberry.com/berry.phtml). The signal
peptide was predicted using SignalP (http://www. cbs.dtu.dk/services/SignalP/). ...
The FASEB Journal
Published online before print September 20, 2012 DOI: 10.1096/fj.12-219444
Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female
Dottorini et al.,
*Department of Experimental Medicine and
†Department of Industrial Engineering, University of Perugia, Perugia, Italy;
‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK;
... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted
using FGENESH-C, FGENESH (http://linux1.softberry.com/), Wise2 (http:// www.ebi.ac.uk/), and
Genescan (http://genes.mit.edu/ GENSCAN.html). Mosquito rearing and mating analysis ...
Journal of Zhejiang University SCIENCE B
June 2012, Volume 13, Issue 6, pp 452-464 DOI: 10.1631/jzus.B1100338
Genomic organization and sequence dynamics of the AvrPiz-t locus in Magnaporthe oryzae
Ping Li, Bin Bai, Hong-yan Zhang, Heng Zhou, Bo Zhou
1. State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
2. Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, China
... The Page 3. Li et al. / J Zhejiang Univ-Sci B (Biomed & Biotechnol) 2012 13(6):452-464 454 BAC
sequence was annotated by using gene predic- tion program and homology search. The Fgenesh
program (http://www.softberry.com) was used for gene prediction. ...
Journal of Bioscience and Bioengineering
Volume 113, Issue 6, June 2012, Pages 710–714 DOI: 10.1016/j.jbiosc.2012.02.005,
Cloning, over-expression and characterization of an alkali-tolerant endo-b-1,4-mannanase from Penicillium freii F63
Wang et al.,
1 Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
2 Engineering Research Centre for the Protection and Utilization of Bioresource in Southern China, College of Life Science, South-Central University for Nationalities, Wuhan 430074, PR China
... The online software FGENESH (http://linux1.softberry.com/berry.phtml) was used to predict
introns, exons and transcription initiation sites of the DNA sequence. The signal peptide was
predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). ...
New Phytologist
Volume 193, Issue 4, pages 1049–1063, March 2012 DOI: 10.1111/j.1469-8137.2011.04006.x
Tracing the origin and evolutionary history of plant nucleotide-binding site–leucine-rich repeat (NBS-LRR) genes
Jia-Xing Yue 1,2, Blake C. Meyers 3, Jian-Qun Chen 1, Dacheng Tian 1, Sihai Yang 1
1 State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, China
2 Department of Ecology and Evolutionary Biology, Rice University, Houston, TX 77005, USA
... In addition, the nucleotide sequences of these two genes, together with their 5? and 3? flanking
regions (each 5000 bp, respectively), were used for re-annotation with FGENESH
(http://linux1.softberry.com/berry.phtml) and the domain architecture of the resulting predicted ...
PLoS ONE 7
(7): e40564. doi:10.1371/journal.pone.0040564
Identification of a Polyketide Synthase Required for Alternariol (AOH) and Alternariol-9-Methyl Ether (AME) Formation in Alternaria alternata
Saha et al.,
Department of Microbiology, Karlsruhe Institute of Technology (KIT) - South Campus, Institute for Applied Biosciences, Karlsruhe, Germany
Department of Food Chemistry, Karlsruhe Institute of Technology (KIT) - South Campus, Institute for Applied Biosciences, Karlsruhe, Germany
... A. alternata. Intron-exon borders were predicted using FGENESH (softberry.com)
trained on A. brassicicola gene models but have not yet been verified experimentally
due to the rather large nature of PKS genes. Among these ...
Gene
Volume 500, Issue 1, 25 May 2012, Pages 73–79 DOI: 10.1016/j.gene.2012.02.051
Two novel N-terminal coding exons of Prkar1b gene of mouse: Identified using a novel approach of in silico and molecular biology techniques
Abdul Rouf Banday, Shafquat Azim, Sayeed Ur Rehman, Mohammad Tabish
Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, U.P. 202002, India
... and Borodovsky, 1998) and is available at http://www.cbs.dtu.dk/services/HMMgene, Genescan
(http://genes.mit.edu/GENSCAN.html), GeneSplicer available at http://cbcb.umd.edu/software/
GeneSplicer/ (Pertea et al., 2001), and FGENESH (http://www.softberry.com/berry.phtml ...
Developmental & Comparative Immunology
Volume 38, Issue 1, September 2012, Pages 1–9 DOI: 10.1016/j.dci.2012.03.001
Snakes antibodies
Francisco Gambon-Deza a, Christian Sanchez-Espinel b, Serafin Mirete-Bachiller a, Susana Magadan-Mompo c
a Servicio Gallego de Salud (SERGAS) Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain
b Shared Unit of Immunology, University of Vigo – Vigo University Hospital Complex (Hospital Meixoeiro), Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As Lagoas-Marcosende, Vigo 36310, Pontevedra, Spain
... previously published reptile immunoglobulin mRNAs. Limits were deduced following
instructions in the software FGENESH (http://www.softberry.com) and Augustus
(http://www.augustus.gobics.de/submission). In Additional File A ...
Bioresource Technology
Volume 130, February 2013, Pages 161–167 DOI: 10.1016/j.biortech.2012.12.067
Characterization of three novel thermophilic xylanases from Humicola insolens Y1 with application potentials in the brewing industry
Yanlong Du et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
b College of Biological Science and Engineering, Bei Fang University of Nationalities, Yinchuan 750021, PR China
... The sequence assembly was performed using the Vector NTI Advance 10.0 software
(Invitrogen). Genes, introns, exons and transcription initiation sites were predicted using
the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...
Molecular Plant Pathology
Volume 13, Issue 9, pages 1089–1100, December 2012 DOI: 10.1111/j.1364-3703.2012.00818.x
Degradation of aromatic compounds through the b-ketoadipate pathway is required for pathogenicity of the tomato wilt pathogen Fusarium oxysporum f. sp. lycopersici
Caroline B. Michielse 1,†,*, Linda Reijnen 1,‡, Chantal Olivain 2, Claude Alabouvette 2, Martijn Rep 1
1Plant Pathology, Swammerdam Institute for Life Sciences, University of Amsterdam, Amsterdam, the Netherlands
2UMR 1229 INRA, Universite de Bourgogne Microbiologie du Sol et de l'Environnement, Dijon, France
... 1996). The annotated FOXG_17757 gene lacks a 5' and 3' end. In this article, we
suggest a new gene model based on fgenesh and augustus gene prediction software
(http://www.softberry.com, http://augustus.gobics.de/). This ...
Theoretical and Applied Genetics
May 2012, Volume 124, Issue 7, pp 1173-1182 DOI: 10.1007/s00122-011-1777-3
Localization of high level of sequence conservation and divergence regions in cotton
Wang et al.,
1. National Key Laboratory of Crop Genetics and Germplasm Enhancement, Cotton Research Institute, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, China
... hmm (Brudno et al. 2003), GENSCAN (Lomsadze et al. 2005) and FGENESH
(http://linux1.soft- berry.com). The predicted genes were confirmed using BLASTN
queries against the cotton EST database. To annotate genes, predicted ...
Genes & genomics
2012, vol. 34, no4, pp. 379-390
The NPR1 family of transcription cofactors in papaya: insights into its structure, phylogeny and expression
Santy et al.,
(1) Unidad de Biotecnologia, Centro de Investigacion Cientifica de Yucatan (CICY), C. 43, No. 130, Col. Chuburna de Hidalgo, Merida, Yucatan, Mexico
... Page 3. Genes & Genomics 1997). The open reading frames (ORFs) in the papaya DNA contigs
harboring NPR1 homologues were predicted by the FGENESH program with the A. thaliana
genome set as refer- ence (http://linux1.softberry.com/berry.phtml). ...
Applied Microbiology and Biotechnology
November 2012, Volume 96, Issue 4, pp 951-962 DOI: 10.1007/s00253-012-3873-y
Expression and characterization of a novel metagenome-derived cellulase Exo2b and its application to improve cellulase activity in Trichoderma reesei
Geng et al.,
1. Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Fenglin Rd 300, Shanghai, 200032, China
2. Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China
... The resulting reads were assembled using Newbler version 2.0 (http://www.454.com). ORFs
in the assembled sequences were predicted by FGENESB (Softberry, Goteborg, Sweden) and
a BLASTX search performed against the NR database to access annotation information. ...
ChemBioChem
Volume 13, Issue 17, pages 2583–2592, November 26, 2012 DOI: 10.1002/cbic.201200523
Identification of the Verruculogen Prenyltransferase FtmPT3 by a Combination of Chemical, Bioinformatic and Biochemical Approaches
Kathrin Mundt 1, Beate Wollinsky 1, Prof. Dr. Han-Li Ruan 2, Assoc. Prof. Dr. Tianjiao Zhu 3, Prof. Dr. Shu-Ming Li1
1Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie und Biotechnologie, Deutschhausstrasse 17A, 35037 Marburg (Germany)
2Huazhong University of Science and Technology, Faculty of Pharmacy, Tongji Medical College and Hubei Key Laboratory of Natural Medicinal Chemistry and Resource Evaluation, Hongkong Road 13, 430030, Wuhan (China)
... Computer-assisted sequence analysis: The DNASIS software package (version 2.1; Hitachi
Software Engineering, San Bruno, CA) and FGENESH (Softberry, Inc.; http://www.softberry.com/
berry.phtml) were used for intron prediction and sequence analysis, respectively. ...
Molecular Genetics and Genomics
May 2012, Volume 287, Issue 5, pp 373-388 DOI: 10.1007/s00438-012-0682-z
Comparative mapping, genomic structure, and expression analysis of eight pseudo-response regulator genes in Brassica rapa
Jin A. Kim et al.,
1. Department of Agricultural Bio-resources, National Academy of Agricultural Science, Rural Development Administration, 224 Suinro Gwonseon-gu, Suwon, Gyeonggi-do, 441-707, Republic of Korea
2. National Instrumentation Center for Environmental Management, College of Agriculture and Life Sciences, Seoul National University, Seoul, 151-742, Republic of Korea
... gov/BLAST/) were used when needed. Gene annotation was achieved using the
Web-based gene-prediction program FGENESH Arabid- opsis (http://www.softberry.
com/berry.phtml). A phylogenetic tree was constructed using ...
FEBS Journal
Volume 279, Issue 4, pages 572–585, February 2012 DOI: 10.1111/j.1742-4658.2011.08446.x
Identification and expression analysis of three novel splice variants of protein kinase A catalytic b subunit gene in the mouse using combinatorial in silico and molecular biology approaches
Abdul R. Banday, Shafquat Azim, Mohammad Tabish
Department of Biochemistry, Faculty of Life Sciences, AM University, Aligarh, India
... The FGENESH tool (http://www.softberry.ru/berry.phtml) was used for defining the
structural features of gene under study. The ... sequence motifs/rules [53,54]. FEX tool
(http://www.softberry.ru/berry.phtml) was used for validation of new ...
Theoretical and Applied Genetics
August 2012, Volume 125, Issue 4, pp 715-729 DOI: 10.1007/s00122-012-1863-1
Identification of FAD2 and FAD3 genes in Brassica napus genome and development of allele-specific markers for high oleic and low linolenic acid contents
Qingyong Yang et al.,
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China
... The nonredundant sequences resulted from the hits were then collected and compared with known
FAD2 and FAD3 genes in Arabidopsis . The program FGENESH (HMM-based gene structure
prediction tool) was used for gene prediction (http:// www.softberry.com/). ...
Molecular Biology Reports
April 2012, Volume 39, Issue 4, pp 3375-3383 DOI: 10.1007/s11033-011-1108-4
Differentially expressed three non-coding alternate exons at 5? UTR of regulatory type I beta subunit gene of mouse
Abdul Rouf Banday, Shafquat Azim, Mohammad Tabish
1. Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, UP, 202002, India
... Gene/ Exon finding tools were used at HMMgene (http://www.cbs. dtu.dk/services/HMMgene),
Genescan (http://genes.mit.edu/ GENSCAN.html), GeneSplicer (http://cbcb.umd.edu/software/
GeneSplicer/), FGENESH (http://www.softberry.com/berry. phtml). ...
Canadian Journal of Microbiology
2012, 58(7): 815-827, DOI: 10.1139/w2012-054
Gene cloning, molecular modeling, and phylogenetics of serine protease P32 and serine carboxypeptidase SCP1 from nematophagous fungi Pochonia rubescens and Pochonia chlamydosporia
Eduardo Larriba, a,c Jose Martin-Nieto, b,c Luis Vicente Lopez-Llorca a,c
aDepartment of Marine Sciences and Applied Biology, University of Alicante, P.O. Box 99, E-03080 Alicante, Spain.
bDepartment of Physiology, Genetics and Microbiology, University of Alicante, P.O. Box 99, E-03080 Alicante, Spain.
... lyon1.fr/cap3.php. Gene prediction was made using FGENESH/HMM based on
Neurospora genes (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=
programs&subgroup =gfind). Pairwise alignments were carried ...
PNAS
August 7, 2012 vol. 109 no. 32 E2155-E2164 DOI: 10.1073/pnas.1117982109
Positional cloning and characterization reveal the molecular basis for soybean maturity locus E1 that regulates photoperiodic flowering
Zhengjun Xia et al.,
aNortheast Institute of Geography and Agroecology, Chinese Academy of Sciences, Harbin 150081, China;
bSoybean Applied Genomics Research Unit, National Institute of Agrobiological Sciences, Tsukuba 305-8602, Japan;
... 2 B and C). A single intron-free gene (AB552962, 525 bp, 174 aa) was consistently identified
by GenScan (45), GeneMark (46), FGENESH (http://linux1.softberry.com/berry.phtml), and
RiceGAAS (44) for the dominant E1 genotype (Misuzudaizu and Harosoy-E1), and was ...
Comparative and Functional Genomics
Volume 2012 (2012), Article ID 914843, 14 pages
doi:10.1155/2012/914843
In Silico Identification and Comparative Genomics of Candidate Genes Involved in Biosynthesis and Accumulation of Seed Oil in Plants
Arti Sharma and Rajinder Singh Chauhan
Department of Biotechnology & Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan 173 215, India
... Rapa, and soybean sequences were further annotated for gene models (open reading frames,
including the 5?UTRs and 3?UTRs) using gene prediction algorithms of FGenesH
(http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) [43– ...
Genetics
August 17, 2012 genetics.112.144436 DOI:10.1534/genetics.112.144436
High Throughput Discovery of Mutations in tef Semi-dwarfing Genes by Next Generation Sequencing Analysis
Qihui Zhu et al.,
1 University of Georgia;
2 Purdue University
... The complete clone sequences were submitted to GenBank (Accession numbers:
JN672669-JN672670). The fosmid sequences were initially annotated by FGENESH
(http://www.softberry.com) and GENESCAN (Buger and Karlin 1997). Putative proteins ...
Theoretical and Applied Genetics
November 2012, Volume 125, Issue 7, pp 1525-1537 DOI: 10.1007/s00122-012-1931-6
Development of candidate gene markers associated to common bacterial blight resistance in common bean
Chun Shi et al.,
1. Greenhouse and Processing Crops Research Centre, Agriculture and Agri-Food Canada, Harrow, ON, N0R 1G0, Canada
2. Department of Plant Agriculture, University of Guelph, Crop Science Building, Guelph, ON, N1G 2W1, Canada
... for Bio- technology Information (NCBI) database. Gene predictions were based on
ab initio method by FGENESH software using Medicago gene model (http://www.
softberry.com). Sequences were subjected to BlastN similarity ...
Mol Genet Genomics.
2012 Oct;287(10):765-84. Epub 2012 Aug 24.
Auxin response factor gene family in Brassica rapa: genomic organization, divergence, expression, and evolution
Mun JH et al.,
Department of Agricultural Biotechnology, National Academy of Agricultural Science, Rural Development Administration, 150 Suin-ro, Gwonseon-gu, Suwon 441-707, Korea
... Since the draft B. rapa genome did not provide information on the 50- and 30-UTR
regions of the gene models, we used in-house trained FGENESH (www.
softberry.com) to predict the 50- and 30-UTR regions of the BrARF genes. ...
PLoS ONE
7(9): e45307. doi:10.1371/journal.pone.0045307
Genome Dynamics Explain the Evolution of Flowering Time CCT Domain Gene
Families in the Poaceae.
Cockram et al.,
1 John Bingham Laboratory, National Institute of Agricultural Botany, Huntington Road, Cambridge, United Kingdom, 2 Leibniz Institute for Plant Genetics and Crop Plant
Research (IPK), Gatersleben, Germany, 3 Leibniz Institute for Age Research, Fritz Lipmann Institute (FLI), Jena, Germany, 4 Department of Computational and Systems
Biology, John Innes Centre, Norwich, United Kingdom
... helmholtz-muenchen.de/plant/triticeae/) or fl-cDNAs [40]. De novo gene predictions
and reassessments were conducted using FGENESH (http://www.softberry.com/)
using 'monocot' as the basis of gene prediction. Homology ...
PLoS ONE
7(9): e45307. doi:10.1371/journal.pone.0045307
Genome Dynamics Explain the Evolution of Flowering Time CCT Domain Gene Families in the Poaceae
Cockram et al.,
John Bingham Laboratory, National Institute of Agricultural Botany, Huntington Road, Cambridge, United Kingdom
Leibniz Institute for Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany
...De novo gene predictions and reassessments were conducted using FGENESH (http://www.softberry.com/) using ‘monocot’ as the basis of gene prediction. ...
African Journal of Biotechnology
Vol. 11(77), pp. 14123-14131, 25 September, 2012
DOI: 10.5897/AJB12.778
Molecular cloning and characterization of an acyl-ACP thioesterase gene (AhFatB1) from allotetraploid peanut (Arachis hypogaea L.)
Wen Qigen, Lei Yong, Huang Jiaquan, Jiang Huifang and Liao Boshou
Oil Crop Research, Institute of the Chinese Academy of Agricultural Sciences, Key Laboratory of Biology and Genetic Improvement of Oil Crops, Ministry of Agriculture, P. R. China.
... The theoretical molecular weight and isoelectric point of deduced polypeptide were predicted
using the ProtParam program (http://www.expasy.ch/tools/protparam.html), and Exon-Intron
analysis was made with the FGENESH program (http://linux1.softberry.com/). ...
Molecular Genetics and Genomics
March 2012, Volume 287, Issue 3 , pp 189-203 DOI: 10.1007/s00438-011-0671-7
Transcriptome analysis of rin mutant fruit and in silico analysis of promoters of differentially regulated genes provides insight into LeMADS-RIN-regulated ethylene-dependent as well as ethylene-independent aspects of ripening in tomato
Rahul Kumar, Manoj K. Sharma, Sanjay Kapoor, Akhilesh K. Tyagi, Arun K. Sharma
1. Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, 110021, India
2. Department of Plant Pathology, University of California, Davis, CA, 95616, USA
... Gene structure of these BAC sequences was predicted using FGENESH (http://linux1.
softberry.com/berry.phtml?topic=fgenesh& group=programs&subgroup=gfind) and 2 kb
sequences upstream to predicted open reading frames were extrac- ted. ...
Molecular Biology Reports
Volume 40, Issue 2 , pp 1385-1396 DOI: 10.1007/s11033-012-2182-y
Characterization of the NADP-malic enzymes in the woody plant Populus trichocarpa
Yu et al.,
1. State Key Laboratory of Tree Genetics and Breeding, Northeast Forestry University, 26 Hexing Road, Harbin, 150040, China
... We performed the PtNADP-ME4 gene structure (exons and introns) prediction using the
FGENESH program on the SoftBerry server (http://www.soflberry.corn/berry.phtml), and
present new predicted PtNADP-ME4 gene sequences (Table S1). ...
Plant Disease
February 2013, Volume 97, Number 2
Pages 245-251
http://dx.doi.org/10.1094/PDIS-11-11-0941-RE
Chromosomal Mapping and QTL Analysis of Resistance to Downy Mildew in Cucumis sativus
Zhang et al.,
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China;
College of Agriculture, Guizhou University, Guiyang 550025, China
... Only matches with an identity of ? 95% were retained. Gene prediction was performed with the
computer program BGF (http://bgf.genomics.org.cn) and veriWed by FGENESH (http://sunl.softberry.
com/) (40), GENESCAN (http://genes.mit.edu/GENSCAN.html) (4), TwinScan ...
PLoS ONE
7(12): e53401. doi:10.1371/journal.pone.0053401
A Novel Family of Terminal-Repeat Retrotransposon in Miniature (TRIM) in the Genome of the Red Harvester Ant, Pogonomyrmex barbatus
Yihong Zhou, Sara Helms Cahan
Department of Biology, University of Vermont, Burlington, Vermont, United States of America
... assembly. Elements along with their flanking sequences were submitted to FGENESH
program (Softberry, Inc., http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&subgroup=gfind) for gene prediction. ...
J Hered
(2012) doi: 10.1093/jhered/ess102
Identification and Characterization of a Homologue to the Arabidopsis INDEHISCENT Gene in Common Bean
Gioia T, Logozzo G, Kami J, Zeuli PS, Gepts P.
From the Scuola di Scienze Agrarie, Forestali, Alimentari ed Ambientali, Universita degli Studi della Basilicata, Viale dell’Ateneo Lucano 10, 85100 Potenza, Italy (Gioia, Logozzo, Spagnoletti Zeuli); and the Department of Plant Sciences/MS1, University of California, 1 Shields Avenue, Davis, CA 95616–8780 (Kami and Gepts).
... with AtIND. Gene structure was predicted using the software FGENESH
(http://linux1.softberry.com/berry.phtml), whereas the search for ORFs was performed
using ORF finder (http://www.ncbi.nlm.nih.gov/projects/gorf/). To identify ...
Theoretical and Applied Genetics
Volume 125, Issue 2 , pp 223-234 DOI: 10.1007/s00122-012-1827-5
Map-based cloning of a recessive genic male sterility locus in Brassica napus L. and development of its functional marker
Li et al.,
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China
2. Institute of Industrial Crops, Henan Academy of Agricultural Science, Zhengzhou, 450002, China
... Gene prediction and plant transformation The website-based software FGENESH (http://www.soft
berry.com) was applied to predict the putative ORF from the candidate region. The genomic or
coding sequences of predicted genes were submitted to NCBI (http://www.ncbi. ...
New Phytologist
Volume 197, Issue 2, pages 416–430, January 2013 DOI: 10.1111/nph.12026
Methylome of DNase I sensitive chromatin in Populus trichocarpa shoot apical meristematic cells: a simplified approach revealing characteristics of gene-body DNA methylation in open chromatin state
Lafon-Placette et al.,
1Universite d'Orleans, Faculte des Sciences, Laboratoire de Biologie des Ligneux et des Grandes Cultures (LBLGC), Orleans, France
2INRA, USC1328 Arbres et Reponses aux Contraintes Hydriques et Environnementales (ARCHE), Orleans, France
... Identification of transposase was performed using Fgenesh software (http://linux1.softberry.com/
berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) and confirmed by TBlastX
analysis (e-value < 10 ?30 ) on a flowering plant transcripts database. ...
BMC Genomics
2012, 13:409
http://www.biomedcentral.com/1471-2164/13/409
Evolution of the Rdr1 TNL-cluster in roses and
other Rosaceous species
Diro Terefe-Ayana, Helgard Kaufmann, Marcus Linde and Thomas Debener
Institute for Plant Genetics, Leibniz University Hannover, Herrenhaeuser Str. 2,
Hannover 30419, Germany
... Gene prediction and annotation based on the completely assembled sequence was carried out using the gene prediction program
FGENESH (http://www.softberry.com). ...
Journal of Plant Interactions
Volume 8, Issue 1, 2013 pages 34-44 DOI: 10.1080/17429145.2012.721523
Positive selection pressure on rice blast resistance allele Piz-t makes it divergent in Indian land races
Thakur et al.,
a National Research Centre on Plant Biotechnology, IARI, New Delhi, 110012, India
b Deparment of Biotechnology, Himachal Pradesh University, Shimla, 171005, India
... [CrossRef], [PubMed], [Web of Science ®], [CSA] View all references) and manually edited using
BioEdit Software version 7.0.9.0 (www.mbio.ncsu.edu). Gene coding regions were predicted
with FGENESH (www.softberry.com) using the Piz-t sequence as reference. ...
Mycology: An International Journal on Fungal Biology
Volume 3, Issue 1, 2012 pages 54-64 DOI: 10.1080/21501203.2011.654353
Two arginine biosynthesis genes are essential for pathogenicity of Colletotrichum higginsianum on Arabidopsis
Hiroyuki Takahara ab*, Aurelie Huser b & Richard O'Connell b
a Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, Nonoichi, Ishikawa, Japan
b Max Planck Institute for Plant Breeding Research, Department of Plant–Microbe Interactions, Cologne, Germany
... 2007) and the FGENESH prediction tool using Fusarium and Magnaporthe matrices (Softberry
Inc., Mount Kisco, NY, USA). Sequence homology searches were performed against the
NCBI nr protein data base using appropriate BLAST algorithms. ...
PLoS ONE
7(9): e44264. doi:10.1371/journal.pone.0044264
Identification and Sequence Analysis of Metazoan tRNA 3?-End Processing Enzymes tRNase Zs.
Wang et al.,
Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, Nanjing, China
... The splicing pattern was verified using the Fgenesh and Fgenesh_GC programs provided at the Softberry website (http://linux1.softberry.com/berry.phtml??topic=fgenesh). ...
Theoretical and Applied Genetics
Volume 125, Issue 2 , pp 211-222 DOI: 10.1007/s00122-012-1826-6
Exploiting comparative mapping among Brassica species to accelerate the physical delimitation of a genic male-sterile locus (BnRf) in Brassica napus
Yanzhou Xie et al.,
1. National Key Laboratory of Crop Genetic Improvement, National Center of Rapeseed Improvement (Wuhan Branch), Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
2. College of Agriculture, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China
... Biosystems, Foster City, CA, USA). Software packages FGENESH (http://www.softberry.
com) and Glim- merHMM (Majoros et al. 2004) were both applied to pre- dict the putative
ORF from the candidate region. The genomic or coding ...
Planta
Volume 237, Issue 1 , pp 279-292 DOI: 10.1007/s00425-012-1756-1
Young Leaf Chlorosis 1, a chloroplast-localized gene required for chlorophyll and lutein accumulation during early leaf development in rice
Kunneng Zhou et al.,
1. National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing, 210095, China
2. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... P0027G10. Within this region, five ORFs were predicted using the program FGENESH
2.2 (http://www. softberry.com) (Fig. 2b). To determine the mutation site, all five cDNA
sequences were separately isolated from young leaves. ...
PLoS ONE
7(12): e52293. doi:10.1371/journal.pone.0052293
Full-Length Minor Ampullate Spidroin Gene Sequence.
Chen et al.,
Institute of Biological Sciences and Biotechnology, Donghua University, Shanghai, People's Republic of China
Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada
... Fgenesh 2.6 (http://linux1.softberry.com/berry.phtml??topic=fgenesh&group=programs&subgroup=gf?ind) was used for intron prediction. ...
BMC Plant Biology
2012, 12:85 DOI: 10.1186/1471-2229-12-85
Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns
Chen et al.,
1 School of Agriculture and Food Science, Zhejiang A & F University, Lin'an, Hangzhou, Zhejiang 311300, China
2 State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Resources and Environmental Sciences, Nanjing Agricultural University, Nanjing 210095, China
... As the absence of the cDNA sequence, the exon/intron structure of GaSus2 was predicted online
using the FGENESH algorithm (http://linux1.softberry.com/berry.phtml), which resulted in the
definition of 10 putative introns within its putative coding regions. ...
Genomics
Volume 99, Issue 4, April 2012, Pages 241–245 DOI:10.1016/j.ygeno.2012.01.007
Evolutionary genomics reveals the premetazoan origin of opposite gating polarity in animal-type voltage-gated ion channels
Xinjiang Cai
Division of Cardiology, Department of Medicine, Duke University Medical Center, Durham, North Carolina 27710, USA
Department of Molecular Pathogenesis, New York University Langone Medical Center, New York, NY 10016, USA
... In cases when TBlastN searches identified putative genes of interest that had not been annotated,
or when currently annotated genes in the databases were believed to be incomplete,
GeneMark.hmm and FGENESH programs (http://www.softberry.com/berry.phtml?topic ...
BMC Genomics
2012, 13:253 doi:10.1186/1471-2164-13-253
Comprehensive analysis of CCCH zinc finger family in poplar (Populus trichocarpa)
Chai et al.,
1 Key Laboratory of Biofuels, Chinese Academy of Sciences, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, 266101, PR China
2 Complex Carbohydrate Research Center, University of Georgia, 315 Riverbend Road, Athens, GA, 30602, USA
... Subsequently, manual reannotation was performed to correct the putative CCCH sequences
using online web server FGENESH (http://linux1.softberry.com/berry.phtml webcite). In this
endeavor, 12 protein sequences were corrected for further analysis. ...
ChemBioChem
Volume 13, Issue 12, pages 1798–1804, August 13, 2012 DOI: 10.1002/cbic.201200187
Characterization of the Suillus grevillei Quinone Synthetase GreA Supports a Nonribosomal Code for Aromatic a-Keto Acids
Barbara Wackler 1, Dr. Gerald Lackner 1, Dr. Yit Heng Chooi 1, 2, Prof. Dr. Dirk Hoffmeister 1
1Friedrich-Schiller-Universitat, Department Pharmaceutical Biology at the Hans-Knoll-Institut, Beutenbergstrasse 11a, 07745 Jena (Germany)
2Current Address: University of California, Los Angeles, Department of Chemical and Biomolecular Engineering, Los Angeles, CA 90095 (USA)
... The DNA sequence of the combined insert sequences of these cosmids has been deposited
in GenBank (#JQ681152) and was submitted to FGENESH (Softberry, Mount Kisco, NY) and
to the BLAST server,29 to identify genes and exon/intron junctions. ...
The Plant Journal
Volume 72, Issue 1, pages 142–153, October 2012 DOI: 10.1111/j.1365-313X.2012.05072.x
The sunflower (Helianthus annuus L.) genome reflects a recent history of biased accumulation of transposable elements
Staton et al.,
1 Department of Genetics, University of Georgia, Athens, GA 30602, USA
2 Division of Biology, 426 Ackert Hall, Kansas State University, Manhattan, KS 66506, USA
... The bias in the EST matches to Gypsy elements, and the biased genomic abundance of these
sequences are shown in the tracks below the predicted genes. Gene predictions were made
using fgenesh (http://www.softberry.com) and maker (http://gmod.org/wiki/MAKER). ...
Chemistry & Biology
Volume 19, Issue 12, 21 December 2012, Pages 1611–1619 DOI: 10.1016/j.chembiol.2012.10.010
Terpendole E, a Kinesin Eg5 Inhibitor, Is a Key Biosynthetic Intermediate of Indole-Diterpenes in the Producing Fungus Chaunopycnis alba
Takayuki Motoyama1, Toshiaki Hayashi1, Hiroshi Hirota1, Masashi Ueki1, Hiroyuki Osada1
1 Chemical Biology Core Facility, Chemical Biology Department, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198, Japan
... Nucleotide and amino acid sequence data were analyzed by DNASIS-Mac software (Hitachi
Software Engineering, Tokyo, Japan). Open reading frames were predicted by FGENESH and
FGENESH + software (Softberry, Mount Kiscko, NY). Construction of Recombinant Strains. ...
BMC Genomics
2012, 13:553 doi:10.1186/1471-2164-13-553
Sequencing of the core MHC region of black grouse (Tetrao tetrix) and comparative genomics of the galliform MHC
Biao Wang 1*, Robert Ekblom 2, Tanja M Strand 1,3, Silvia Portela-Bens 1 and Jacob Hoglund 1
1 Population Biology and Conservation Biology, Department of Ecology and Genetics, Evolutionary Biology Centre, Uppsala University, Norbyvagen 18 D, Uppsala, SE-752 36, Sweden
2 Evolutionary Biology, Department of Ecology and Genetics, Evolutionary Biology Centre, Uppsala University, Norbyvagen 18 D, Uppsala, SE-752 36, Sweden
... Identification of coding regions and putative exons was conducted by three different gene
prediction programs: Fgenesh ( http://www.softberry.com webcite), GeneMark.hmm (
http://exon.gatech.edu webcite) and Genscan ( http://genes.mit.edu/GENSCAN.html webcite) [ ...
PNAS
August 21, 2012 vol. 109 no. 34 13716-13721 DOI: 10.1073/pnas.1121096109
Rapid divergence and expansion of the X chromosome in papaya
Gschwend et al.,
aDepartment of Plant Biology, University of Illinois at Urbana–Champaign, Urbana, IL 61801;
bTexas AgriLife Research Center, Department of Plant Pathology and Microbiology, Texas A & M University, Weslaco, TX 78596;
... V. monoica Gene Prediction. Genes were predicted in the V. monoica BACs using Genscan
(http://genes.mit.edu/GENSCAN.html) and FGENESH (http://linux1.softberry.com/berry.phtml),
as well as homology to papaya-expressed sequence tags (ESTs) and gene models. ...
Theoretical and Applied Genetics
Volume 125, Issue 2 , pp 273-284 DOI: 10.1007/s00122-012-1832-8
Fine mapping of fw3.2 controlling fruit weight in tomato
Na Zhang, Marin Talbot Brewer, Esther van der Knaap
1. Department of Horticulture and Crop Science, The Ohio State University/OARDC, 217A Williams Hall, 1680 Madison Avenue, Wooster, OH, 44691, USA
2. Department of Plant Pathology, University of Georgia, Athens, GA, USA
... The sequence of the BAC C03Hba0051C24 encompassing fw3.2 was analyzed with the ab initio
gene prediction pro- grams FGENESH (http://www.softberry.com/berry.phtml) (Salamov and
Solovyev 2000) and is consistent with the recently released annotation of the tomato ...
BMC Genomics
2012, 13:444
http://www.biomedcentral.com/1471-2164/13/444 doi:10.1186/1471-2164-13-444
Comparative genomics of the white-rot fungi,
Phanerochaete carnosa and P. chrysosporium, to
elucidate the genetic basis of the distinct wood
types they colonize
Suzuki et al.,
1
Department of Chemical Engineering & Applied Chemistry, University of Toronto, 200 College Street, Toronto, ON M5S 3E5, Canada
...Using the repeat-masked assembly, several gene prediction programs falling into three
general categories were used: 1) ab initio - FGENESH [52]; GeneMark [53], 2) homology-based - FGENESH+; Genewise [54] seeded by BLASTx alignments against GenBank’s database of non-redundant proteins (NR: [55]), and 3) EST-based - EST_map [56] seeded by EST contigs....
BMC Genomics
2012, 13:270
http://www.biomedcentral.com/1471-2164/13/270 doi:10.1186/1471-2164-13-270
The WRKY transcription factor family in Brachypodium distachyon
Tripathi et al.,
1
Department of Biology and Microbiology, South Dakota State University,
Brookings, SD 57007, USA
... Each potential gene was then manually curated using both FGENESH [38] and...
PLoS ONE
7(3): e32658. doi:10.1371/journal.pone.0032658
Membrane Topology and Predicted RNA-Binding Function of the ‘Early Responsive to Dehydration (ERD4)’ Plant Protein
Archana Rai, Penna Suprasanna, Stanislaus F. D'Souza, Vinay Kumar
Nuclear Agricultural & Biotechnology Division, Bhabha Atomic Research Centre, Mumbai, India
High Pressure & Synchrotron Radiation Physics Division, Bhabha Atomic Research Centre, Mumbai, India
...Gene structure study was performed using popular gene finding pipeline (FGENESH at www.softberry.com)...
BMC Genomics
2012, 13:171 doi:10.1186/1471-2164-13-171
Genomic characterization of the conditionally dispensable chromosome in Alternaria arborescens provides evidence for horizontal gene transfer
Hu et al.,
1 Department of Plant Pathology, The Ohio State University, Columbus, OH 43210, USA
2 Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430, USA
... Gene prediction, codon usage analysis & repetitive DNA identification. Gene prediction was
conducted using FGENESH [47], an ab initio gene predictor provided in the Softberry website.
A pre-trained Alternaria matrix was used to optimize predictions. ...
BMC Genomics
2012, 13:674 doi:10.1186/1471-2164-13-674
Design of a tobacco exon array with application to investigate the differential cadmium accumulation property in two tobacco varieties
Martin et al.,
1 Philip Morris International R&D, Philip Morris Products SA, Neuchatel 2000,
Switzerland
2 Institut fur Mathematik und Informatik, Greifswald D-17487, Germany
...FGENESH was trained for tobacco by SoftBerry Inc. and run as an ab initio gene finder with default parameters. Further
iterations of the tobacco genome assembly were also ...
The Plant Journal
Volume 72, Issue 2, pages 212–221, October 2012 DOI: 10.1111/j.1365-313X.2012.05059.x
Dynamic evolution of bz orthologous regions in the Andropogoneae and other grasses
Qinghua Wang 1, Hugo K. Dooner 1,2
1 Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA
2 Department of Plant Biology, Rutgers University, New Brunswick, NJ 08901, USA
... The Fgenesh gene prediction program (http://www.softberry.com) was used to annotate
the non-orthologous genes in Coix and sorghum, and adjustment of exon/intron structures
was based on the sorghum and rice transcript annotation. ...
Plant Physiology
July 2012 vol. 159 no. 3 1086-1098 doi: http://dx.doi.org/10.1104/pp.112.197483
Altered Chloroplast Development and Delayed Fruit Ripening Caused by Mutations in a Zinc Metalloprotease at the lutescent2 Locus of Tomato
Barry et al.,
Department of Horticulture, Michigan State University, East Lansing, Michigan 48824 (C.S.B., Q.M.)
Boyce Thompson Institute for Plant Research, Ithaca, New York 14853 (G.M.A., R.P.M., J.J.G.)
...The prediction of genes within genomic DNA sequence was performed using the FGENESH hidden Markov model-based gene structure prediction program (http://linux1.softberry.com/berry.phtml). ...
Front Plant Sci.
2012; 3: 5. DOI: 10.3389/fpls.2012.00005
TriAnnot: A Versatile and High Performance Pipeline for the Automated Annotation of Plant Genomes
Leroy et al.,
1 UMR 1095, Genetics, Diversity and Ecophysiology of Cereals, Institut National de la Recherche Agronomique-Universite Blaise Pascal, Clermont-Ferrand, France
2 National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan
For ab initio gene prediction, TriAnnot uses four programs: FGeneSH [17], GeneID (Guigo et al., 1992), GeneMarkHMM
BMC Plant Biology
2012, 12:20 doi:10.1186/1471-2229-12-20
Comparative transcriptome analysis of stylar canal cells identifies novel candidate genes implicated in the self-incompatibility response of Citrus clementina
Caruso et al.,
1 Dipartimento di Scienze delle Produzioni Agrarie e Alimentari, Universita degli Studi di Catania, Via Valdisavoia 5, 95123 Catania, Italy
2 Institut Valencia d'Investigacions Agraries - Centre de Genomica, Carretera Montcada de l'Horta-Naquera Km. 4,5, 46113 Montcada de l'Horta (Valencia), Spain
...ORF prediction was based on the genome browser data for each analyzed species as
well as Fgenesh analysis http://www.softberry.com...
PLoS ONE
7(2): e32010. doi:10.1371/journal.pone.0032010
A Highly Conserved, Small LTR Retrotransposon that Preferentially Targets Genes in Grass Genomes
Gao D, Chen J, Chen M, Meyers BC, Jackson S
Center for Applied Genetic Technologies and Institute for Plant Breeding Genetics and Genomics, University of Georgia, Athens, Georgia, United States of America
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China
...To predict the sequences in sorghum and maize, 20 kb of flanking sequence (10 kb on each side of the
transposon) were analyzed by the FGENESH (http://linux1.softberry.com) and the GeneMark.hmm ...
PLoS Pathog
8(9): e1002952. doi:10.1371/journal.ppat.1002952
Comparative Pathogenomics Reveals Horizontally Acquired Novel Virulence Genes in Fungi Infecting Cereal Hosts
Gardiner DM et al.,
Commonwealth Scientific and Industrial Research Organization (CSIRO) Plant Industry, Queensland Bioscience Precinct, Brisbane, Queensland, Australia
Plant Pathology, Institute of Integrative Biology, ETH Zurich, Zurich, Switzerland
...Protein coding genes were ab initio predicted in the F. pseudograminearum genome
using FGENESH [52] based on the F. graminearum gene models as part of the MolQuest2 package from Softberry, AUGUSTUS [53] and GeneMark-ES...
PLoS ONE
7(2): e31149. doi:10.1371/journal.pone.0031149
Genome-Wide Identification, Evolutionary Expansion, and Expression Profile of Homeodomain-Leucine Zipper Gene Family in Poplar (Populus trichocarpa)
Hu et al.,
CAS Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and BioProcess Technology, Chinese Academy of Sciences, Qingdao, Shandong, People's Republic of China
... For the misannotated genes, manual reannotation was performed using online web server FGENESH (http://linux1.softberry.com/berry.phtml). ...
Theoretical and Applied Genetics
Volume 125, Issue 5 , pp 1047-1055 DOI 10.1007/s00122-012-1894-7
The isolation of Pi1, an allele at the Pik locus which confers broad spectrum resistance to rice blast
Lixia Hua et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropic Agrobioresources, Laboratory of Plant Resistance and Genetics, College of Natural Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China
2. National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, 305-8602, Japan
... The gene annotation tools RiceGAAS (http://ricegaas.dna.affrc. go.jp) and FGENESH
(http://www.softberry.com) were then used to identify Pi1 candidates within the 277-kb segment
of cv. Nipponbare defined by the closest flanking markers (CRG11-7 and K28). ...
Bioresource Technology
Volume 121, October 2012, Pages 404–410 http://dx.doi.org/10.1016/j.biortech.2012.07.027
Two neutral thermostable cellulases from Phialophora sp. G5 act synergistically in the hydrolysis of filter paper
Junqi Zhao et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... Transcription initiation sites and intron and exon information were predicted using the online
software FGENESH (http://linux1.softberry.com/berry.phtml). The presence of signal peptides
was predicted using SignalP 4.0 (http://www.cbs.dtu.dk/services/SignalP/). ...
Theoretical and Applied Genetics
Volume 125, Issue 4 , pp 773-779 DOI 10.1007/s00122-012-1870-2
Fine mapping and candidate gene analysis of the nuclear restorer gene Rfp for pol CMS in rapeseed (Brassica napus L.)
Zhi Liu et al.,
1. National Key Lab of Crop Genetic Improvement, National Center of Rapeseed Improvement (Wuhan Branch), Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
... Candidate gene identification and sequence analysis The online system FGENESH
(http://www.softberry.com) was used to identify predicted ORFs in the delimited gene region. ... b
Candidate region of the Rfp locus and the predicted gene from http://www.softberry. com. ...
Plant Molecular Biology Reporter
Volume 30, Issue 4 , pp 1025-1031 DOI 10.1007/s11105-011-0408-0
Identification and Association Analysis of Castor Bean Orthologous Candidate Gene-Based Markers for High Oil Content in Jatropha curcas
Arti Sharma (1)
Rajinder Singh Chauhan (1)
1. Department of Biotechnology & Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan, 173 215, HP, India
... gene sequences from other plants (Arabidopsis, Brassica, Medicago, sunflower, soybean, and
cotton) were downloaded and annotated for open reading frames, including the 5? and 3?UTRs
using gene prediction algorithms of FGenesH (http://sun1.softberry.com/berry. ...
The Journal of Biological Chemistry
doi: 10.1074/jbc.M111.317982 January 6, 2012, 287, 1371-1380.
Biochemical Characterization of Indole Prenyltransferases
FILLING THE LAST GAP OF PRENYLATION POSITIONS BY A 5-DIMETHYLALLYLTRYPTOPHAN SYNTHASE FROM ASPERGILLUS CLAVATUS
Xia Yu ‡,1,
Yan Liu ‡§,2,
Xiulan Xie ¶,
Xiao-Dong Zheng § and
Shu-Ming Li ‡,3
From the ‡Institut fur Pharmazeutische Biologie und Biotechnologie, Philipps-Universitat Marburg, Deutschhausstrasse 17A, 35037 Marburg, Germany,
the §Department of Food Science and Nutrition, Zhejiang University, 310058 Hangzhou, Zhejiang, China, and
the ¶Fachbereich Chemie, Philipps-Universitat Marburg, Hans-Meerwein-Strasse, 35032 Marburg, Germany
... gov). FGENESH from Softberry and the DNASIS software package (version 2.1, Hitachi
Software Engineering, San Bruno, CA) were used for exon prediction and sequence
analysis, respectively. Chemicals. Dimethylallyl diphosphate ...
Functional & Integrative Genomics
Volume 12, Issue 3 , pp 489-500 DOI
10.1007/s10142-012-0283-2
New cis-regulatory elements in the Rht-D1b locus region of wheat
Jialei Duan et al.,
1. College of Biology Sciences, China Agricultural University, No. 2 Yuanmingyuan West Road, Haidian District, 100094, Beijing, People’s Republic of China
... usda.gov/ITMI/Repeats/gene_annotation.pdf). Gene pre- dictions were accomplished
mainly by using the program FGENESH with the monocot (corn, rice, wheat, and
barley) training set (http://www.softberry.com). GENSCANW ...
Molecules and Cells
Volume 33, Issue 4 , pp 415-422 DOI
10.1007/s10059-012-0017-2
Ectopic expression of Capsicum-specific cell wall protein Capsicum annuum senescence-delaying 1 (CaSD1) delays senescence and induces trichome formation in Nicotiana benthamiana
Eunyoung Seo et al.,
2. Department of Plant Science, Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, Korea
1. Seeders Inc., Daejeon, 305-509, Korea
... an- nuum 'CM334' (Yoo et al., 2003). Both the gene-coding region and the 3?
untranslated region were predicted using the FGENESH program (http://linux1.
softberry.com/berry.phtml). Gene-specific primers were designed for ...
Mol Biol Evol
(2012) 29 (1): 91-100. doi: 10.1093/molbev/msr149
Ancestral Ca2+ Signaling Machinery in Early Animal and Fungal Evolution
Xinjiang Cai *,1 and
David E. Clapham * 2,3
1Molecular Pathogenesis Program, The Skirball Institute of Biomolecular Medicine, New York University Langone Medical Center
2Howard Hughes Medical Institute, Department of Cardiology, Children's Hospital Boston
3Department of Neurobiology, Harvard Medical School
... 2005) and FGENESH programs (http://www.softberry.com/berry.phtml?topic=index&group=
programs&subgroup=gfind) were used to predict the genes of interest by using identified
DNA segments and their neighboring regions of genomic sequences. ...
POJ
5(2):94-102 (2012)
Genome-wide analysis of cytosolic and chloroplastic isoforms of glutathione reductase in plant cells
Ahmad Tahmasebi 1, Farzaneh Aram 2, Mansour Ebrahimi 3, Manijeh Mohammadi-Dehcheshmeh 4,
Esmaeil Ebrahimie 1&5*
1Department of Crop Production & Plant Breeding, College of Agriculture, Shiraz University, Shiraz, Iran
2Institute of Biotechnology, College of Agriculture, Shiraz University, Shiraz University, Shiraz, Iran
...Genomic sequences were also analyzed in the
FGENESH gene structure prediction program
(http://www.softberry.com) and GeneMark program
(http://opal.biology.gatech.edu/GeneMark)....
...Protein sorting and subcellular localization predictions were
performed according to ProtComp program Version 5
(http://www.softberry.com/)...
Phytopathology
May 2012, Volume 102, Number 5
Pages 506-518
http://dx.doi.org/10.1094/PHYTO-06-11-0180
Evidence for Morphological, Vegetative, Genetic, and Mating-Type Diversity in Sclerotinia homoeocarpa
Daniele Liberti, Jeffrey A. Rollins, and Philip F. Harmon
Department of Plant Pathology, 1453 Fifield Hall, University of Florida, Gainesville 32611.
... analysis. Protein prediction analysis was performed using ab initio gene prediction
software FGENESH (36) running on the Softberry web interface (http://
www.softberry.com) selecting S. sclerotiorum as the reference ge- nome. ...
Phytopathology
February 2012, Volume 102, Number 2
Pages 222-228
http://dx.doi.org/10.1094/PHYTO-03-11-0075
Identification and Fine-Mapping of Xa33, a Novel Gene for Resistance to Xanthomonas oryzae pv. oryzae
P. Natraj Kumar et al.,
Directorate of Rice Research, Rajendranagar, Hyderabad 500 030, India.
... Identification of putative candidate genes. The genomic se- quence between the flanking
SSR markers was downloaded from Japonica rice genome and analyzed using the online
software FGENESH (http://www.softberry.com). ... softberry.com). ...
Plant and Soil
July 2012, DOI
10.1007/s11104-012-1345-x
The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber
M. Migocka,
A. Warzybok,
G. Klobus
1. Institute of Experimental Biology, Department of Plant Physiology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland
... AtNRT1 cDNAs were retrieved from the database and further analyzed using FGENESH and
FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www. ... The structure of each gene was
determined using FGENESH or FGENESH+ programs available on softberry.com ...
Molecular Genetics and Genomics
Volume 287, Issue 4 , pp 295-311 DOI
10.1007/s00438-012-0675-y
Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model
Jian Wu et al.,
1. Key Laboratory of Horticultural Plant Growth, Development and Biotechnology, Agricultural Ministry of China, Department of Horticulture, Zhejiang University, 310058, Hangzhou, People’s Republic of China
... After searching for IAA genes, bioinformatics tools, such as DNASTAR and FGENESH
(http://linux1.softberry.com/berry) were used to analyze and predict those unknown IAAs.
Isolation of the open reading frame (ORF) cDNA sequences ...
Gene
Volume 499, Issue 1, 10 May 2012, Pages 108–120
http://dx.doi.org/10.1016/j.gene.2012.01.048
Genome-wide analysis of the mitogen-activated protein kinase gene family in Solanum lycopersicum
Fuling Kong et al.,
Key Laboratory of Horticultural Plant Growth, Development and Biotechnology, Agricultural Ministry of China, Department of Horticulture, Zhejiang University, Hangzhou 310058, People's Republic of China
... After searching for MAPK gene family, DNASTAR and FGENESH (http://linux1.softberry.com/berry)
were used to analyze and predict those MAPK domains. ... Each predicted SlMAPK sequence was
confirmed by FGENESH (http://www.softberry.com/berry.phtml?topic=fgenesh). ...
Journal of Integrative Plant Biology
Volume 54, Issue 5, pages 321–329, May 2012 DOI: 10.1111/j.1744-7909.2012.01112.x
Identification and Fine Mapping of rhm1 Locus for Resistance to Southern Corn Leaf Blight in Maize
Yuanzeng Zhao et al.,
1
State Key Laboratory of Agrobiotechnology and National Maize Improvement Center, Department of Plant Genetics and Breeding, China Agricultural University, Beijing 100193, China
2
Department of Life Science and Technology, Henan Institute of Science and Technology, Xinxiang 453003, China
... region contains only one putative protein-coding gene using the FGENESH gene prediction
program (http://linux1.softberry.com/berry.phtml). This predicted gene was a homologue of ... monocot
training set (http://linux1.softberry.com/berry.phtml). The predicted genes were ...
Theoretical and Applied Genetics
September 2012 DOI
10.1007/s00122-012-1975-7
Fine mapping and characterization of BPH27, a brown planthopper resistance gene from wild rice (Oryza rufipogon Griff.)
D. Huang et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, College of Life Science and Technology, Agricultural College, Guangxi University, Nanning, 530005, China
2. Rice Research Institute, Plant Protection Institute and Guangxi Rice Genetic Improvement and Biotechnology Lab, Guangxi Academy of Agricultural Sciences, Nanning, 530007, China
... The putative open reading frame (ORF) in the target region was predicted by the online
software GENESCAN and FGENESH of Softberry (www.softberry.com/berry.phtml) with
monocot plants as the model organism. Host selection behavior ...
Gene
Volume 507, Issue 1, 1 October 2012, Pages 54–60 http://dx.doi.org/10.1016/j.gene.2012.07.004,
Characterization of Aquilegia Polycomb Repressive Complex 2 homologs reveals absence of imprinting
Emily J. Gleason a, b,
Elena M. Kramer a,
a Dept. of Organismic and Evolutionary Biology, Harvard University, 16 Divinity Ave. Cambridge, MA, 02138, USA
b Dept. of Molecular and Cellular Biology, Harvard University, 16 Divinity Ave. Cambridge, MA, 02138, USA
... the query sequence. We then used the SoftBerry FGENESH program (http://linux1.
softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) to predict
open reading frames for the loci. cDNA sequences were ...
African Journal of Biotechnology
Vol. 11(40), pp. 9534-9542, 17 May, 2012 DOI: 10.5897/AJB12.040
Isolation and characterization of a candidate gene for
resistance to cereal cyst nematode from Aegilops
variabilis in China
D. L. Xu et al.,
1
Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan, China.
2
Graduate University of the Chinese Academy of Sciences, Beijing, China.
... The ORFs of the sequences were identified by FGENESH (http://linux1.softberry.com/) and the
amino acid sequence was obtained at the same time. ... The resulting sequences were analyzed
using NSITE-PL to identify regulatory motifs (http://linux1.softberry.com/). RESULTS ...
Theoretical and Applied Genetics
Volume 125, Issue 6 , pp 1125-1135 DOI
10.1007/s00122-012-1899-2
Characterization, fine mapping and expression profiling of Ragged leaves1 in maize
Haiying Guan et al.,
1. Department of Plant Genetics and Breeding, State Key Laboratory of Agrobiotechnology and National Maize Improvement Center of China, China Agricultural University, Beijing, 100193, China
2. Department of Life Science and Technology, Henan Institute of Science and Technology, XinXiang, 453003, China
... 2004). The gene prediction was conducted by Softberry (http://linux1.softberry.com/berry.
phtml?topic=fgenesh&group=programs&subgroup=gfind). Transcriptome sequencing and gene
annotation The BC3 segregating population was grown in a green- house. ...
Molecular Genetics and Genomics
Volume 287, Issue 3 , pp 247-259 DOI
10.1007/s00438-012-0674-z
Candidate genes within a 143 kb region of the flower sex locus in Vitis
Iris Fechter et al.,
1. Julius Kuhn-Institut, Federal Research Centre for Cultivated Plants, Institute for Grapevine Breeding Geilweilerhof, 76833, Siebeldingen, Germany
2. Center for Biotechnology, Bielefeld University, 33594, Bielefeld, Germany
... PCR amplifications were per- formed to ensure order of contigs in cases of
uncertainties. Gene prediction The sequences were annotated from the scaffolds
using the software FGENESH (http://linux1.softberry.com/berry. phtml). ...
Braz. J. Plant Physiol.,
24(1): 69-73, 2012
Isolation and in silico characterization of cDNA encoding
cyclophilin from etiolated Vigna mungo seedlings
Kalika Kuhar
1
, Varun Kumar Gupta
1
, Rekha Kansal
2
, Vijay Kumar Gupta
1
*
1
Department of Biochemistry, Kurukshetra University, Kurukshetra, Haryana, India.
2
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (PUSA), New Delhi, India.
... The nucleotide sequence was analyzed in silico using VecScreen program of National
Center for Biotechnology Information (NCBI), Basic Local Alignment Search Tool (BLAST),
FGENESH program of Softberry web server and BioEdit. ...
Mol Biol Evol
2012, 29 (2): 631-645.
doi: 10.1093/molbev/msr208
Zisupton—A Novel Superfamily of DNA Transposable Elements Recently Active in Fish
Astrid Bohne et al.,
1Institut de Genomique Fonctionnelle de Lyon, Universite de Lyon, Universite Lyon 1, Centre National de la Recherche Scientifique, Institut National de la Recherche Agronomique, Ecole Normale Superieure de Lyon, Lyon, France
2Department of Physiological Chemistry I, Biocenter, University of Wurzburg, Wurzburg, Germany
... 10 ?05 . Automatic sequence annotation was refined manually using expressed
sequence tag data and related protein sequences with the help of FGENESH on
the softberry web server (http://linux1.softberry.com). Nucleotide ...
3 Biotech.
2012 September; 2(3): 199–209. Published online 2012 March 24. doi: 10.1007/s13205-012-0047-7
Cloning, characterization and expression analysis of a novel gene encoding Kunitz-type protease inhibitor from Dolichos biflorus
Kalika Kuhar,1 Rekha Kansal,2 Amit Mishra,2 Kirpa Ram Koundal,2 and Vijay Kumar Gupta 1
1Department of Biochemistry, Kurukshetra University, Kurukshetra, Haryana India
2National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute (PUSA), New Delhi, India
... The primers were designed from the coding region of the genes determined through Softberry
software following the standard rules and analyzed using Fast PCR software for self-dimers,
melting temperature ... 2) as predicted by FGENESH program of Softberry web server. ...
FGENESH 2011
Immunogenetics
2011 Nov;63(11):753-71. doi: 10.1007/s00251-011-0549-1. Epub 2011 Jun 28.
Defining the turkey MHC: identification of expressed class I- and class IIB-like genes independent of the MHC-B
Reed et al.,
Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St Paul, MN 55108, USA
... Final assembly of repeated contigs was confirmed by PCR and resequencing. Gene identification
and annotation Sequences were analyzed with Softberry FGENESH and BLAST
(http://linux1.softberry.com/all.htm) to identify putative transcripts and homologies to known genes. ...
Journal of Insect Physiology
Volume 58, Issue 4, April 2012, Pages 570–579 DOI: 10.1016/j.jinsphys.2011.12.009
Localization of two Na+- or K+-H+ antiporters, AgNHA1 and AgNHA2, in Anopheles gambiae larval Malpighian tubules and the functional expression of AgNHA2 in yeast
Minghui A. Xiang a, c, Paul J. Linser b, David A. Price b, William R. Harvey b, c, d, e
a Division of Nephrology and Hypertension, Department of Medicine, University of Florida-Jacksonville, Jacksonville, FL 32206, USA
b Whitney Mosquito Biology Group, University of Florida, 9505 Ocean Shore Boulevard, St. Augustine, FL 32080, USA
... gambiae that were applied to FGENESH at the Softberry site (http://www.softberry.com/berry.phtml)
identified a cDNA from a genomic region of 30 kb; it included the originally predicted cDNA
exons and predicted two more exons at the 5? end although it had the same 3 ...
BMC Proceedings
2011, 5(Suppl 7):P65 doi:10.1186/1753-6561-5-S7-P65
Genome characterization of a Eucalyptus natural mutant
Fuchs et al.,
1 Departamento de Genetica, Instituto de Biociencias, Universidade Estadual Paulista (UNESP), Distrito de Rubiao Jr s/n CEP 18618-000, Botucatu (SP), Brazil
2 Departamento de Genetica, Escola Superior de Agricultura “Luiz de Queiroz” (ESALQ), Universidade de Sao Paulo (USP), Avenida Padua Dias, 11 CEP 13418-900, Piracicaba (SP), Brazil
... phytozome.net/ webcite) using BLAST. The genomic region identified was analyzed
by FGENESH tool (Softberry, Inc. – http://www.softberry.com webcite) to find predicted
genes in the region. Predicted genes were translated ...
Journal of Insect Physiology
Volume 57, Issue 9, September 2011, Pages 1190–1197 DOI: 10.1016/j.jinsphys.2011.05.011
Functions of duplicated genes encoding CCAP receptors in the red flour beetle, Tribolium castaneum
Bin Li a, 1, Richard W. Beeman b, Yoonseong Park a
a Department of Entomology, Waters Hall, Kansas State University, Manhattan, KS 66506, USA
b USDA-ARS Center for Grain and Animal Health Research, 1515 College Avenue, Manhattan, KS 66502, USA
... Initial search results were further analyzed using the gene prediction software FGENESH
(http://linux1.softberry.com/berry.phtml). Similar methods were used to mine candidate CCAP
receptors from other insect genomes for comparisons of gene structures and sequences. ...
Funct Integr Genomics.
2011 Dec;11(4):599-609. doi: 10.1007/s10142-011-0237-0. Epub 2011 Jul 16.
Recent insertion of a 52-kb mitochondrial DNA segment in the wheat lineage
Zhang J, Jia J, Breen J, Kong X.
Key Laboratory of Crop Germplasm Resources and Utilization, MOA/Institute of Crop Science, CAAS/The Key Facility for Crop Gene Resources and Genetic Improvement, Beijing, People's Republic of China
... plot analysis (Krumsiek et al. 2007). Gene prediction and function assignment Gene
prediction was performed using FGENESH at softberry web site (http://www.softberry.
com) and GENES- CAN. Then, BLASTP against the non ...
Fungal Biology
Volume 116, Issue 2, February 2012, Pages 225–233 DOI: 10.1016/j.funbio.2011.11.005
mrflbA, encoding a putative FlbA, is involved in aerial hyphal development and secondary metabolite production in Monascus ruber M-7
Yishan Yang c, Li Li c, Xin Li c, Yanchun Shao a, c, Fusheng Chen a, b, c,
a State Key Laboratory of Agricultural Microbiology, Wuhan 430070, Hubei Province, PR China
b Key Laboratory of Food Safety Evaluation of the Ministry of Agriculture, Wuhan 430070, Hubei Province, PR China
... Specific primers for 3'RACE were designed according to the predicted cDNA sequence of the
mrflbA or mga1 gene using SoftBerry's FGENESH program (http://linuxl.softberry.com/ berry.phtml),
while primers for 5'RACE were designed according to the sequences obtained by 3 ...
Breast Cancer Research and Treatment
Volume 130, Issue 3 , pp 1003-1010 DOI: 10.1007/s10549-011-1677-x
Further evidence for the contribution of the RAD51C gene in hereditary breast and ovarian cancer susceptibility
Vuorela et al.,
1. Laboratory of Cancer Genetics, Department of Clinical Genetics and Biocenter Oulu, University of Oulu, Oulu University Hospital, P.O. Box 5000, 90014, Oulu, Finland
2. Department of Pathology and Forensic Medicine, School of Medicine, Institute of Clinical Medicine, University of Eastern Finland, 70211, Kuopio, Finland
... 2). According to FPROM human promoter prediction software (Softberry, Inc., Mt. ... FGENESH
(Softberry, Inc., Mt. Kisco, NY), are abolished. Based on bioinformatics, the observed
27 bp deletion thus produces a null allele, and is pathogenic. ...
Biologia Plantarum
Volume 55, Issue 4 , pp 614-624 DOI: 10.1007/s10535-011-0159-7
Molecular cloning and phylogenetic analysis of cereal type II metacaspase cDNA from wheat
E. Piszczek, M. Dudkiewicz, M. Sobczak
1. Department of Biochemistry, Warsaw University of Life Sciences, 159 Nowoursynowska, PL-02776, Warsaw, Poland
2. Department of Experimental Design and Bioinformatics, Warsaw University of Life Sciences, 159 Nowoursynowska, PL-02776, Warsaw, Poland
... The identification of the coding region, open reading frame and the translation of TaeMCAII
nucleotide sequence were made based on the FGENESH gene structure prediction using an
HMM model constructed for monocot plants (SoftBerry software http://linux1.softberry.com ...
Plant Cell Reports
Volume 30, Issue 11 , pp 2059-2073 DOI: 10.1007/s00299-011-1113-z
Identification, isolation and expression analysis of auxin response factor (ARF) genes in Solanum lycopersicum
J. Wu et al.,
1. Key Laboratory of Horticultural Plant Growth, Development and Biotechnology, Agricultural Ministry of China, Hangzhou, 310058, People’s Republic of China
2. Department of Horticulture, Zhejiang University, Hangzhou, 310058, People’s Republic of China
... databases. After searching for ARF genes, bioinformatics tools, such as DNASTAR and
FGENESH (http://linux1.softberry.com/berry) were used to analyze and predict those
unknown SlARFs. ... www. softberry.com/berry.phtml?topic=fgenesh). ...
Sains Malaysiana
40 (4). pp. 331-337. ISSN 0126-6039
Cloning and analysis of pyrG gene encoding orotidine 5-Monophosphate decarboxylase of aspergillus oryzaeStrain S1
Selina Oh Siew Ling, and Leong , Jiun Min and Abdul Munir Abdul Murad, and Nor Muhammad Mahadi , and Farah Diba Abu Bakar
BGI
... 475 bp). The pyrG contained one intron at position 623-687 bp based on the
AUGUSTUS and FGENESH (SoftBerry) analysis corresponding to the intron present
in the pyrG of A. oryzae (Accession Number: Y13811). In silico ...
Nucl. Acids Res.
(2011) 39 (suppl 1): D637-D639.
doi: 10.1093/nar/gkq1016
FGDB: revisiting the genome annotation of the plant pathogen Fusarium graminearum
Wong et al.,
1Helmholtz Zentrum Munchen, German Research Center for Environmental Health, Institute of Bioinformatics and Systems Biology, Ingolstadter Landstrasse 1, D-85764 Neuherberg, 2Max-Planck-Institute for Terrestrial Microbiology, Department of Organismic Interactions, D-35043 Marburg
... Based on this set, all gene loci in FGDB v3.1 were re-annotated using a pipeline including (i)
Fgenesh with different matrices (www.softberry.com); (ii) GeneMark-ES (8); (iii) Augustus with
ESTs, precedingly annotated Fusarium models and/or Neurospora crassa protein ...
Theoretical and Applied Genetics
Volume 123, Issue 4 , pp 625-633 DOI: 10.1007/s00122-011-1612-x
Fine-mapping of the woolly gene controlling multicellular trichome formation and embryonic development in tomato
Changxian Yang, Hanxia Li, Junhong Zhang, Taotao Wang, Zhibiao Ye
1. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China
2. Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan, 430070, China
... Protein coding genes were predicted from the resul- tant contig using the FGENESH program
(http://linux1.soft- berry.com/berry.phtml). ... Analysis of the »200 kb sequence revealed that this
fragment contains 19 ORFs as automatically predicted by FGENESH (http://softberry. ...
POJ
4(5):239-249(2011)
Comparative analysis of the genomic regions flanking Xa21 locus in indica and japonica ssp.
of rice (Oryza sativa L.)
Kumar et al.,
1Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Gachibowli Prof. C.R. Rao
Road , Hyderabad 500046, India
2Department of Plant Pathology, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India
... Protcomp V 8.0 (http://linux1.softberry.com/ berry.phtml) analysis for the sub cellular location of
proteins showed that 80% of the predicted TEs were nuclear in localization while the remaining
were cytoplasmic or mitochondrial in both the rice lines (Table 9). GC Content in the ...
...Gene prediction from the 100 kb region flanking to Xa21
locus of chromosome 11 in japonica and indica rice was
carried out using HMM based gene structure prediction
software FGENESH tool (www.softberry.com) trained for
monocot plant species (Salamov and Solovyer, 2000) ...
Eukaryotic Cell
doi: 10.1128/EC.05255-11 December 2011 vol. 10 no. 12 1740-1741
Draft Genome Sequence of Penicillium marneffei Strain PM1
Woo et al.,
1Department of Microbiology
2State Key Laboratory of Emerging Infectious Diseases, The University of Hong Kong, Hong Kong
... genome, were sequenced. The Phred/Phrap/Consed software package was used
for base calling and sequence assembly (1,–,5). Protein-coding genes and introns
were predicted using FGENESH (Softberry). The draft genome ...
Theoretical and Applied Genetics
Volume 122, Issue 5 , pp 1017-1028 DOI: 10.1007/s00122-010-1506-3
The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes
Yuan et al.,
1. Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China
2. Hubei Academy of Agricultural Science, Wuhan, 430064, China
... Wang et al. 2009). The gene content in the equivalent interval of cv. Nipponbare
was predicted using GENESCAN (http://genes.mit.edu/ GENSCAN.html) and
FGENESH (http://www.softberry. com). DNA sequence comparisons ...
BMC Proceedings
2011, 5(Suppl 7):O17 doi:10.1186/1753-6561-5-S7-O17
High-throughput targeted SNP discovery using Next Generation Sequencing (NGS) in few selected candidate genes in Eucalyptus camaldulensis
Prasad S Hendre *, Rathinam Kamalakannan, Rathinavelu Rajkumar and Mohan Varghese
ITC R&D Centre, Peenya Insdustrial Area, No.3, 1st Main, 1st Phase, Bangalore- 560 058, Karnataka, India
... block. Web-based gene prediction tool FGENESH (http://linux1.softberry.com webcite)
was used for identifying genic regions such as UTRs, exons and introns with
Arabidopsis thaliana gene model. Results and discussion. Forty ...
Fungal Biology
Volume 115, Issue 8, August 2011, Pages 775–781 DOI: 10.1016/j.funbio.2011.06.002,
Characterisation of the ArmA adenylation domain implies a more diverse secondary metabolism in the genus Armillaria
Mathias Misiek, Jana Braesel, Dirk Hoffmeister
Friedrich-Schiller-Universitat Jena, Department Pharmaceutical Biology at the Hans-Knoll-Institute, Beutenbergstrasse 11a, 07745 Jena, Germany
... The Aspergillus, Laccaria, or Phanerochaete search algorithms of FGENESH (Softberry, Mount
Kisco, NY) were used to predict gene structures and exon/intron junctions in the insert sequences
of three previously identified Armillaria cosmids 108, 138, and 152 (Misiek & ...
Mol Biol Evol
(2011) 28 (6): 1913-1926. doi: 10.1093/molbev/msr012
Molecular Evolution of the Metazoan PHD–HIF Oxygen-Sensing System
Kalle T. Rytkonen *,1, Tom A. Williams 2, Gillian M. Renshaw 3, Craig R. Primmer 1 and Mikko Nikinmaa 1
1Division of Genetics and Physiology, Department of Biology, University of Turku, Turku, Finland
2Department of Genetics, University of Dublin, Trinity College, Dublin, Ireland
... surrounding the primary BlastP hits in the genome contigs and repredicted the gene structure
using three independent pieces of software: GENESCAN (http://genes.mit.edu/GENSCAN.html),
Augustus (http://augustus.gobics.de/), and FGENESH (http://linux1.softberry.com). ...
Theoretical and Applied Genetics
Volume 123, Issue 4 , pp 585-601 DOI: 10.1007/s00122-011-1609-5
Towards an understanding of the nature of resistance to Phytophthora root rot in red raspberry
Graham et al.,
1. Genetics Department, Scottish Crop Research Institute, Invergowrie, Dundee, DD2 5DA, Scotland, UK
2. Biomathematics and Statistics Scotland, Invergowrie, Dundee, DD2 5DA, Scotland, UK
... Gene prediction Open reading frames from both BAC sequences were identified
using the Softberry gene structure prediction program FGENESH (http://linux1.
softberry.com/berry. phtml) using Vitis vinifera as the reference. ...
Applied Microbiology and Biotechnology
Volume 89, Issue 6 , pp 1851-1858 DOI: 10.1007/s00253-010-3016-2
An acid and highly thermostable xylanase from Phialophora sp. G5
Zhang et al.,
1. Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, No. 12 Zhongguancun South Street, Beijing, 100081, China
2. School of Biology and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan, 430023, China
... ncbi.him.nih.gov/gorf/gorf/gorf.html). Genes, introns, exons and transcription initiation sites were
predicted using the online software FGENESH (http://linux1.softberry.com/ berry.phtml). The signal
peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). ...
Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184–194 DOI: 10.1016/j.exppara.2010.07.012
Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases
Tiago M. Martins a, b, , , Virgilio E. do Rosario b, Ana Domingos a, b
a Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal
b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal
... A threshold of E ? 1e-04 was adopted for the tblastn search (Wu et al., 2003). The gene
structure of the identified CP genes with multiple exons was predicted using the
FGENESH and FGENESH+ software (http://www.softberry.com). ...
Advanced Studies in Biology
Vol. 3, 2011, no. 4, 169 – 180
Genetic Disease Resistance and Conservation of a
Plant Gene that Encodes a Mitogen-Activated Protein
Kinase Kinase Kinase
L. David Kuykendall, Jonathan Y. Shao, Rachel P. Naegele and J. Mitchell McGrath
Molecular Plant Pathology Laboratory, Plant Sciences Institute Beltsville
Agricultural Research Center, Beltsville MD 20705, USA
Department of Crop and Soil Sciences and USDA-ARS
Sugar Beet and Bean Research, Michigan State University
East Lansing, MI 48824-1325,USA
...The sequence contig was screened for coding sequence using a
combination of the following programs:
GeneMark [21] for eukaryotes:(http://exon.gatech.edu/GeneMark/eukhmm.cgi),
GenScan [22] (http://genes.mit.edu/GENSCAN.html)
FGENESH (http://linux1.softberry.com/berry.phtml...
Comparative and Functional Genomics
Volume 2011 (2011), Article ID 286089, 9 pages
doi:10.1155/2011/286089
Repertoire of SSRs in the Castor Bean Genome and Their Utilization in Genetic Diversity Analysis in Jatropha curcas
Arti Sharma and Rajinder Singh Chauhan
Department of Biotechnology & Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani, Kandaghat, Solan 173 215, India
... Castor bean genome sequence contigs harboring SSRs were annotated for putative open reading
frames, including 5?UTRs and 3?UTRs, using gene prediction algorithms of FGenesH
(http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind ...
Advanced Science Letters
Volume 4, Numbers 11-12, November 2011 , pp. 3653-3657(5) DOI: http://dx.doi.org/10.1166/asl.2011.2027
Cloning and Sequence Analysis of Candidate Disease Resistance Genes from Dongxiang Common Wild Rice (O. rufipogon Griff.)
Han, Xiaoxia et al.,
BGI
... The Genomic DNA Sequence Analysis DNA sequence location and similarity analysis was
performed by BLAST program (http://www.ncbi.nlm.nih.gov/).13 Gene pre- diction was performed
by FGENESH (Solovyev and Salamov 1999; http://www.softberry.com/berry.phtml) and ...
New Phytologist
2011, 192: 164–178. doi: 10.1111/j.1469-8137.2011.03800.x
Comparative analysis of peanut NBS-LRR gene clusters suggests evolutionary innovation among duplicated domains and erosion of gene microsynteny.
Ratnaparkhe et al.,
1 Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30602, USA
2 Center for Genomics and Computational Biology, School of Life Sciences, School of Sciences, Hebei United University, Tangshan, Hebei 063000, China
... sequenced. Assembled sequences were visualized and manually edited using
Consed (Gordon et al., 1998). Peanut BAC sequences were annotated using gene
prediction programs FGENESH (http://www.softberry.com). The ...
Plant Molecular Biology Reporter
Volume 29, Issue 4 , pp 769-783 DOI: 10.1007/s11105-010-0284-z
Genome-Wide Analysis of Fatty Acid Desaturases in Soybean (Glycine max)
Xiaoyuan Chi et al.,
1. Shandong Peanut Research Institute, Qingdao, 266100, People’s Republic of China
2. Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao, 266101, People’s Republic of China
... The searches were iterated until convergence. As for the incorrectly predicted genes,
manual reannotation was performed using online web server FGENESH
(http://linux1.softberry.com/berry.phtml; Salamov and Solovyev 2000). ...
Molecular Genetics and Genomics
Volume 285, Issue 1 , pp 79-90 DOI: 10.1007/s00438-010-0587-7
Relative evolutionary rates of NBS-encoding genes revealed by soybean segmental duplication
Xiaohui Zhang et al.,
1. State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, 210093, China
2. National Center for Soybean Improvement, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
... All new BLAST hits in the genomes, together with flanking regions of 5,000–10,000 bp at both
sides, were annotated using the gene-finding programs FGENESH with the legume plant training
set (http://www.softberry.com/) and GENSCAN with the Arabidopsis training set (http ...
Metabolic Engineering
Volume 13, Issue 6, November 2011, Pages 723–732 DOI: 10.1016/j.ymben.2011.09.008
Identification and engineering of the cytochalasin gene cluster from Aspergillus clavatus NRRL 1
Kangjian Qiao a, Yit-Heng Chooi a, Yi Tang a, b,
a Department of Chemical and Biomolecular Engineering, University of California, Los Angeles, CA 90095, United States
b Department of Chemistry and Biochemistry, University of California, Los Angeles, CA 90095, United States
... Gene predictions were performed via FGENESH program (www.softberry.com) and manually
checked based on homologous gene/protein sequences in the GenBank database. Protein
domain functions were deduced using Conserved Domain Search (NCBI). 2.3. ...
International Journal of Plant Genomics
Volume 2011 (2011), Article ID 370548, 8 pages
doi:10.1155/2011/370548
Genes Encoding Callose Synthase and Phytochrome A Are Adjacent to a MAP3K?-Like Gene in Beta vulgaris US H20
L. David Kuykendall and Jonathan Y. Shao
Molecular Plant Pathology Laboratory, Agricultural Research Service, US Department of Agriculture, Plant Sciences Institute, Beltsville Agricultural Research Center, 10300 Baltimore Avenue, Building 004, Room 120, BARC-West, Beltsville, MD 20705, USA
... NCBI BLAST [8]. The 125 Kb sequence was screened for coding sequence using a combination
of the following programs: GeneMark [9, 10] for eukaryotes (http://exon.gatech.edu/GeneMark/
eukhmm.cgi), Augustus (http://augustus.gobics.de/), and FgenesH (http://softberry.com ...
BMC Plant Biology
2011, 11:44 doi:10.1186/1471-2229-11-44
Characterisation of the legume SERK-NIK gene superfamily including splice variants: Implications for development and defence
Kim E Nolan, Sergey Kurdyukov and Ray J Rose
Australian Research Council Centre of Excellence for Integrative Legume Research, School of Environmental and Life Sciences. The University of Newcastle. University Dr. Callaghan, NSW, 2308, Australia
... potential coding regions from the individual genomic sequences were predicted
using FGENESH software (Softberry; http://linux1.softberry.com webcite) ...
Journal of Bioscience and Bioengineering
Volume 112, Issue 6, December 2011, Pages 551–557 DOI: 10.1016/j.jbiosc.2011.08.018,
Acidic b-mannanase from Penicillium pinophilum C1: Cloning, characterization and assessment of its potential for animal feed application
Hongying Cai et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
2 Department of Microbial Engineering, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... Introns, exons and transcription initiation sites were predicted using the online software
FGENESH (http://linux1.softberry.com/berry.phtml). The signal peptide was predicted
using SignalP (http://www.cbs.dtu.dk/services/SignalP/). ...
Journal of Molecular Evolution
Volume 72, Issue 5-6 , pp 498-509 DOI: 10.1007/s00239-011-9448-1
Co-Variation Among Major Classes of LRR-Encoding Genes in Two Pairs of Plant Species
Jiao Wang, Shengjun Tan, Li Zhang, Ping Li, Dacheng Tian
1. State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, 210093, China
2. Rice Research Institute, Sichuan Agricultural University, Wenjiang, 611130, China
.. Their sequences and corresponding annotations were downloaded from the online databases
(Table S1). The annotation methods and quality could affect the gene identification. To estimate
the bias, we used the ab initio gene finder FGENESH (http://linux1.softberry. ...
New Phytologist
189: 321–334. doi: 10.1111/j.1469-8137.2010.03462.x
The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication.
Zhai et al.,
1 Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China
2 Rice Research Institute, Guangdong Provincial Academy of Agricultural Sciences, Guangzhou, 510640, China
... Candidate gene identification. The gene annotation tools RiceGAAS (http://ricegaas.dna.affrc.
go.jp) and FGENSH (http://www.softberry.com) were used to identify Pik candidates within the
166-kb segment of cv Nipponbare defined by the flanking markers K34 and K28 (Fig. 1a). ...
Process Biochemistry
Volume 46, Issue 12, December 2011, Pages 2341–2346 DOI: 10.1016/j.procbio.2011.09.018,
A novel thermoacidophilic family 10 xylanase from Penicillium pinophilum C1
Cai et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... The signal peptide was predicted using SignalP (http://www.cbs.dtu.dk/services/SignalP/). The
exon–intron structure and transcription initiation sites of the full-length gene were predicted using
the online software FGENESH (http://linux1.softberry.com/berry.phtml). ...
International Journal of Plant Genomics
Volume 2011 (2011), Article ID 291563, 12 pages
doi:10.1155/2011/291563
Comparative Genomics in Perennial Ryegrass (Lolium perenne L.): Identification and Characterisation of an Orthologue for the Rice Plant Architecture-Controlling Gene OsABCG5
Hiroshi Shinozuka, 1,2,3 Noel O. I. Cogan, 1,2,3 German C. Spangenberg, 1,2,3,4 and John W. Forster 1,2,3,4
1Biosciences Research Division, Department of Primary Industries, Victorian AgriBiosciences Centre, La Trobe University Research and Development Park, 1 Park Drive, Bundoora, VIC 3083, Australia
2Molecular Plant Breeding Cooperative Research Centre, Bundoora, VIC 3083, Australia
... Gene structure prediction was performed using the FGENESH program with the parameter setting
for monocot plants (http://linux1.softberry.com/berry.phtml). Phylogenetic analysis was performed
using the CLUSTALW program (http://www.genome.jp/tools/clustalw/). ...
Advanced Studies in Biology
Vol. 3, 2011, no. 1, 13 - 24
A Plant Gene Encodes a ‘HSFA9-like’ Heat Shock
Factor and is Part of a Cluster of Orthologous Genes
Including NPR1, CaMP and CK1 in Beta vulgaris,
Populus trichocarpa, Solanum lycopersicum
and Vitis vinifera
David Kuykendall, Jonathan Shao, Kate Burdekin and Lauren Conway
Molecular Plant Pathology Laboratory, PSI, BARC
10300 Baltimore Avenue, Beltsville, MD 20705 USA
...Putative genes in these genomic regions were annotated using FGenesH
program (Gene finding in Eukaryota, http://linux1.softberry.com/). ...
The Journal of Microbiology
Volume 49, Issue 3 , pp 473-480 DOI: 10.1007/s12275-011-0362-4
Isolation and characterization of a reducing polyketide synthase gene from the lichen-forming fungus Usnea longissima
Wang et al.,
1. Korean Lichen Research Institute, Sunchon National University, Sunchon, 540-742, Republic of Korea
... The potential open reading frame (ORF) of FoNRks2662 was scanned with FGENESH (Berg
et al., 2008) using Aspergillus as the matrix (http://linux1. softberry.com). The putative function
of these ORFs was determined using a basic local alignment search tool (BLAST). ...
Genome
2011, 54(12): 1041-1044, DOI: 10.1139/g11-068
Isolation of a strawberry gene fragment encoding an actin depolymerizing factor-like protein from genotypes resistant to Colletotrichum acutatum
Marta Ontivero, a Gustavo Martinez Zamor a,b Sergio Salazar, c Juan Carlos Diaz Ricci, b Atilio Pedro Castagnaro a
Seccion Biotecnologia, Estacion Experimental Agroindustrial Obispo Colombres-Unidad Asociada al INSIBIO, Av. William Cross 3150, 4101 Las Talitas, Tucuman, Argentina.
bInstituto Superior de Investigaciones Biologicas (INSIBIO; CONICET- UNT) and Instituto de Quimica Biologica “Dr. Bernabe Bloj”, Universidad Nacional de Tucuman. Chacabuco 461, 4000 Tucuman. Argentina.
... The deduced amino acid sequence showed identity scores ranging between 93% and 60%,
with E values comprised between 1 ? 10 –37 and 6 ? 10 –44 . The gene prediction programs
SPL and FGENESH 2.6 (www.softberry.com) (Solovyev et al. ...
Plant Molecular Biology
Volume 77, Issue 1-2 , pp 59-75 DOI: 10.1007/s11103-011-9794-9
BraSto, a Stowaway MITE from Brassica: recently active copies preferentially accumulate in the gene space
Veronique Sarilar, Anne Marmagne, Philippe Brabant, Johann Joets, Karine Alix
1. AgroParisTech/CNRS, UMR 0320/UMR 8120 Genetique Vegetale INRA/Univ. Paris-Sud/CNRS/AgroParisTech, Ferme du Moulon, 91190, Gif-sur-Yvette, France
2. CNRS, UMR 0320/UMR 8120 Genetique Vegetale INRA/Univ. Paris-Sud/CNRS/AgroParisTech, Ferme du Moulon, 91190, Gif-sur-Yvette, France
... We used a combination of FGENESH v.2.6 (http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&subgroup=gfind, Salamov and Solovyev 2000), with arabidopsis
thaliana (arabidopsis) as the reference model, and BLASTP to characterize the genomic ...
Front Plant Sci.
2011; 2: 35. DOI: 10.3389/fpls.2011.00035
Mining Disease-Resistance Genes in Roses: Functional and Molecular Characterization of the Rdr1 Locus
Terefe-Ayana et al.,
1Institute for Plant Genetics, Leibniz University Hannover, Hannover, Germany
... Gene prediction and annotation. Bioedit (Hall, 1999) was used for viewing and editing of
sequences. Gene prediction and annotation was done using the gene prediction programs
FGENESH and GENSCAN (http://www.softberry.com; http://genes.mit.edu/GENSCAN.html). ...
Journal of Plant Genetics and Transgenics
Vol 2, No 1 (2011) Chandel
In Silico Expression Analysis of QTL Specific Candidate Genes for Grain Micronutrient (Fe/Zn) Content Using ESTs and MPSS Signature Analysis in Rice (Oryza sativa L.)
Girish Chandel, P. Samuel, M. Dubey, R. Meena
BGI
... The nucleotide sequences were downloaded and analyzed for open reading frames (ORFs)
and the CDS (Coding DNA sequence) using gene prediction algorithms of FGenesH
(http://sun1.softberry.com/berry.phtml?topic=fgenesh&group =programs&subgroup=gfin). ...
Plant Physiology
March 2011 vol. 155 no. 3 1301-1311 DOI: 10.1104/pp.110.168500
Genetic Control of a Transition from Black to Straw-White Seed Hull in Rice Domesticationome
Zhu et al.,
National Center for Gene Research and Institute of Plant Physiology and Ecology (B.-F.Z., L.S., Y.Z., J.Z., Y.S., D.L., D.F., C.L., B.H.) and State Key Laboratory of Plant Molecular Genetics and Institute of Plant Physiology and Ecology (H.L.), Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200233, China;
... fully sequenced (Fig. 2C). Only one open reading frame (ORF) was identified in
the 8.8-kb DNA fragment using FGENESH gene prediction analysis (http://linux1.
softberry.com/berry.phtml; Fig. 2D). Two BACs corresponding ...
PLoS ONE
6(8): e24230. doi:10.1371/journal.pone.0024230
Next Generation Sequencing Provides Rapid Access to the Genome of Puccinia striiformis f. sp. tritici, the Causal Agent of Wheat Stripe Rust
Cantu et al.,
Department of Plant Sciences, University of California Davis, Davis, California, United States of America
Genome Center, University of California Davis, Davis, California, United States of America
... 12]. Exon-intron structures of transposable elements were predicted with the aid
of Softberry FGENESH (linux1.softberry.com). Protein sequences of transposable
elements were aligned using MAFFT with the linsi option [29]. ...
J. Exp. Bot.
(2011) 62 (8): 2585-2597.
doi: 10.1093/jxb/erq433
Time course and amplitude of DNA methylation in the shoot apical meristem are critical points for bolting induction in sugar beet and bolting tolerance between genotypes
Trap-Gentil et al.,
1Universite d'Orleans, UFR-Faculte des Sciences, UPRES EA 1207 ‘Laboratoire de Biologie des Ligneux et des Grandes Cultures’ (LBLGC), rue de Chartres, BP 6759, F-45067 Orleans, France
2INRA, USC1328 Arbres et Reponses aux Contraintes Hydriques et Environnementales (ARCHE), F-45067 Orleans, France
... The determination of transposable elements (TEs) in the BvFLC and BvVIN3 genomic sequences
was realized by the identification of potential coding sequences (Fgenesh on http://linux1.softberry.
com/berry.phtml) followed by similarity analysis using BLASTP and analysis of ...
African Journal of Biotechnology
Vol. 10 (66), pp. 14738-14745, 26 October, 2011
DOI: 10.5897/AJB11.667
Isolation of candidate disease resistance genes from enrichment library of Oryza minuta based on conserved domains
Han et al.,
1State Key Laboratory of Hybrid Rice, Longping Branch of Graduate School, Central South University, Changsha 410125, P. R. China.
2China National Hybrid R&D Center, Changsha 410125, P. R. China.
... The gene prediction program used was FGENESH (http:// www.softberry.com.cn), and the
domains were predicted by the SMART program (http://smart.embl-heidelberg.de/) and CDD
program (http://www.ncbi.nlm.nih.gov/sites/entrez?db=cdd). Results. ...
Molecular Breeding
Volume 28, Issue 3 , pp 343-357 DOI: 10.1007/s11032-010-9487-0
Identification of suitable reference genes for studying gene expression in cucumber plants subjected to abiotic stress and growth regulators
M. Migocka, A. Papierniak
1. Department of Plant Physiology, Institute of Plant Biology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland
... The selected cucumber sequences were then input into the programs identifying the full
cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.gatech.edu/
eukhmm.cgi) and FGENESH (http://www.softberry.ru/berry.phtml). ...
BMC Evolutionary Biology
2011, 11:165 doi:10.1186/1471-2148-11-165
Immunoglobulin heavy chains in medaka (Oryzias latipes)
Susana Magadan-Mompo 1, Christian Sanchez-Espinel 2 and Francisco Gambon-Deza 3
1 Oceanographic Center of Vigo, Spanish Institute of Oceanography (IEO), Subida a Radio Faro 50, 36390 Vigo, Pontevedra, Spain
2 Shared Unit of Immunology, University of Vigo - Vigo University Hospital Complex (Hospital Meixoeiro), Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As LagoasMarcosende, Vigo 36310, Pontevedra, Spain
... immunoglobulin mRNAs. Limits of unpublished antibodies were deduced following
instructions in the software FGENESH (http://www.softberry.com webcite) and Augustus
(http://augustus.gobics.de/submission webcite) [26]. Messenger ...
New Phytologist
189: 710–722. doi: 10.1111/j.1469-8137.2010.03492.x
Isolation and characterization of MAT genes in the symbiotic ascomycete Tuber melanosporum.
Rubini et al.,
1 National Research Council, Plant Genetics Institute – Perugia Division, Via della Madonna Alta 130, I–06128 Perugia, Italy
2 UMR 1136, Interactions Arbres/Microorganismes, INRA-Nancy, F–54280 Champenoux, France
... comparison and dotplot analysis were carried out using National Center for Biotechnology
Information (NCBI) blast and Dotmatcher (EMBOSS Package v. 6.0.1). Gene structure prediction
of MAT1-1-1 was performed with fgenesh software (http://linux1.softberry.com) using ...
Journal of Plant Biology
Volume 54, Issue 5 , pp 294-302 DOI: 10.1007/s12374-011-9166-7
Genetic Variation and Evolution of the Pi9 Blast Resistance Locus in the AA Genome Oryza Species
Liu et al.,
1. Hunan Provincial Key Laboratory of Crop Germplasm Innovation and Utilization, Hunan Agricultural University, Changsha, Hunan, 410128, China
3. Crop Biotech Institute & Graduate School of Biotechnology, Kyung Hee University, Yongin, 446–701, South Korea
... by MEGA 4.0. Gene coding regions were predicted with GeneScan (http://genes.mit.edu/
GENSCAN.html) and Fegenesh (http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&subgroup=gfind) using the Pi9 sequence as the reference. ...
Molecular Genetics and Genomics
Volume 286, Issue 1 , pp 21-36 DOI: 10.1007/s00438-011-0616-1
Mapping Fusarium wilt race 1 resistance genes in cotton by inheritance, QTL and sequencing composition
Ulloa et al.,
1. USDA-ARS, Western Integrated Cropping Systems Research Unit, 17053 N. Shafter Ave., Shafter, CA, 93263, USA
2. Department of Nematology, University of California-Riverside, Riverside, CA, 92521, USA
... for analysis. Gene predic- tion and annotation were performed with the gene predic-
tion programs Augustus (Stanke and Morgenstern 2005) and FGENESH (Softberry
Mount Kisco, NY, USA, http:// www.softberry.com). Local ...
Journal of Industrial Microbiology & Biotechnology
Volume 38, Issue 9 , pp 1211-1218 DOI: 10.1007/s10295-010-0899-y
a-Amylase activity during pullulan production and ?-amylase gene analyses of Aureobasidium pullulans
Manitchotpisit et al.,
1. Biological Sciences Program, Faculty of Science, Chulalongkorn University, Bangkok, 10330, Thailand
2. Plant Biomass Utilization Research Unit, Department of Botany, Faculty of Science, Chulalongkorn University, Bangkok, 10330, Thailand
... CA). The mRNA sequence, amino acid sequence, initial start codon, stop codon,
and number of exons were predicted by the hidden Markov model plus protein-based
gene prediction FGENESH ? (Softberry, Inc.). Calculations ...
Tropical Plant Biology
Volume 4, Issue 3-4 , pp 217-227 DOI: 10.1007/s12042-011-9083-4
Molecular and Cytological Characterization of Centromeric Retrotransposons in a Wild Relative of Rice, Oryza granulata
Dongying Gao, Zhiyun Gong, Rod A. Wing, Jiming Jiang, Scott A. Jackson
1. Center for Applied Genetic Technologies and Institute for Plant Breeding Genetics and Genomics, University of Georgia, 111 Riverbend Rd., Athens, GA, 30602, USA
2. Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA
... In order to generate the phylogenetic tree with the conserved RT domains of LTR retrotransposons,
the internal sequences from OGRetro9 and other 30 retroelements were annotated with FGENESH
(http://linux1.softberry.com/berry.phtml) and GENEMARK (http://exon.gatech ...
BMC Evolutionary Biology
2011, 11:263 doi:10.1186/1471-2148-11-263
Evolutionary view of acyl-CoA diacylglycerol acyltransferase (DGAT), a key enzyme in neutral lipid biosynthesis
Turchetto-Zolet et al.,
1 Programa de Pos-Graduacao em Genetica e Biologia Molecular, Departamento de Genetica, Universidade Federal do Rio Grande do Sul, Brazil
2 Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Brazil
... The structural organization of the DGAT genes was determined after alignment of genomic DNA
and cDNA and EST sequences. Genomic sequences were also analyzed in the FGENESH gene
structure prediction program http://www.softberry.com/ webcite[58]. ...
BMC Plant Biology
2011, 11:26 doi:10.1186/1471-2229-11-26
Identification of potential target genes for the tomato fruit-ripening regulator RIN by chromatin immunoprecipitation
Masaki Fujisawa, Toshitsugu Nakano and Yasuhiro Ito
National Food Research Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan
... Gene structures were predicted using the sim4 [60] and the FGENESH 2.6 [61] programs with a parameter for the tomato genome (available at the Softberry site: http://linux1.softberry.com/berry.phtml ...
Journal of Genetics and Genomics
Volume 38, Issue 7, 20 July 2011, Pages 315–325 DOI: 10.1016/j.jgg.2011.06.003
Use of methylation filtration and C0t fractionation for analysis of genome composition and comparative genomics in bread wheat
Bandopadhyay et al.,
a Department of Genetics & Plant Breeding, Ch. Charan Singh University, Meerut 250004, India
b Department of Biotechnology, Birla Institute of Technology, Mesra 835215, Ranchi, India
... Gene prediction was achieved using FGenesH (http://softberry.com/berry.phtml). 2.9.
Fluorescence in situ hybridization (FISH). Four RD clones containing SSRs were used as
probes, which were labeled with digoxigenin-11-dUTP by nick translation. ...
Theoretical and Applied Genetics
Volume 123, Issue 6 , pp 973-983 DOI: 10.1007/s00122-011-1640-6
Fine genetic mapping of cp: a recessive gene for compact (dwarf) plant architecture in cucumber, Cucumis sativus L.
Li et al.,
1. Horticulture College, Northwest Agriculture & Forestry University, Yangling, 712100, China
2. Horticulture Department, University of Wisconsin, Madison, WI, 53706, USA
... Gene annotation was performed with the computer program FGENESH (http://sunl.softberry.com/)
and function prediction was conducted with BLASTx at the NCBI (National Center for
Biotechnology Information) website (http://blast.ncbi.nlm.nih.gov). Molecular marker analysis ...
Theoretical and Applied Genetics
Volume 122, Issue 4 , pp 795-803 DOI: 10.1007/s00122-010-1487-2
Fine genetic mapping localizes cucumber scab resistance gene Ccu into an R gene cluster
Kang et al.,
1. Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, 100081, Beijing, China
3. Key Laboratory of Horticultural Crops Genetic Improvement, Ministry of Agriculture, 100081, Beijing, China
... Gene prediction was performed with the computer program BGF (http://bgf.genomics.org.cn) and
verified by FGENESH (http://sunl.softberry.com/) (Salamov and Solovyev 2000), GENESCAN
(http://genes.mit.edu/GENSCAN.html) (Burge and Karlin 1997), TwinScan (http://mblab ...
BMC Genomics
2011, 12:609 doi:10.1186/1471-2164-12-609
Structural characterization of helitrons and their stepwise capturing of gene fragments in the maize genome
Dong et al.,
State Key Laboratory of Agrobiotechnology and National Maize Improvement Center, Department of Plant Genetics and Breeding, China Agricultural University, Beijing, 100193, China
... Then the obtained sequences were extended 10 kb each in the 5'-terminus and
3'-terminus respectively. Finally, the obtained putative autonomous helitrons were
annotated by Fgenesh (http://linux1.softberry.com/berry.phtml webcite). ...
Agricultural Sciences in China
Volume 10, Issue 4, April 2011, Pages 481–489 DOI: 10.1016/S1671-2927(11)60028-X
Characterization of Zm26Sub5 and Its Potential Roles in Regulating Pollen Fertility of S-CMS in Maize
Zheng-feng ZHANG a, b, Yong-lian ZHENG b
a College of Life Science, Huazhong Normal University, Wuhan 430079, P.R. China
b National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China
... embl-heidelberg.de/Alignment/). Gene prediction for the Zm26Sub5 DNA sequence
was carried out, analyzing introns, exons, and poly(A), with the FGENESH 2.6 program
(http://www.softberry.com/all/ htm). The protein encoded ...
The Plant Journal
2011, 65: 230–243. doi: 10.1111/j.1365-313X.2010.04414.x
Identification of legume RopGEF gene families and characterization of a Medicago truncatula RopGEF mediating polar growth of root hairs.
Riely et al.,
1 Department of Plant Pathology, University of California, One Shields Avenue, Davis, CA 95616, USA
2 Beijing Forestry University, Beijing, China
...Bacterial artificial chromosomes identified as containing possible RopGEFs were analyzed using softberry fgenesh gene prediction tools to identify possible open reading frames in MtRopGEFs (http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ...
Molecular and Cellular Biochemistry
Volume 357, Issue 1-2 , pp 263-274 DOI: 10.1007/s11010-011-0897-z
Alternative promoter usage and differential expression of multiple transcripts of mouse Prkar1a gene
Abdul Rouf Banday, Shafquat Azim, Mohammad Tabish
1. Department of Biochemistry, Faculty of Life Sciences, A.M. University, Aligarh, Uttar Pradesh, 202002, India
... mit.edu/GENSCAN.html), GeneSplicer (http://cbcb.umd. edu/software/GeneSplicer/),
FGENESH (http://www.soft berry.com/berry.phtml). Alignment analysis was carried
out using the Gene stream Align tool (http://www2.igh.cnrs. ...
Theoretical and Applied Genetics
Volume 122, Issue 7 , pp 1247-1264 DOI: 10.1007/s00122-011-1528-5
Molecular basis of seed lipoxygenase null traits in soybean line OX948
Reinprecht et al.,
1. Department of Plant Agriculture, University of Guelph, Guelph, ON, N1G 2W1, Canada
3. Agriculture and Agri-Food Canada, Greenhouse and Processing Crops Research Centre, Harrow, ON, N0R 1G0, Canada
... 2007) during the current study. The gene structure was also analyzed with the FGenesh 2.6
available at http://www. linux1.softberry.com (Salamov and Solovyev 2000). Translation of
nucleotide sequences was generated on ExPASy (http://www.expasy.ch/tools/dna.html). ...
Plant Biotechnology Reports
Volume 5, Issue 4 , pp 331-344 DOI: 10.1007/s11816-011-0187-y
Isolation of an Rx homolog from C. annuum and the evolution of Rx genes in the Solanaceae family
Shi et al.,
1. Department of Plant Science, Plant Genomics and Breeding Institute, College of Agriculture and Life Sciences, Seoul National University, Seoul, 151-921, Republic of Korea
2. Research Institute for Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul, 151-921, Republic of Korea
... GENESCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://linux1.softberry.com/
berry.phtml) were used for BAC sequence annotation of a Rx1-containing BAC from potato, a
CapRGC-containing BAC from pepper, and a LaRGC-containing BAC from tomato. ...
New Phytologist
2011, 192: 713–726. doi: 10.1111/j.1469-8137.2011.03824.x
Conservation and clade-specific diversification of pathogen-inducible tryptophan and indole glucosinolate metabolism in Arabidopsis thaliana relatives.
Bednarek et al.,
1 Max Planck Institute for Plant Breeding Research, Department of Plant Microbe Interactions, Carl-von-Linne-Weg 10, D-50829 Koln, Germany
2 Institute of Bioorganic Chemistry, Polish Academy of Sciences, Noskowskiego 12/14, 61-704 Poznan, Poland
... To predict the open reading frames (ORFs) from the genomic candidate regions, Fgenesh
(http://www.softberry.com) was used with parameters optimized for A. thaliana. The predicted
proteins were aligned using ClustalW and visualized using Jalview (Waterhouse et al., 2009). ...
PLoS Genet
7(4): e1002029. doi:10.1371/journal.pgen.1002029
The Phylogenetic Origin of oskar Coincided with the Origin of Maternally Provisioned Germ Plasm and Pole Cells at the Base of the Holometabola.
Lynch et al.,
Affiliation: Institute for Developmental Biology, University of Cologne, Cologne, Germany
Department of Biology, McGill University, Montreal, Canada
...The genomic region surrounding the region showing homology to Osk was used as input into FgenesH using the Apis model at http://linux1.softberry.com/ to predict an Osk sequence, ...
Mobile DNA
2011, 2:12 http://www.mobilednajournal.com/content/2/1/12
Crypton transposons: identification of new diverse families and ancient domestication events
Kenji K Kojima and Jerzy Jurka
Genetic Information Research Institute, 1925 Landings Drive, Mountain View,
CA 94043, USA
...We predicted exon-intron boundaries
with the aid of SoftBerry FGENESH:
http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind...
Genetica
Volume 139, Issue 4 , pp 489-496 DOI: 10.1007/s10709-011-9569-x
Transfer of a chromosomal Maverick to endogenous bracovirus in a parasitoid wasp
Dupuy et al.,
1. Institut de Recherche sur la Biologie de l’Insecte, UMR CNRS 6035, Universite F. Rabelais, UFR Sciences et Techniques, Parc Grandmont, 37200, Tours, France
... The hit was considered significant when the e-value was lower than 10-4. Open reading frames
(ORFs) were identified using FGENESH (http://linux1.softberry.com) and putative ORFs were
confirmed and adjusted if necessary through alignments with T. castaneum Maverick ...
Nature
478, 119–122 (06 October 2011) doi:10.1038/nature10431
Control of flowering and storage organ formation in potato by FLOWERING LOCUS T
Navarro et al.,
Departamento de Genetica Molecular de Plantas, Centro Nacional de Biotecnologia-CSIC. Calle Darwin 3, 28049 Madrid, Spain
Laboratory of Plant Molecular Genetics, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma 630-0101, Japan
... The best genome matches (Supplementary Table 2)were downloaded and open reading frames were predicted using FGENESH (http://linux1.softberry.com/berry.phtml) and ORF Finder ...
BMC Evolutionary Biology
2011, 11:219 doi:10.1186/1471-2148-11-219
A survey of green plant tRNA 3'-end processing enzyme tRNase Zs, homologs of the candidate prostate cancer susceptibility protein ELAC2
Fan et al.,
1 Laboratory of Yeast Genetics and Molecular Biology, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China
2 Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China
...The splicing pattern was verified using the FGENESH and FGENESH_GC programs provided at the Softberry website...
PLoS ONE
(2011) 6(8): e22046. doi:10.1371/journal.pone.0022046
Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs.
Zhang et al.,
Department of Biology, University of Padua, Padova, Italy, Abteilung fur Botanische Genetik und Molekularbiologie, Botanisches Institut und Botanischer Garten, Christian-Albrechts-Universitat zu Kiel, Kiel, Germany
...To ensure correct gene structures of all putative GPCR genes, we predicted gene structures using
GENSCAN [97], [98] and predictions were repeated using GENOMESCAN [97], [98], GENEWISE [99] and
FGENESH/FGENESH+ [31]. Intron-exon structures were determined with the aid of GENEWISE [99]
and/or PROT_MAP module of the Softberry software suite (website: www.softberry.org). ...
MPMI
Vol. 24, No. 1, 2011, pp. 79–90. doi:10.1094/ MPMI -06-10-0131
TaDAD2, a Negative Regulator of Programmed Cell Death,
Is Important for the Interaction
Between Wheat and the Stripe Rust Fungus
Wang et al.,
1
College of Plant Protection and Shaanxi Key Laboratory of Molecular Biology for Agriculture, Northwest A&F University,
Yangling, Shaanxi, 712100, P. R. China; 2
College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100,
P. R. China;
...The HsDAD (Homo sapiens) was employed as the outgroup control for the construction of phylogenetic trees. Gene structure was predicted
by FGENESH....
PLoS Genet
(2011), 7(8): e1002230. doi:10.1371/journal.pgen.1002230
Genomic Analysis of the Necrotrophic Fungal Pathogens Sclerotinia sclerotiorum and Botrytis cinerea.
Amselem et al.,
Unite de Recherche Genomique – Info, UR1164, INRA, Versailles, France, Biologie et Gestion des Risques en Agriculture – Champignons Pathogenes des Plantes, UR1290, INRA, Grignon, France
Broad Institute of MIT and Harvard, Cambridge, Massachusetts, United States of America
...For S. sclerotiorum and B. cinerea B05.10, gene structures were predicted using a combination of FGENESH and GENEID....
Molecular Ecology
(2011), 20: 2603–2618. doi: 10.1111/j.1365-294X.2011.05119.x
Characterization of a genomic divergence island between black-and-yellow and gopher Sebastes rockfishes.
BUONACCORSI et al.,
1 Juniata College, 1700 Moore St. Huntingdon, PA 16652, USA
2 Columbia River Inter-Tribal Fish Commission, 3059-F National Fish Hatchery Road, Hagerman, ID 83332, USA
... The sequenced region was manually annotated using ab initio gene predictions from
Genscan (Burge & Karlin 1997) and FgenesH (SoftBerry; Fish gene model). Microsatellites
were identified using Tandem Repeat Finder (Benson 1999). ...
Nature Biotechnology
29, 922–927 (2011) doi:10.1038/nbt.1976
Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris.
Berka et al.,
Novozymes, Inc., Davis, California, USA.
US Department of Energy Joint Genome Institute, Walnut Creek, California, USA.
Centre for Structural and Functional Genomics, Concordia University, Montreal, Quebec, Canada.
... was performed using ab initio Fgenesh 32 and Genemark-ES 33 ; homology-based Fgenesh+ 32 and
Genewise 34 seeded by BLASTx alignments of NCBI's nr (nonredundant) protein database against the assembly;
cDNA-based EST_map (http://www.softberry.com/) seeded ...
Plant Physiology
October 2011 vol. 157 no. 2 937-946 DOI: 10.1104/pp.111.174912
Evolution of the S-Locus Region in Arabidopsis Relatives
Ya-Long Guo 2*, Xuan Zhao 2, Christa Lanz and Detlef Weigel
Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tuebingen, Germany
... Annotation of the BAC sequences was performed using FGENESH (http://linux1.
softberry.com/berry.phtml). The annotation was confirmed by ...
Nature Communications
2, Article number: 202 doi:10.1038/ncomms1189
Effector diversification within compartments of the Leptosphaeria maculans genome affected by Repeat-Induced Point mutations
Rouxel et al.,
INRA-Bioger, UR1290, Avenue Lucien Bretignieres, BP 01, Thiverval-Grignon F-78850, France.
Murdoch University, South Street, Murdoch, Western Australia 6150, Australia.
...The EuGene prediction pipeline v. 3.5a (ref. 48), which integrates ab initio (Eugene_IMM, SpliceMachine and Fgenesh 2.6 (www.softberry.com)) and similarity methods (BLASTn, GenomeThreader, BLASTx), was used to predict gene models. ...
Nature Genetics
43, 228–235 (2011) doi:10.1038/ng.769
The draft genome of the parasitic nematode Trichinella spiralis
Mitreva et al.,
The Genome Center, Washington University School of Medicine, St. Louis, Missouri, USA.
Department of Genetics, Washington University School of Medicine, St. Louis, Missouri, USA.
...Protein-coding genes were predicted using a combination of ab initio programs47 and FgenesH (Softberry, Corp) and the evidence-based program EAnnot48. ...
Theoretical and Applied Genetics
Volume 122, Issue 3 , pp 459-470 DOI: 10.1007/s00122-010-1460-0
Characterization and genetic analysis of a low-temperature-sensitive mutant, sy-2, in Capsicum chinense
An et al.,
1. Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute for Agriculture and Life Sciences, Seoul National University, 599 Gwanak-ro Gwank-gu, Seoul, 151-921, Korea
2. Key Laboratory of Crop Genomics and Genetic Improvement of Ministry of Agriculture, Beijing Key Lab of Crop Genetic Improvement, China Agriculture University, Beijing, 100094, China
... C2_At1g09070. In the sequence, 51 genes were predicted by gene prediction
FGENESH (http://linux1.softberry. com) and blastx (http://blast.ncbi.nlm.nih.gov). There
were several candidate genes including five lipoxygenase genes, ...
The Plant Journal
(2011), 65: 745–756. doi: 10.1111/j.1365-313X.2010.04461.x
Cross-genome map based dissection of a nitrogen use efficiency ortho-metaQTL in bread wheat unravels concerted cereal genome evolution.
Quraishi et al.,
1 INRA/Universite Blaise Pascal UMR 1095 GDEC, Domaine de Crouelle, 234 Avenue du Brezet, 63100 Clermont-Ferrand, France
2 BIOGEMMA, 8 Rue des Freres Lumiere, 63028 Clermont-Ferrand Cedex 2, France
... nih.gov/) and SwissProt databases (http://expasy.org/sprot/), with the results of two gene predictor
programs, Eugene (Matheet al., 2002) with the rice (Oryza sativa) training version and FgeneSH
(Salamov and Solovyev, 2000) with default parameters (http://sun1.softberry.com/). ...
Plant Physiology October
2011 vol. 157 no. 2 757-769 DOI: 10.1104/pp.111.181990
Genome-Wide Comparison of Nucleotide-Binding Site-Leucine-Rich Repeat-Encoding Genes in Arabidopsis
Guo et al.,
Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tuebingen, Germany
... Gordon et al., 1998). Primer walking and PCR were used to fill or polish gaps and
ambiguous regions. Annotation was performed using FGENESH and FGENESH+
(http://linux1.softberry.com/berry.phtml). Spidey (http://www.ncbi ...
BMC Genomics
2011, 12:142 doi:10.1186/1471-2164-12-142
Exceptional lability of a genomic complex in rice and its close relatives revealed by interspecific and intraspecific comparison and population analysis
Tian et al.,
1 Department of Agronomy, Purdue University, West Lafayette, IN 47907, USA
2 Arizona Genomics Institute, The University of Arizona, Tucson, AZ 85721, USA
... Putative gene models were predicted using the FGENESH program with the monocot training
set (http://www.softberry.com webcite), and were further investigated to determine whether they
are actually genes following described previously criteria [6]. Truncated gene fragments ...
The Plant Journal
(2011), 68: 777–787. doi: 10.1111/j.1365-313X.2011.04728.x
Rice 14-3-3 protein (GF14e) negatively affects cell death and disease resistance.
Manosalva, P. M., Bruce, M. and Leach, J. E.
Boyce Thompson Institute for Plant Research, Ithaca, NY 14853, USA.
... Throughput Genomic Sequences (HTGS) database. The fgenesh program
(http://www.softberry.com/berry.phtml) was used to predict 14-3-3 gene members
from significant rice BAC hits. All sequences corresponding to various ...
Genomics
Volume 97, Issue 5, May 2011, Pages 313–320 DOI: 10.1016/j.ygeno.2011.02.007
Comparative analysis of Gossypium and Vitis genomes indicates genome duplication specific to the Gossypium lineage
Lin et al.,
a Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30605, USA
b Center for Genomics and Biocomputing, College of Sciences, Hebei Polytechnic University, Tangshan, Hebei, 063000, China
...Genes were identified from BAC sequences using FGENESH (http://linux1.softberry.com/berry.phtml). ...
BMC Evolutionary Biology
2011, 11:78 doi:10.1186/1471-2148-11-78
Evolution of Parallel Spindles Like genes in plants and highlight of unique domain architecture
Cigliano et al.,
1 CNR - National Research Council of Italy, Institute of Plant Genetics, Research Division Portici, Via Universita 133, 80055 Portici. Italy
2 DISSPAPA, Dept. of Soil, Plant and Environmental Sciences, University of Naples "Federico II", Via Universita 100, 80055 Portici. Italy
... Germany). PSL1 gene structure and cDNA predictions were carried out using FGENESH
online tool (http:/ / linux1.softberry.com/ berry.phtml?topic=fgenesh&group=pro
grams&subgroup=gfind webcite) selecting Tomato as organism. ...
BMC Research Notes
2011, 4:518 doi:10.1186/1756-0500-4-518
Identification of superior reference genes for data normalisation of expression studies via quantitative PCR in hybrid roses (Rosa hybrida)
Maik Klie and Thomas Debener
Department of Molecular Plant Breeding, Institute for Plant Genetics, Leibniz Universitat Hannover, Herrenhauser Str. 2, 30419 Hannover, Germany
...Open reading frames and 5'and 3' UTR regions were predicted using the
FGENESH algorithm [34] with specifications for dicot plants....
Aging Cell
(2011), 10: 896–907. doi: 10.1111/j.1474-9726.2011.00727.x
Alternative splicing factor or splicing factor-2 plays a key role in intron retention of the endoglin gene during endothelial senescence.
Blanco, F. J. and Bernabeu, C.
Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), and Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), c/Ramiro de Maeztu 9, 28040 Madrid, Spain
... Genome Bioinformatics (http://genome.ucsc.edu/). Then, the FSPLICE and FGENESH
tools were used to predict exons and introns in the DNA sequences (http://linux1.
softberry.com/berry.phtml). The Transeq tool at the European ...
PLoS Pathog
(2011), 7(7): e1002137. doi:10.1371/journal.ppat.1002137
Comparative Genomics Yields Insights into Niche Adaptation of Plant Vascular Wilt Pathogens.
Klosterman et al.,
USDA-ARS, Salinas, California, United States of America
University of California, Davis, California, United States of America
...Protein-encoding genes were annotated using a combination of manually curated genes, in addition to EST BLAST alignments, and ab initio gene predictions
made by FGENESH, FGENESH+ (http://linux1.softberry.com), and ...
PLoS Negl Trop Dis
(2011), 5(10): e1340. doi:10.1371/journal.pntd.0001340
Characterisation of the Trichinella spiralis Deubiquitinating Enzyme, TsUCH37, an Evolutionarily Conserved Proteasome Interaction Partner.
White et al.,
Division of Cell and Molecular Biology, Department of Life Sciences, Imperial College London, London, United Kingdom
Whitehead Institute for Biomedical Research, Cambridge, Massachusetts, United States of America
...Contig 1.2 was analysed by 4 different gene prediction programmes: AUGUSTUS [24], GenemarkHMM [31], SNAP [32]
and Fgenesh [33]. ...
The Plant Cell May
2011 vol. 23 no. 5 1861-1875 DOI: 10.?1105/?tpc.?111.?085456
A Small Zinc Finger Thylakoid Protein Plays a Role in Maintenance of Photosystem II in Arabidopsis thaliana
Yan Lu a, 1, David A. Hall a and Robert L. Last a,b,2
aDepartment of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824
bDepartment of Plant Biology, Michigan State University, East Lansing, Michigan 48824
...Complete genomic sequence (including 500 bp upstream and downstream of the original partial sequence) was used to predict new gene structures with the
FGENESH program (a Hidden Markov Model-based gene prediction program; http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind)....
PLoS ONE
(2011), 6(3): e17505. doi:10.1371/journal.pone.0017505
Elucidation of Functional Markers from Aspergillus nidulans Developmental Regulator FlbB and Their Phylogenetic Distribution.
Cortese MS, Etxebeste O, Garzia A, Espeso EA, Ugalde U
Department of Applied Chemistry, Faculty of Chemistry, University of the Basque Country, San Sebastian, Spain, IKERBASQUE, Basque Foundation for Science, Bilbao, Spain
Department of Cellular and Molecular Medicine, Centro de Investigaciones Biologicas (CSIC), Madrid, Spain
...and Fgenesh (Softberry) [71] were considered along with manual verification of splice sites....
Genome Biology
2011, 12:R48 doi:10.1186/gb-2011-12-5-r48
A physical map for the Amborella trichopoda genome sheds light on the evolution of angiosperm genome structure
Zuccolo et al.,
1 Arizona Genomics Institute, School of Plant Sciences and BIO5 Institute for Collaborative Research, University of Arizona, 1657 East Helen Street, Tucson, AZ 85721, USA
2 Department of Plant Biology, University of Georgia, 4504 Miller Plant Sciences, Athens, GA 30602, USA
...FGENESH [63] annotations for the Amborella contigs were included on the horizontal axes of the dot plots. ...
Plant Physiology
October 2011 vol. 157 no. 2 770-789 DOI: 10.?1104/?pp.?111.?179648
The Tomato Terpene Synthase Gene Family
Falara et al.,
Department of Molecular, Cellular, and Developmental Biology, University of Michigan, Ann Arbor, Michigan 48109–1048 (V.F., T.A.A., T.T.H.N., I.S., Y.M., M.E.B., E.P.); Department of Plant Physiology, Swammerdam Institute of Life Sciences, 1098 XH Amsterdam, The Netherlands (E.A.S., P.M.B., R.C.S.)
...he FGENESH gene prediction tool (www.softberry.com) was used for initial annotation of the predicted tomato TPS genes....
PLoS Pathog
(2011), 7(11): e1002348. doi:10.1371/journal.ppat.1002348
Multiple Candidate Effectors from the Oomycete Pathogen Hyaloperonospora arabidopsidis Suppress Host Plant Immunity. PLoS Pathog 7(11): e1002348. doi:10.1371/journal.ppat.1002348
Fabro et al.,
The Sainsbury Laboratory, John Innes Centre, Norwich, United Kingdom
School of Life Sciences, Warwick University, Wellesbourne, United Kingdom
...ORFs from ATG to Stop codon were identified using FgenesH (www.softberry.com) and ...
BMC Plant Biology
2011, 11:20 doi:10.1186/1471-2229-11-20
ZINC-INDUCED FACILITATOR-LIKE family in plants: lineage-specific expansion in monocotyledons and conserved genomic and expression features among rice (Oryza sativa) paralogs
Ricachenevsky et al.,
1 Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, P.O.Box 15005, Porto Alegre, 91501-970, Brazil
2 Departamento de Botanica, Instituto de Biociencias, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9500, Porto Alegre, 91501-970, Brazil
...Two unnanotated ZIFL genes from Zea mays were predicted using Fgenesh (http://www.softberry.com ...
FGENESH 2010
Cytogenet Genome Res
2011;132:55-63 (DOI: 10.1159/000319491)
Sequence of a Turkey BAC Clone Identifies MHC Class III Orthologs and Supports Ancient Origins of Immunological Gene Clusters
L.D. Chaves a, b, S.B. Krueth a, M.M. Bauer a, K.M. Reed a
aDepartment of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, Minn., and
bNational Jewish Health, Division of Allergy and Clinical Immunology, Department of Medicine, Denver, Colo., USA
... Sequences were analyzed with the basic local alignment search tool (BLAST), GENESCAN
(http://genes.mit.edu/GENSCAN.html) and Softberry FGENESH (http://linux1.softberry.com/
all.htm) to identify putative transcripts and homologies to known genes. ...
Gene
Volume 452, Issue 2, 1 March 2010, Pages 45-53, doi:10.1016/j.gene.2009.11.001
Comparative genomics identifies new alpha class genes within the avian glutathione S-transferase gene cluster
Ji Eun Kim a, Miranda M. Bauer b, Kristelle M. Mendoza b, Kent M. Reed b and Roger A. Coulombe Jr. a,
a Department of Veterinary Sciences and Graduate Toxicology Program, Utah State University, Logan, UT 84322, USA
b Department of Veterinary and Biomedical Sciences, University of Minnesota, St. Paul, MN 55108, USA
.. 2.4. Gene identification and annotation. The assembled sequence was analyzed with Softberry
FGENESH (http://linux1.softberry.com/all.htm) and the basic local alignment search tool (BLAST)
to identify putative transcripts and homologies to known genes. ...
Gene
Volume 468, Issues 1-2, 15 November 2010, Pages 41-47 doi:10.1016/j.gene.2010.08.003
Two conserved Z9-octadecanoic acid desaturases in the red flour beetle, Tribolium castaneum
Irene Horne a, Nerida Gibb a, Katherine Damcevski a, Karen Glovera and Victoria S. Haritos a
a CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia
... were obtained. Each of the contigs was then subjected to a gene prediction program
in Softberry (http://www.softberry.com/cgi- bin/programs/gfin/fgenesh) using
parameters for Brugia malaya and Caenorhabditis elegans. 2.2 ...
Journal of Invertebrate Pathology
Volume 105, Issue 2, October 2010, Pages 156-163 doi:10.1016/j.jip.2010.06.003
Transient transcription of a putative RNase containing BEN domain encoded in Cotesia plutellae bracovirus induces an immunosuppression of the diamondback moth, Plutella xylostella
Bokri Park and Yonggyun Kim
Department of Bioresource Sciences, Andong National University, Andong 760-749, Republic of Korea
... 17 18 2.2. Gene prediction using bioinformatic tools 19 20 Open reading frame (ORF) was
predicted from a viral genome segment using 21 FGENESH program (Softberry, Inc., Mount Kisco,
NY, USA) by access to 22 http://linux1.softberry.com/berry.phtml?topic=index&group ...
Genome
Volume 53, Number 1, 1 January 2010 , pp. 55-67(13)
Microsatellites in Brassica unigenes: relative abundance, marker design, and use in comparative physical mapping and genome analysis
Parida, Swarup K.; Yadava, Devendra K.; Mohapatra, Trilochan
... Also, unigenes were checked using software tools such as FGENESH (Softberry,
Inc., Mount Kisco, New York; www. softberry.com),
ORF Finder (Stothard 2000; http://
bioinformatics.org/sms/orf_find.html), and UTRScan (http ...
Bioinformatics
2010, 26 (12): 1488-1492. doi: 10.1093/bioinformatics/btq167
Ergatis: a web interface and scalable software system for bioinformatics workflows
Orvis et al.,
1 Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, MD, 2 J. Craig Venter Institute, Rockville, MD, USA
... Ergatis contains components for over a dozen different gene prediction programs, such as
GeneWise (Birney et al., 2004), GeneMark (Besemer and Borodovsky, 2005) and FGENESH
(SoftBerry), as well as RNA prediction. ... SoftBerry. "Gene finding in Eukaryota.". ...
Mol Biol Evol
2010, 27 (11): 2487-2506. doi: 10.1093/molbev/msq133
Orthologous Comparisons of the Hd1 Region across Genera Reveal Hd1 Gene Lability within Diploid Oryza Species and Disruptions to Microsynteny in Sorghum
Sanyal et al.,
1Department of Agronomy, Purdue University
2Department of Plant Sciences, BIO5 Institute, Arizona Genomics Institute, University of Arizona, Tucson
... The sequences were then annotated for genes using a combination of ab initio prediction
programs FGENESH (www.softberry.com, Salamov and Solovyev 2000) and Page 8. 8 ...
(www.softberry.com, Salamov and Solovyev 2000) and with previous annotation. We ...
Nucl. Acids Res
2010 doi: 10.1093/nar/gkq1016
FGDB: revisiting the genome annotation of the plant pathogen Fusarium graminearum
Wong et al.,
1Helmholtz Zentrum Munchen, German Research Center for Environmental Health, Institute of Bioinformatics and Systems Biology, Ingolstadter Landstrasse 1, D-85764 Neuherberg, 2Max-Planck-Institute for Terrestrial Microbiology, Department of Organismic Interactions, D-35043 Marburg,
... Based on this set, all gene loci in FGDB v3.1 were re-annotated using a pipeline including (i)
Fgenesh with different matrices (www.softberry.com); (ii) GeneMark-ES (8); (iii) Augustus with
ESTs, precedingly annotated Fusarium models and/or Neurospora crassa protein ...
PLoS ONE
5(3): e9620. doi:10.1371/journal.pone.0009620
Morphological and Genomic Characterization of Filobasidiella depauperata: A Homothallic Sibling Species of the Pathogenic Cryptococcus Species Complex
Marianela Rodriguez-Carres, Keisha Findley, Sheng Sun, Fred S. Dietrich, Joseph Heitman
Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, United States of America
... Assembled sequences were subsequently annotated employing the gene predictor software
FGENESH from SoftBerry© and using as reference current gene predictions in C. neoformans
(http://linux1.softberry.com/berry.phtml??topic=fgenesh&group=programs&subgroup=gf ...
Mol Biol Rep.
2010 Feb;37(2):801-8. Epub 2009 Jul 4
Molecular cloning and characterization of five genes encoding pentatricopeptide repeat proteins from Upland cotton (Gossypium hirsutum L.)
Yang L, Zhu H, Guo W, Zhang T
National Key Laboratory of Crop Genetics and Germplasm Enhancement, Cotton Research Institute, Nanjing Agricultural University, 210095, Nanjing, Jiangsu, China.
... The remaining non- redundant sequences were assembled by CAP3 assembly tool [24] with
default parameter. Potential genes of BAC sequences originated from the G. hirsutum database
were predicted by a program: FGENESH (http://www.softberry. ...
J Mol Evol.
2010 Jan 1. [Epub ahead of print]
Strong Positive Selection Drives Rapid Diversification of R-Genes in Arabidopsis Relatives
Chen Q, Han Z, Jiang H, Tian D, Yang S.
State Key Laboratory of Pharmaceutical Biotechnology, Department of Biology, School of Life Sciences, Nanjing University, Nanjing, 210093, China.
... the gene-finding programs FGENESH (http://www. softberry.com/) and GENSCAN
(http://genes.mit.edu/ genescan.html/) to obtain information on complete open reading
frames. To exclude potentially redundant candidate NBS ...
Eukaryotic Cell
January 2010, p. 164-172, Vol. 9, No. 1 doi:10.1128/EC.00194-09
Evolutionary Dynamics of Mating-Type Loci of Mycosphaerella spp. Occurring on Banana
Mahdi Arzanlou, 1,2,3 Pedro W. Crous, 1,2 and Lute-Harm Zwiers 1
Evolutionary Phytopathology, CBS-KNAW Fungal Biodiversity Center, Utrecht 3508 AD, The Netherlands,1 Wageningen University and Research Center (WUR), Laboratory of Phytopathology, Wageningen 6708 PB, The Netherlands,2
... reading frames (ORFs) and intron positions were predicted by comparing the sequence data
with known MAT sequences from other filamentous fungi, as well as by means of the FGENESH
gene prediction module from the MOLQUEST software package (Softberry, Inc., Mount ...
Plant Molecular Biology Reporter
Volume 28, Number 1, March 2010 , pp. 152-161(10) DOI: 10.1007/s11105-009-0134-z
Identification of NBS-Type Resistance Gene Homologs in Tobacco Genome
Xiaodong et al.,
1: Institute of Crop Science, Zhejiang University, Hangzhou, 310029, China 2: Joint Laboratory of Tobacco Bioinformatics, Yunnan Institute of Tobacco Science, Yuxi, 653100, China,
... 2006) for sequence cleaning and assembly. FGENESH was used to perform gene prediction
(http://www.softberry.com) (Salamov and Solovyev 2000). HMMER (Eddy 1998) was used to
search protein sequences Plant Mol Biol Rep (2010) 28:152–161 153 Page 3. ...
J. Agric. Food Chem.
2010, 58 (5), pp 3184–3190
DOI: 10.1021/jf904367r
An Acidophilic and Acid-Stable b-Mannanase from Phialophora sp. P13 with High Mannan Hydrolysis Activity under Simulated Gastric Conditions
Zhao et al.,
Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P. R. China
... sequence. Sequence Analysis The exon-intron structure of the full-length mannanase
gene was predicted using GENESCAN (http://genes.mit.edu/GENSCAN.html) and
FGENESH (http://www.softberry.com/berry.phtml/). The ...
New Phytologist
Special Issue: Plant polyploidy
Volume 186, Issue 1, pages 228–238, April 2010 DOI: 10.1111/j.1469-8137.2009.03164.x
Tandem duplication of the FLC locus and the origin of a new gene in Arabidopsis related species and their functional implications in allopolyploids
Nah, G. and Jeffrey Chen, Z.
1. Section of Molecular Cell and Developmental Biology
2. Institute for Cellular and Molecular Biology
3. Section of Integrative Biology
4. Center for Computational Biology and Bioinformatics, The University of Texas at Austin, Austin, TX 78712, USA
... Sonnhammer & Durbin, 1995). The genomic sequences were annotated using fgenesh
(http://www.softberry.com), a gene prediction software program for A. thaliana genome
annotation (Swarbreck et al., 2008). The predicted genes ...
Funct Integr Genomics.
2010 May;10(2):241-51. Epub 2009 Dec 12
Recruitment of closely linked genes for divergent functions: the seed storage protein (Glu-3) and powdery mildew (Pm3) genes in wheat (Triticum aestivum L.)
Wang ZN, Huang XQ, Cloutier S.
Cereal Research Centre, Agriculture and Agri-Food Canada, 195 Dafoe Road, Winnipeg, MB, Canada, R3T 2M9.
... ricegaas.dna.affrc. go.jp/) using the gene prediction algorithm of FGENESH Funct
Integr Genomics Page 3. (http://www.softberry.com/) and GENESCAN (http://gene
mark.mit.edu/GENESCAN.htm). The predicted gene sequences ...
Journal of Basic Microbiology
Volume 50, Issue 1, pages 59–71, February 2010 DOI: 10.1002/jobm.200900113
Adenylyl cyclase regulates heavy metal sensitivity, bikaverin production and plant tissue colonization in Fusarium proliferatum
Gabor Kohut 1,
Brigitta Olah 1,
Attila L. Adam 1,
Jorge Garcia-Martinez 2,
Laszlo Hornok Prof. 1
1. Agricultural Biotechnology Center, Mycology Group of the Hungarian Academy of Sciences, Institute of Plant Protection, Szent Istvan University, Godollo, Hungary
2. Department of Genetics, Faculty of Biology, University of Seville, Seville, Spain
... Biotechnology Centre (Godollo, Hungary). Se- quence data were analyzed with the
Lasergene software package (DNAStar Inc., Madison, Wisconsin, USA) and the
FGENESH program (http://www.softberry.com). Blast searches were ...
Theor Appl Genet.
2010 Apr;120(6):1099-106. Epub 2009 Dec 24
Fine mapping of pepper trichome locus 1 controlling trichome formation in Capsicum annuum L. CM334.
Kim et al.,
Department of Plant Sciences, Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, South Korea.
... 2003). Repeat sequences were filtered by RepeatMasker (http://www. repeatmasker.org)
and JDotter (http://athena.bioc.uvic.ca). The gene coding regions were predicted by
FGENESH (http://linux1.softberry.com) or GENESCAN (http://genes. ...
Eukaryotic Cell
January 2010, p. 46-58, Vol. 9, No. 1 doi:10.1128/EC.00259-09
Organization and Evolutionary Trajectory of the Mating Type (MAT) Locus in Dermatophyte and Dimorphic Fungal Pathogens
Wenjun Li, 1 Banu Metin, 1 Theodore C. White ,2 and Joseph Heitman 1
Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina,1 Seattle Biomedical Research Institute, Seattle, Washington2
... Putative genes in the MAT locus and flanking regions were predicted by using a combination
of primary annotation from the Broad Institute, GeneMark (37), BLAST (1), ORF Finder
(http://www.ncbi.nlm.nih.gov/projects/gorf/), and FGENESH (http://linux1.softberry.com/berry.phtml ...
Molecular Plant Pathology
2010, 11: 395–407. doi: 10.1111/j.1364-3703.2010.00612.x
The two-component histidine kinase Fhk1 controls stress adaptation and virulence of Fusarium oxysporum
RISPAIL, N. and DI PIETRO, A
Departamento de Genetica, Universidad de Cordoba, Campus de Rabanales Edificio Gregor Mendel C5, 14071 Cordoba, Spain
... ing the complete fhk1 gene, including the promoter, coding region and terminator, was sequenced
manually, revealing an open reading frame of 3882 bp interrupted by five putative introns,
according to the Fgenesh 2.6 prediction server (http:// linux1.softberry.com/berry.phtml ...
Funct Integr Genomics
2010 Mar;10(1):111-22. Epub 2009 Aug 2
Conserved globulin gene across eight grass genomes identify fundamental units of the loci encoding seed storage proteins
Gu YQ, Wanjugi H, Coleman-Derr D, Kong X, Anderson OD.
Western Regional Research Center, United States Department of Agricultural-Agricultural Research Service, Albany, CA 94710, USA. yong.gu@ars.usda.gov
... 2003) and wheat A genome (BAC AY494981 and DQ537335, Gu et al. 2004, 2006,
respectively). FGENESH (http://www.softberry.com/nucleo.html) and GEN- ESCAN
(http://genemark.mit.edu/GENESCAN.htm) were used for gene prediction. ...
Molecular Breeding
Volume 26, Number 2, August 2010 , pp. 275-292(18)
Genic markers for wild abortive (WA) cytoplasm based male sterility and its fertility restoration in rice
Ngangkham, Umakanta et al.,
1: National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India 2: Division of Genetics, Indian Agricultural Research Institute, New Delhi, 110012, India
... msu.edu/pseudomolecules) and indica cultivar 93–11 (Beijing Rice Information System,
http://rice.genomics. org.cn/rice) were downloaded and annotated using FGENESH
(http://sun1.softberry.com/berry.phtml) gene prediction software to identify protein encoding genes. ...
Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184-194 doi:10.1016/j.exppara.2010.07.012
Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases
ATiago M. Martins a, b, Virgilio E. do Rosario b and Ana Domingos a, b
Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal
b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal
... A threshold of E 1e-04 was adopted for 93 the tblastn search (Wu et al., 2003). The gene
structure of the identified CP genes with 94 multiple exons was predicted using the
FGENESH and FGENESH+ software 95 (http://www.softberry.com). ...
Mol Genet Genomics.
2010 May;283(5):427-38. Epub 2010 Mar 9
Unique evolutionary pattern of numbers of gramineous NBS-LRR genes
Li et al.,
State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, 210093, China.
... with Xanking regions of 5,000–10,000 bp on both sides, were annotated using the gene-finding
programs FGENESH with the monocot training set (http://www.soft- berry.com/) and GENSCAN
with the maize training set (http://genes.mit.edu/GENSCAN.html) to obtain informa ...
Mol Biol Evol
2010 doi: 10.1093/molbev/msq156
Tracing the evolution of the floral homeotic B- and C-function genes through genome synteny
Barry Causier *,1,
Rosa Castillo 2,4,
Yongbiao Xue 3,
Zsuzsanna Schwarz-Sommer 2 and
Brendan Davies 1
1 Centre for Plant Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom
2 Max-Planck-Institut fur Zuchtungsforschung, Carl-von-Linne-Weg 10, 50829 Koln, Germany
... Lukashin and Borodovsky 1998) (each using the Arabidopsis dataset, with default settings),
and FGENESH (www.softberry.com) (using both Arabidopsis and tobacco datasets, with
default settings). In most cases each algorithm predicted a similar ...
Veterinary Immunology and Immunopathology
Volume 137, Issues 1-2, 15 September 2010, Pages 176-180 doi:10.1016/j.vetimm.2010.04.018
Polymorphism of sheep MHC Class IIb gene TAPASIN
N. Siva Subramaniam a, E.F. Morgan a, C.Y. Lee a, J.D. Wetherall a and D.M. Groth a
Western Australian Biomedical Research Institute (WABRI) & Centre for Health Innovation Research Institute, School of Biomedical Sciences, Curtin University of Technology, Perth, Western Australia 6845, Australia
... A consensus genetic structure for sheep 108 TAPASIN was determined from analysis of the
predictions from GENSCAN (Burge & 109 Karlin 1997) Burge and Karlin, 1997), TWINSCAN
(Korf et al. 2001) and 110 FGENESH (http://www.softberry.com). ...
Theor Appl Genet.
2010 Feb;120(4):709-20. Epub 2009 Nov 3.
Nucleotide diversity and molecular evolution of the PSY1 gene in Zea mays compared to some other grass species
Fu et al.,
National Maize Improvement Center of China, Key Laboratory of Crop Genomics and Genetic Improvement, China Agricultural University, Yuanmingyuan West Road, Haidian, Beijing, China.
... Gene structure was predicted separately for each species using the soft- ware packages
FGENESH (http://linuxl.softberry.com) and NNPP (http://www.fruitfly.org). Alignments were per-
formed among all species with the ClustalX version 8.1 (Thompson et al. ...
The Journal of Immunology
May 1, 2010 vol. 184 no. 9 5038-5046 doi: 10.4049/?jimmunol.0903374
Intron-Containing Type I and Type III IFN Coexist in Amphibians: Refuting the Concept That a Retroposition Event Gave Rise to Type I IFNs
1. Zhitao Qi*†, Pin Nie*, Chris J. Secombes‡ and Jun Zou‡
*State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei;
†Chemical and Biological Engineering College, Yancheng Institute of Technology, Jiangsu, China
... ca.expasy.org/tools). Putative transcripts were predicted from the genome sequences
using the GenScan program (http://genes/mit.edu/GENSCAN.html) and the Fgenesh
program (www.softberry.com). Signal peptides were ...
Molecular Breeding
Volume 26, Number 2, August 2010 , pp. 325-338(14)
SNP haplotypes of the BADH1 gene and their association with aroma in rice (Oryza sativa L.)
Singh, Anuradha et al.,
1: Rice Genome Laboratory, National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India 2: Division of Genetics, Indian Agricultural Research Institute, New Delhi, 110012, India
... work well. The position of exons and introns were identified using gene prediction
software FGENESH (www.softberry.com) and verified manually by checking against
the full length cDNA sequence of the BADH1 gene. The ...
Theor Appl Genet.
2010 May;120(7):1443-50. Epub 2010 Jan 2010
Fine mapping of a resistance gene to bacterial leaf pustule in soybean
Kim DH, Kim KH, Van K, Kim MY, Lee SH
Department of Plant Science and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, 151-921, Korea
... Composite interval mapping (CIM) was performed by Qgene V. 4.2.2 (Joehanes and Nelson
2008) with scan interval 1. Gene annotation was conducted with gene prediction program
FGENESH (http:// www.softberry.ru) against Arabidopsis database. ...
Plant Science
Volume 179, Issue 4, October 2010, Pages 399-406 doi:10.1016/j.plantsci.2010.06.017
Disease resistance signature of the leucine-rich repeat receptor-like kinase genes in four plant species
Tang et al.,
a State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, 210093 Nanjing, China
b Department of Life Science, Lianyungang Teacher's College, 222006 Lianyungang, China
... Then the nucleotide sequences of candidate Ser/Thr/Tyr kinase genes, together with flanking
regions of 5,000-10,000 bp at both sides, were annotated using the gene-finding programs
FGENESH (http://www.softberry.com/) and GENSCAN (http://genes.mit.edu/genescan.html ...
Comparative Biochemistry and Physiology Part D: Genomics and Proteomics
Volume 5, Issue 2, June 2010, Pages 151-156 doi:10.1016/j.cbd.2010.03.006
Novel isoform of the Xenopus tropicalis PKA catalytic alpha subunit: An example of alternative splicing
Mohammad Tabish, Vladimir I. Rodionov
Center for Cell Analysis and Modeling, University of Connecticut Health Center, Farmington, Connecticut 06032, USA
... Gene/Exon finding tools were used at HMMgene (http://www.cbs.dtu.dk/services/HMMgene),
Genescan (http://genes.mit.edu/ GENSCAN.html), GeneSplicer (http://cbcb.umd.edu/
software/GeneSplicer/), FGENESH (http://www.softberry.com/berry.phtml). ...
Molecular breeding
2010, vol. 25, no2, pp. 187-201
Development and evaluation of broadly applicable markers for Restorer-of-fertility in pepper
Deuk et al.,
(1) Department of Plant Science, Plant Genomics and Breeding Institute, and Research Institute for Agriculture and Life Sciences, Seoul National University, 151-921, Seoul, Korea
(2) Breeding and Research Station, Monsanto Korea, 363-955, Chungwon, Korea
... search using petunia Rf gene sequence as query. FGENESH program
(www.softberry.com) was used to predict gene sequences from sequences of
selected BAC clones. Among predicted fifteen genes, sequence of the first ...
Plant Science
Volume 179, Issue 3, September 2010, Pages 257-266 doi:10.1016/j.plantsci.2010.05.012
Distribution and diversity of PIF-like transposable elements in the Bambusoideae subfamily
Ming-Bing Zhou a, Jiang-Jie Lu a, Hao Zhonga, Xiang-Min Liu a and Ding-Qin Tang a
a The Nurturing Station for the State Key Laboratory of Subtropical Silviculture, Zhejiang Agriculture and Forestry University, LinAn 311300, Zhejiang Province, PR China
.. The putative coding exons of these sequences, as well as those derived from our 114 PCR
experiments, were predicted using web software of Netgene2 115 (http://www.cbs.dtu.dk/services/
NetGene2/) and FGENESH 116 (http://sun1.softberry.com/berry.phtml?topic ...
Genome
Volume 53, Number 9, 1 September 2010 , pp. 658-666(9)
Comparative genomic analysis of the false killer whale (Pseudorca crassidens) LMBR1 locus
Dae-Won Kim et al.,
.. submit.html) (Benson 1999). We also searched for potential genes on the contig sequences
using FGENESH (SoftBerry, Inc., Mount Kisco, New York), geneid (http://genome.imim.
es/geneid.html), and GeneMark (http://exon.biology.gatech. edu/eukhmm.cgi). ...
Fungal Genetics and Biology
Volume 47, Issue 8, August 2010, Pages 663-671 doi:10.1016/j.fgb.2010.04.008
Phytophthora nicotianae transformants lacking dynein light chain 1 produce non-flagellate zoospores
Reena D. Narayan a, Leila M. Blackman a, Weixing Shan 1, a and Adrienne R. Hardham a
a Plant Science Division, Research School of Biology, The Australian National University, Canberra, ACT 2601, Australia
... DNA sequences were 22 searched for introns using FGENESH 23 (http://linux1.softberry.com/
berry.phtml?topic=fgenesh&group=programs&subgroup24 =gfind). For phylogenetic analysis,
homologues of DLC1 were retrieved from NCBI 25 and JGI databases. ...
Plant Physiology Preview
Published on September 10, 2010; 10.1104/pp.110.163923
Genome structures and halophyte-specific gene expression of the extremophile Thellungiella parvula in comparison to Thellungiella salsuginea (T. halophila) and Arabidopsis thaliana
Oh et al.,
1 University of Illinois Urbana-Champaign; 2 Purdue University
... An ab-initio ORF prediction with FGENESH(http://linux1.softberry.com/berry.phtml) identified 2,229
ORFs, ... The open reading frames (ORFs) in genomic sequences were predicted ab initio with
FGENESH (http://www.softberry.com) adopting Arabidopsis parameters. ...
BMC Plant Biol.
2010 Aug 19;10:183. doi:10.1186/1471-2229-10-183
Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds
Seabra AR, Vieira CP, Cullimore JV, Carvalho HG.
Instituto de Biologia Molecular e Celular da Universidade do Porto, Rua do Campo Alegre 823, 4150-180 Porto, Portugal.
... resources (http://www.medicago.org/genome/). Organization of both GS2 genes and prediction
of MtGS2b coding sequence was carried out using the FGENESH2.6 software from Softberry
(www.softberry.com). MtGS2a and MtGS2b amino acid sequences were ...
PLoS ONE
2010 5(4): e9958. doi:10.1371/journal.pone.0009958
Association and Linkage Analysis of Aluminum Tolerance Genes in Maize
Krill AM, Kirst M, Kochian LV, Buckler ES, Hoekenga OA
1 United States Department of Agriculture-Agricultural Research Service, Robert W. Holley Center for Agriculture and Health, Ithaca, New York, United States of America, 2 Cornell University, Department of Plant Breeding and Genetics, Ithaca, New York, United States of America
.. Genes of interest were placed on the physical-genetic map of maize using the BLAST tool
implemented by the Maize Genome Sequencing Project [42]. Gene architecture predictions were
made using the FGenesH tool as implemented by Softberry [46]. Statistical tests. ...
Fish & Shellfish Immunology
Volume 29, Issue 4, October 2010, Pages 594-599 doi:10.1016/j.fsi.2010.06.004
Ig heavy chain genes and their locus in grass carp Ctenopharyngodon idella
Xiao et al.,
a State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, China
b Graduate School of the Chinese Academy of Sciences, Beijing 100039, China
... sequence. The software GENSCAN (http://genes.mit.edu/GENSCAN.html), 131
FGENESH (http://linux1.softberry.com/all.htm) and BLASTX 132 (http://blast.ncbi.
nlm.nih.gov/Blast.cgi) were employed for the genome annotation. ...
Molecular breeding
2010, vol. 25, no1, pp. 155-166
Identification of major quantitative trait loci qSBR11-1 for sheath blight resistance in rice
Channamallikarjuna et al.,
(1) National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, 110012, New Delhi, India
(2) Directorate of Rice Research, Andhra Pradesh, Hyderabad, India
... Nipponbare (www.ncbi.nlm.nih.gov) was used for gene prediction. FGENESH gene pre- diction
software (www.softberry.com) was used to predict genes in this sequence. Predicted genes were
functionally annotated by using BLASTp (bit- score C 100, E value B -20) software. ...
Fungal Genetics and Biology
Volume 47, Issue 9, September 2010, Pages 761-772 doi:10.1016/j.fgb.2010.06.001
Characterization of the mating type (MAT) locus in the Phialocephala fortinii s.l. – Acephala applanata species complex
Pascal L. Zaffarano a, Angelo Duo a and Christoph R. Grunig a
a Institute of Integrative Biology (IBZ), Forest Pathology and Dendrology, ETH Zurich, 8092 Zurich, Switzerland
... 184 185 2.5. Annotation of the MAT locus 186 187 Positions of open reading frames, transcription
start and poly-A motifs in 188 sequences were predicted with FGENESH (http://linux1.softberry.com/
berry. 189 phtml?topic=fgenesh&group=programs&subgroup=gfind). ...
Eukaryotic Cell
2010 doi:10.1128/EC.00161-10
Co-localization of Amanitin and a Candidate Toxin-Processing Prolyl Oligopeptidase in Amanita Basidiocarps
Hong Luo, Heather E. Hallen-Adams, John S. Scott-Craig, and Jonathan D. Walton
Department of Energy Plant Research Laboratory, Michigan State University, E. Lansing MI 48824
... AbPOPA and AbPOPB, and two hybridizing clones were sequenced completely. 11 FGENESH
(www.softberry.com) was used to predict proteins ab initio using the 12 Coprinopsis cinerea model.
Each predicted protein was then used to search GenBank nr 13 using BLASTP. ...
BMC Plant Biology
2010, 10:145doi:10.1186/1471-2229-10-145
Comprehensive Analysis of NAC Domain Transcription Factor Gene Family in Populus trichocarpa
Hu et al.,
1 Qingdao Institute of BioEnergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao 266101, PR China
2 Current address: Complex Carbohydrate Research Center, The University of Georgia, 315 Riverbend Road, Athens, GA 30602, USA
... putative pseudogenes or incorrect annotations, and manual reannotation was performed to correct
and reannotate the putative NACs using online web server FGENESH (http://linux1.softberry.com/
berry.phtml) [59]. In this endeavor, seven sequences encoding only ...
Bioorganic & Medicinal Chemistry
Volume 18, Issue 12, 15 June 2010, Pages 4542-4546 doi:10.1016/j.bmc.2010.04.058
Identification of csypyrone B1 as the novel product of Aspergillus oryzae type III polyketide synthase CsyB
Yasuyo Seshime a, †, Praveen Rao Juvvadi b, ‡, Katsuhiko Kitamoto b, Yutaka Ebizuka c and Isao Fujii a
a School of Pharmacy, Iwate Medical University, 2-1-1 Nishitokuta, Yahaba, Iwate 028-3694, Japan
b Department of Biotechnology, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan
... These sequences were hand annotated by using FGENESH program (Softberry, Inc.) and/or
GeneID program. 25 Acknowledgements We thank Dr. D. Wakana for measurement of the
physicochemical properties of the compound, and Dr. T. Kushiro for helpful suggestions. ...
PNAS
January 5, 2010 vol. 107 no. 1 472-477 doi: 10.1073/pnas.0908007107
Angiosperm genome comparisons reveal early polyploidy in the monocot lineage
Tang, Haibao,Bowers, John E.,Wang, Xiyin,Paterson, Andrew H.
aPlant Genome Mapping Laboratory and
bDepartment of Plant Biology, University of Georgia, Athens, GA 30602
... set (Sbi1.4) from the Joint Genomics Institute (19), and the grapevine gene set from Genoscope
(3). Two Musa balbisiana BACs (AC226052.1 and AC226053.1) were downloaded from GenBank,
with putative gene models predicted using FGENESH (http://www.softberry.com). ...
BMC Plant Biology
2010, 10:25 6doi:10.1186/1471-2229-10-256
Functional divergence of the NIP III subgroup proteins involved altered selective constraints and positive selection
Qingpo Liu and Zhujun Zhu
College of Agriculture and Food Science, Zhejiang A & F University, Lin'an, Hangzhou 311300, China
... Programs InterProScan [45] and Page 14. ConPred II [46] were utilized to detect conserved
domains and predict the putative transmembrane regions (TMs), respectively. FgeneSH
(http://linux1.softberry.com/) was employed to predict the gene structures of candidates identified. ...
BMC Plant Biology
2010, 10:180 doi:10.1186/1471-2229-10-180
Structure and evolution of Apetala3, a sex-linked gene in Silene latifolia
Cegan et al.,
1 Laboratory of Plant Developmental Genetics, Institute of Biophysics, Academy of Sciences of the Czech Republic, v.v.i.Kralovopolska 135, CZ-612 65 Brno, Czech Republic
2 Department of Plant Biology, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno, Czech Republic
... software [48] (http://genes.mit.edu/GENSCAN.html) and FGENESH [49] (http://linux1.softberry.
com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind). ORFs were found with
ORF Finder [50] (http://www.ncbi.nlm.nih.gov/projects/gorf/) and a ...
BMC Plant Biology
2010, 10:135 doi:10.1186/1471-2229-10-135
Transcriptional regulation of the grape cytochrome P450 monooxygenase gene CYP736B expression in response to Xylella fastidiosa infection
Cheng et al.,
1 San Joaquin Valley Agricultural Science Center, USDA-ARS 9611 South Riverbend Avenue, Parlier, CA 93648, USA
2 Department of Biology, California State University, Fresno, CA 93740, USA
... a grape genomic database (GenBank Accessions: AM475392.1, CAAP02000243.
1, CAAP02005006.1) using the BLAST (http://www.ncbi.nlm.nih.gov/) and FGENESH
(http://www.softberry.com/berry.phtml) programs. A pair ...
BMC Genomics
2010, 11:179 doi:10.1186/1471-2164-11-179
Characterization of the ovine ribosomal protein SA gene and its pseudogenes
Broeke et al.,
1 Department of Nutrition, Genetics and Ethology, Faculty of Veterinary Medicine, Ghent University, Heidestraat 19, B-9820 Merelbeke, Belgium
2 Departamento de Mejora Genetica Animal, INIA, Ctra La Coruna Km 7.5, Madrid 28040, Spain
... Promoter sequences were searched with CISTER, Neural Network Promoter Prediction, FPROM and TFsearch [36,38-40].
... 36. FGENESH Webserver [http://linux1.softberry.com] ...
Functional Plant Biology
2010 37, 194–205.
Cloning and characterisation of ZmZLP1, a gene encoding an endoplasmic reticulum-localised zinc transporter in Zea mays
Xu Y, Wang B, Yu J, Ao G, Zhao Q
A State Key Laboratory of Agribiotechnology, China Agricultural University, Beijing 100193, China.
... The ZmZIP genomic sequences of Zea mays contigs were from http://maize.tigr.org/release5.
0/azm5.shtmL and were annotated for open reading frames using the gene prediction algorithms
of FGenesH (http://www.softberry.com); the others are in GenBank (http://www.ncbi.nlm ...
PLoS Biol
2010, vol. 8, num. 2, e1000313
Genome sequence of the pea aphid Acyrthosiphon pisum
Rozas Liras et al.,
... 2007-04628 award to ACCW. FgenesH models were donated by Softberry, Inc. This
research was additionally supported in part by the Intramural Research Program
of the NIH, National Library of Medicine. The funders had no ...
BMC Plant Biology
2010, 10:246
Sequencing of 6.7 Mb of the melon genome using a BAC pooling strategy
Gonzalez et al.,
Molecular Genetics Department, Center for Research in Agricultural
Genomics CRAG (CSIC-IRTA-UAB), Jordi Girona, 18-26, 08034 Barcelona, Spain
... setting the minimum identity parameter to 92. In some cases, the FGENESH annotation software
at http://linux1.softberry.com/berry.phtml, with Arabidopsis as plant model, was used to
complement or improve the Augustus annotation. The predicted coding ...
Plant Physiology
152:1772-1786 (2010)
Genomic Analysis of Wild Tomato Introgressions Determining Metabolism- and Yield-Associated Traits
Kamenetzky et al.,
Instituto de Biotecnologia, Instituto Nacional de Tecnologia Agropecuaria, and Consejo Nacional de Investigaciones Cientificas y Tecnicas, B1712WAA Castelar, Argentina (L.K., R.A., S.B., F.C.); Departamento de Botanica, Instituto de Biociencias, Universidade de Sao Paulo, Sao Paulo 05508–900, Brazil (F.d.G., L.B., M.-A.V.S., M.R.)
... S. pennellii BAC/cosmid full-length sequences as well as three S. lycopersicum BAC clones,
C04HBa0331L22, C07HBa0061J13, and C11HBa0062I24, were annotated using two different
gene prediction programs: FGENESH (www.softberry.com; Salamov and Solovyev, 2000 ...
PLoS Pathog
2010 6(4): e1000846. doi:10.1371/journal.ppat.1000846
SREB, a GATA Transcription Factor That Directs Disparate Fates in Blastomyces dermatitidis Including Morphogenesis
and Siderophore Biosynthesis
Gauthier et al.,
1 Department of Medicine, University of Wisconsin, Madison, Wisconsin, United States of America, 2 Department of Pediatrics, University of Wisconsin, Madison, Wisconsin, United States of America
... blast.ncbi.nlm.nih.gov/Blast.cgi). FGENESH was used to identify predicted exons
and introns in the SREB gene (www.softberry.com). Generation of null mutants. Two
vectors, pBTS4-KO1 and pBTS4-KO2, were used to delete.
Mol Genet Genomics.
2010 Feb;283(2):135-45. Epub 2009 Dec 19
Genome-wide discovery of DNA polymorphism in Brassica rapa
Park S, Yu HJ, Mun JH, Lee SC.
Department of Horticultural Crop Research, National Institute of Horticultural and Herbal Science, RDA, Suwon, 441-440, Republic of Korea.
. 2009). A list of BAC clones with GenBank accession numbers is provided in Table
S1. Ab initio gene prediction for the BAC sequences was obtained by using the
FGENESH program (www.softberry.com) based on a B. rapa matrix. ...
Developmental & Comparative Immunology
Volume 34, Issue 4, April 2010, Pages 465-473 doi:10.1016/j.dci.2009.12.007
In search of the origin of FREPs: Characterization of Aplysia californica fibrinogen-related proteins
A.M. Gorbushin, Y.V. Panchin, and N.V. Iakovleva
Institute of Evolutionary Biochemistry and Physiology RAS, pr. Torez 44, Saint-Petersburg 194223, Russia
... contigs having even weak similarity to juxtaposed IgSF and FreD domains were retrieved from
the nucleotide database and the coding region was preliminary identified by several invertebrate
gene prediction models using FGeneSH software (http://linux1.softberry.com/berry ...
Microbiology
156 (2010), 278-286; DOI 10.1099/mic.0.033886-0
A tyrosine O-prenyltransferase catalyses the first pathway-specific step in the biosynthesis of sirodesmin PL
Anika Kremer and Shu-Ming Li
Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie, Deutschhausstrasse 17A, D-35037 Marburg, Germany
... Computer-assisted sequence analysis. FGENESH (SoftBerry; http://linux1.softberry.com/)
and the DNASIS software package (version 2.1; Hitachi Software Engineering) were used
for exon/intron prediction and sequence analysis, respectively. ...
FGENESH 2009
Genome Biology and Evolution
2009 Vol. 1 265-277; doi:10.1093/gbe/evp025
Origin and Diversification of Land Plant CC-Type Glutaredoxins
M. Ziemann*, M. Bhave* and S. Zachgo**
*Environment and Biotechnology Centre, Faculty of Life and Social SciencesSwinburne University of Technology, Hawthorn, Victoria, Australia
**Department of Botany, University of Osnabruck, Osnabruck, Germany
... gene models. In cases of low conservation of exon sequences and lack of transcript
information, FGENESH hidden Markov model-based gene structure prediction
(http://linux1.softberry.com/berry.phtml) was utilized. Values ...
Current Genetics
Volume 55, Number 3 / June, 2009 pp. 253-262
The telomere-linked helicase (TLH) gene family in Magnaporthe oryzae: revised gene structure reveals a novel TLH-specific protein motif
Cathryn J. Rehmeyer, Weixi Li, Motoaki Kusaba and Mark L. Farman
(1) Department of Plant Pathology, University of Kentucky, Lexington, KY 40546, USA
(2) Department of Biology, University of Kentucky, Lexington, KY 40546, USA
... Dean et al. 2005). The masked sequences were then used for gene prediction with
Fgenesh (Salamov and Solovyev 2000) trained on M. oryzae sequences (Softberry,
http://www.softberry.com). Various gene prediction tools ...
Nature
461, 1135-1138 (22 October 2009) | doi:10.1038/nature08498
A transposon-induced epigenetic change leads to sex determination in melon
Martin et al.,
(1) INRA-CNRS, UMR1165, Unite de Recherche en Genomique Vegetale, 2 rue Gaston Cremieux, F-91057 Evry, France
(2) Plateforme de Cytologie et d’Imagerie Vegetale, Institut Jean Pierre Bourgin, INRA, 78026 Versailles Cedex, France
... After assembly, two forms of gene annotation were performed: (1) ab initio gene prediction with
GENSCAN (http://genes.mit.edu/GENSCAN.html),
GeneMark.hmm (http://exon.gatech.edu/
GeneMark/eukhmm.cgi) and FGENESH (http://www.softberry.com/berry.phtml); and (2 ...
Journal of Equine Veterinary Science
2009 Volume 29, Issue 6, Pages 519-526
Search for Polymorphism in Exon 2 of the Equine Leptin Gene
N. Huff, D. Thompson Jr., K. Bondioli
... View Within Article. Splicing donor and acceptor consensus sequences were located at the
putative exon/intron borders. The predicted splice sites at the intron/exon boundaries were
analyzed using a computer program (FGeneSH, Softberry, Inc., Mount Kisco, NY). ...
Molecular Genetics and Genomics
Volume 282, Number 2 / August, 2009, pp. 205-215
Genome-wide analysis of conservation and divergence of microsatellites in rice
Manish Roorkiwal 1, Atul Grover 1 and Prakash C. Sharma 1
(1) University School of Biotechnology, Guru Gobind Singh Indraprastha University, Kashmere Gate, Delhi, 110403, India
.. 1.6.2 (Softberry; downloadable from http://www.molquest.com) prior to the alignment. This allowed
much higher number of queries to be handled per day compared to a maximum of 25 per day
when FGENESH was accessed through World Wide Web portal of Softberry. ...
Russian Journal of Plant Physiology
Volume 56, Number 4 / July, 2009, pp.532-539
Delimitation of the fgr gene for rice fragrance to a 28-kb DNA fragment
Ding et al.,
(1) College of Agriculture and Biotechnology, China Agricultural University, Beijing, 100094, China
(2) High-Tech Research Center, Shandong Academy of Agricultural Science, Jinan, Shandong, 250100, China
... region. The sequence analysis of this fragment using FGENESH (http:/www.softberry.
com) predicted three candidate genes encoding putative 3-methyllcrotonyl- CoA
carboxylase, putative isoleucyl-tRNA synthetase, and BADH2. ...
BMC Evolutionary Biology
2009, 9:271 doi:10.1186/1471-2148-9-271
The evolution of Brassica napus FLOWERING LOCUST paralogues in
the context of inverted chromosomal duplication blocks
Jing Wang et al.,
1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, PR China and 2Rothamsted
Research, Harpenden, Herts, AL5 2JQ, UK
... Sequence analysis The coding sequences and amino acids ofBnFT paralogues were predicted
using the software "Softberry FGENESH" online service (http://linux1.softberry.com/berry.phtml). ...
"Softberry NSITE-PL" online service (http://linux1.softberry.com/berry.phtml). ...
Theor Appl Genet.
2009 May;118(8):1509-17. Epub 2009 Mar 6.
Fine mapping SPP1, a QTL controlling the number of spikelets per panicle, to a BAC clone in rice (Oryza sativa)
Liu T, Mao D, Zhang S, Xu C, Xing Y.
National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, 430070, Wuhan, China.
... Putative ORF prediction in 107 kb region The putative open reading frame (ORF) in the 107-kb
region was predicted by the online software FGENESH on the basis of the gene structure available
on the Internet (http://linux1.softberry.com/berry.phtml?topic=fgenesh& ...
Cited by 1 - Related articles - All 3 versions
PLoS One.
2009; 4(9): e6981 doi: 10.1371/journal.pone.0006981.
Identifying and Characterizing a Novel Protein Kinase STK35L1 and Deciphering Its Orthologs and Close-Homologs in Vertebrates
Pankaj Goyal, 1* Antje Behring, 1 Abhishek Kumar, 2 and Wolfgang Siess 1
1Institute for Prevention of Cardiovascular Diseases, University of Munich, Munich, Germany
2University of Bielefeld, Bielefeld, Germany
... This region was highly conserved among mammals (Figure 3B Figure 3 ). We
investigated this region for coding sequences manually and by using different gene
prediction software such as FGENESH (www.softberry.com). ...
Molecular Immunology
Volume 46, Issues 8-9, May 2009, Pages 1679-1687
The immunoglobulin heavy chain locus in the reptile Anolis carolinensis
Francisco Gambon Deza, Christian Sanchez Espinel and Susana Magadan Mompo
aUnidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n°, Vigo 36210, Pontevedra, Spain
bInstituto Superior de Saude do Alto Ave (ISAVE), Quinta de Matos, Geraz do Minho, 4830-31 PVL, Portugal
... The constant region genes and exons were obtained by comparison with those already described
for E. macularius. A dotplot was made with E. macularius and A. carolinensis sequences using
the DNASTAR (lasergene), FGENESH and FEX software (http://www.softberry.com). ...
The Plant Genome
doi: 10.3835/?plantgenome.2009.01.0001
vol. 2 no. 3 211-223
Retrotransposons within Syntenic Regions between Soybean and Medicago truncatula and Their Contribution to Local Genome Evolution
Bindu Joseph et al.,
Dep. of Agronomy, Iowa State Univ., Ames, IA 50011
... (2006). BAC Sequence Analysis. The LG I UBP12 region BAC sequences were annotated using
gene prediction programs FGENESH (www.softberry.com) and GeneMark (Lomsadze et al., 2005,
http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi; verified 30 July 2009). ...
Plant Science
Volume 176, Issue 3, March 2009, Pages 352-359
Characterization of six novel NAC genes and their responses to abiotic stresses in Gossypium hirsutum L.
Chaomin Meng, Caiping Cai, Tianzhen Zhang and Wangzhen Guo
National Key Laboratory of Crop Genetics & Germplasm Enhancement, Cotton Research Institute, Nanjing Agricultural University, Nanjing 210095, Jiangsu Province, PR China
... Additionally, assembled sequences were compared to exon predictions from FGENESH
(http://www.softberry.com). From these gene predictions, gene-specific primers (Table
1) were designed for PCR from cDNA and genomic DNA. ...
J Biosci.
2009 Jun;34(2):251-61.
Physical mapping, expression analysis and polymorphism survey of resistance gene analogues on chromosome 11 of rice.
Ghazi IA, Srivastava PS, Dalal V, Gaikwad K, Singh AK, Sharma TR, Singh NK, Mohapatra T.
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110 012, India.
... The FASTA form of each BAC/PAC clone sequence was downloaded as a text file one
by one. Gene prediction was performed for each clone using FGENESH (www.
softberry.com) trained for monocot species (Salamov and Solovyer 2000). ...
TAG Theoretical and Applied Genetics
Volume 118, Number 6 / April 2009 pp. 1027-1034
Identification and mapping of Pi41 , a major gene conferring resistance to rice blast in the Oryza sativa subsp. indica reference cultivar, 93-11
Qinzhong Yang 1, 2, Fei Lin 1, Ling Wang 1 and Qinghua Pan 1
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, 510642 Guangzhou, China
... markers. Flanking markers were used to identify candidate NBS- LRR genes, with
the help of GENSCAN (http://genes.mit. edu), FGENSH (http://sun1.softberry.com)
and RiceGAAS (http://rgp.dna.affrc.go.jp) software. The sequence ...
Developmental & Comparative Immunology
Volume 33, Issue 4, April 2009, Pages 547-558
Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties
Baojian Sun, Borre Robertsen, Zhiqiang Wang and Bin Liu
aDepartment of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromso, N-9037 Tromso, Norway
bInstitute of Oceanology, Chinese Academy of Sciences, Qingdao and Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China
... 2.2. Bioinformatics. Annotation of genes in genomic sequences was performed by
analysis with the programs Genscan (http://genes.mit.edu/GENSCAN.html) and
Fgenesh (http://softberry.com) combined with manual inspections. ...
The Plant Genome
doi: 10.3835/?plantgenome2008.09.0007
vol. 2 no. 1 93-101
Gene Content and Distribution in the Nuclear Genome of Fragaria vesca
Pontaroli et al.,
Dep. of Genetics, Univ. of Georgia, Athens, GA 30602;
... Gordon et al., 1998). Fosmid Sequence Annotation. Ab initio gene prediction was
performed on each fosmid sequence using FGENESH (Softberry, Inc., Mount Kisco,
NY) with the Arabidopsis training set. All the obtained predicted ...
Planta
Volume 229, Number 4 / March, 2009, pp. 885-897
Regulation of the cellulose synthase-like gene family by light in the maize mesocotyl
Harrie van Erp 1, 2 and Jonathan D. Walton 1
(1) Department of Energy-Plant Research Laboratory, Michigan State University, E. Lansing, MI 48824, USA
(2) Present address: Institute of Biological Chemistry, Washington State University, Pullman, WA, 99164, USA
... Supplementary Table S1). Proteins encoded by the MAGI sequences were
determined using the FGENESH monocotyledon ab initio gene prediction program
(http://www.softberry.com) (Yao et al. 2005). The predicted protein ...
BMC Plant Biol.
2009 Jul 17;9:93.
Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.
Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.
... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter
recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih.
gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...
Plant Molecular Biology
Volume 70, Numbers 1-2 / May, 2009, pp. 47-61
Structural characterization of Brachypodium genome and its syntenic relationship with rice and wheat
Naxin Huo et al.,
(1) Genomics and Gene Discovery Research Unit, USDA-ARS, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, USA
(2) Department of Plant Sciences, University of California, Davis, CA 95616, USA
... In addition, coding regions in the BAC sequences were also predicted using FGENESH (http://
www.softberry.com) set for a monocot model. Predicted genes were then compared to the
nonredundant and dbEST databases of NCBI (March 2008) using BLASTN and BLASTX. ...
Molecular Plant
2009 doi:10.1093/mp/ssp064
The CELLULOSE-SYNTHASE LIKE C (CSLC) Family of Barley Includes Members that Are Integral Membrane Proteins Targeted to the Plasma Membrane
Dwivany et al.,
Plant Cell Biology Research Centre, School of Botany, University of Melbourne Victoria 3010, Australia
... the 5' and 3' directions. Most of the intron/exon boundaries predicted by FGENESH
(www.softberry.com) in the HvCSLC1 and HvCSLC4 genomic sequences were
confirmed from EST data. A schematic representation of the ...
Plant Physiology and Biochemistry
Volume 47, Issue 7, July 2009, Pages 650-652
Evidence of a sirtuin gene family in grapevine (Vitis vinifera L.)
Matteo Busconi, Serena Reggi, Corrado Fogher and Luigi Bavaresco
aIstituto di Botanica e Genetica vegetale, Universita Cattolica del Sacro Cuore, Via Emilia Parmense, 84 29100 Piacenza, Italy
bIstituto di Frutti-Viticoltura, Universita Cattolica del Sacro Cuore, Via Emilia Parmense, 84 29100 Piacenza, Italy
... When appropriate, the prediction of hypothetical gene structure was performed using
the following software in parallel: FGENESH (http://linux1.softberry.com), GeneMark
(http://exon.gatech.edu), and GENSCAN (http://genes.mit.edu). ...
Fungal Genetics and Biology
Volume 46, Issue 9, September 2009, Pages 695-706
Mutations to LmIFRD affect cell wall integrity, development and pathogenicity of the ascomycete Leptosphaeria maculans
Angela P. Van de Wouw, Filomena A. Pettolino, Barbara J. Howlett and Candace E. Elliott
aSchool of Botany, The University of Melbourne, Vic. 3010, Australia
... study are listed in Table 1. The coding region of a gene flanking the T-DNA insertion (subsequently
referred to as LmIFRD) and a gene downstream of the T-DNA (subsequently referred to as
LmcABH-like) were predicted using FGENESH software (http://www.softberry.com/berry ...
BMC Evol Biol.
2009 Jul 19;9:168.
Evolution of a subtilisin-like protease gene family in the grass endophytic fungus Epichloe festucae
Bryant MK, Schardl CL, Hesse U, Scott B.
Institute of Molecular Biosciences, Massey University, Private Bag 11222, Palmerston North, New Zealand
... reading frames for SLP and unlinked non-SLP genes were identified using FGENESH, an
HMM-based gene structural prediction using the Fusarium graminearum parameters
(http://linux1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfi nd). ...
Functional & Integrative Genomics
Volume 9, Number 1 / February, 2009, pp. 97-108
The 172-kb genomic DNA region of the O. rufipogon yld1.1 locus: comparative sequence analysis with O. sativa ssp. japonica and O. sativa ssp. indica
Beng-Kah Song et al.,
(1) School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor, Malaysia
(2) Genome Dynamics Program, Scottish Crop Research Institute, Dundee, DD2 5DA, UK
... affrc.go.jp/usr-bin/login.cgi) and was aided by the rice training set of the gene-finding program
GeneMark.hmm (Lukashin and Borodovsky 1998, http://genemark.biology. gatech.edu/GeneMark/),
fgenesh (http://www.softberry. com/berry.phtml) and RiceHMM (Sakata et al. ...
Genetics
Published Articles Ahead of Print: October 12, 2009,
doi:10.1534/genetics.109.106922
Fine Mapping and Haplotype Structure Analysis of a Major Flowering Time Quantitative Trait Locus on Maize Chromosome 10
Ducrocq et al.,
INRA
... c0111K09) were analyzed using TE-Nest (KRONMILLER and WISE 2008) and RepeatMasker
(http://www.repeatmasker.org/) in order to localize transposable elements. Masked sequences
were annotated using Fgenesh (http://linux1.softberry.com/berry.phtml, version 2.6). ...
Plant Molecular Biology Reporter
Volume 27, Number 4 / December, 2009, pp. 526-533
The Promoters of Forisome Genes MtSEO2 and MtSEO3 Direct Gene Expression to Immature Sieve Elements in Medicago truncatula and Nicotiana tabacum
Noll et al.,
1) Institut fur Biochemie und Biotechnologie der Pflanzen der Westfalischen Wilhelms, Universitat Munster, Hindenburgplatz 55, Munster, 48143, Germany
(2) Department of Biology, University of York, Heslington, York, YO10 5DD, UK
... The MtSEO promoter sequences were aligned using the Lasergene software package v7.1
(DNAstar, Madison, WI, USA). Putative TATA box sequences were identified by analyzing the
corresponding genomic clone using the FGENESH program (http://www.softberry.com). ...
Molecular Genetics and Genomics
Volume 281, Number 5 / May, 2009, pp. 565-578
Characterization of cyclophilin-encoding genes in Phytophthora
Pamela Hui Peng Gan 1 , Weixing Shan 1, 2, Leila M. Blackman 1 and Adrienne R. Hardham 1
1) Plant Cell Biology Group, Research School of Biological Sciences, School of Biology, The Australian National University, GPO Box 475, Canberra, ACT, 2601, Australia
(2) Present address: College of Plant Protection, Northwest A & F University, Yangling, China
... eng/scripts/01_13.html. Genes were predicted from genomic sequences using
FGENESH (Softberry Inc., Mount Kisco, NY, USA), with diatom-speciWc parameters
and GENSCAN (Chesnick et al. 2000). To analyze pro- moter ...
Heredity.
2009 Mar;102(3):266-73. Epub 2008 Nov 12
Evolutionary fate of rhizome-specific genes in a non-rhizomatous Sorghum genotype
Jang et al.,
Plant Genome Mapping Laboratory, University of Georgia, Athens, GA 30602, USA.
... GAP2 (Huang, 1994) programs. Alternatively, gene structures were predicted by
FGE- NESH gene prediction software (http://sun1.softberry. com/berry.phtml) with
the training set for monocot plants. Orthologs of Oryza sativa ...
Molecular Breeding
Volume 24, Number 4 / November, 2009, pp. 433-446
Development of SNP markers linked to the L locus in Capsicum spp. by a comparative genetic analysis
Hee-Bum Yang 1, Wing Yee Liu 1, Won-Hee Kang 1, Molly Jahn 2 and Byoung-Cheorl Kang
(1) Department of Plant Science, Seoul National University, 599 Gwanak-ro Gwank-gu, Seoul, 151-921, Korea
(2) College of Agriculture and Life Science, University of Wisconsin, Madison, WI 53706, USA
... National University, Korea). BAC sequence annotation The FGENESH program
(http://linux1.softberry.com/ berry.phtml) was used to predict genes from the contig
sequence based on tomato organism informa- tion. To search for ...
BMC Biol.
2009 Jul 23;7:43.
Features of the ancestral bilaterian inferred from Platynereis dumerilii ParaHox genes
Hui et al.,
Department of Zoology, University of Oxford, Oxford, UK
... To find additional genes in these contigs besides the ParaHox genes, the entire contig sequences
were scanned with GENSCAN and FGENESH (implemented at www.softberry.com [79]), and
all predicted peptide sequences searched against Genbank with BLASTP. ...
Genetics
Vol. 181, 405-419, February 2009, doi:10.1534/genetics.108.093583
Molecular Analysis of a Large Subtelomeric Nucleotide-Binding-Site–Leucine-Rich-Repeat Family in Two Representative Genotypes of the Major Gene Pools of Phaseolus vulgaris
Geffroy et al.,
* Institut de Biotechnologie des Plantes, UMR-CNRS 8618, INRA, Universite Paris-Sud, 91 405 Orsay, France, Department of Chromosome Biology, University of Vienna, 1030 Vienna, Austria
... Ann Arbor, MI). The genomic sequence was annotated by using the gene prediction
program Fgenesh (Softberry website) and was manually edited by a homology search
against available databases. The genomic sequence ...
Molecular Biology and Evolution
2009 26(7):1651-1661; doi:10.1093/molbev/msp076
Sixty Million Years in Evolution of Soft Grain Trait in Grasses: Emergence of the Softness Locus in the Common Ancestor of Pooideae and Ehrhartoideae, after their Divergence from Panicoideae
Charles et al.,
* Unite de Recherches en Genomique Vegetale (UMR INRA 1165–CNRS 8114UEVE), Organization and evolution of Plant Genomes, Evry, France
Plant Genome Mapping Laboratory, University of Georgia
... We used the gene prediction given by the program FGENESH (http://www.softberry.com; with
the Monocot matrix) as well as BlastN and BlastX and TBlastX alignments against dbEST
(http://www.ncbi.nlm.nih.gov/), SwissProt (http://expasy.org/sprot/), and synteny with ...
BMC Genomics.
2009 Aug 13;10:376.
Integrating microarray analysis and the soybean genome to understand the soybeans iron deficiency response
O'Rourke et al.,
Department of Genetics, Developmental and Cellular Biology, Iowa State University, Ames, Iowa 50011, USA.
... QTL (Figure 1, Additional files 1 and 2). Sequences of the delineated iron QTL
regions were analyzed using FGENESH (www.softberry.com) using Arabidopsis
as the training model to identify gene structure predictions. The ...
Fungal Genetics and Biology
Volume 46, Issue 5, May 2009, Pages 353-364
Biosynthesis of the cyclooligomer depsipeptide bassianolide, an insecticidal virulence factor of Beauveria bassiana
Yuquan Xu et al.,
aSW Center for Natural Products Research and Commercialization, Office of Arid Lands Studies, College of Agriculture and Life Sciences, The University of Arizona, 250 E. Valencia Rd., Tucson, AZ 85706-6800, USA
bDepartment of Entomology, College of Agriculture and Life Sciences, The University of Arizona, 1140 E. South Campus Dr., Tucson, AZ 85721-0036, USA
... closure. Sequence assembly was done with Sequencher 4.7 (Gene Codes Corp).
HMM-based gene models were built with FGENESH (Softberry) using the F.
graminearum and the Aspergillus nidulans training sets. The models ...
Theor Appl Genet.
2009 Apr;118(6):1199-209. Epub 2009 Feb 15.
ps-2, the gene responsible for functional sterility in tomato, due to non-dehiscent anthers, is the result of a mutation in a novel polygalacturonase gene
Gorguet B, Schipper D, van Lammeren A, Visser RG, van Heusden AW.
Graduate School of Experimental Plant Sciences, Wageningen UR Plant Breeding, PO Box 386, 6700 AJ, Wageningen, The Netherlands
... genetic map. ORF4, a putative polygalacturonase gene, mapped the clos- est to
the ps-2 locus (Fig. 2). Subsequently, the putative introns and exons were identiWed
using the FGENSH soft- ware of Softberry. The candidate ...
Molecular & Cellular Proteomics
October 1, 2009, 8, 2368-2381.
In Planta Proteomics and Proteogenomics of the Biotrophic Barley Fungal Pathogen Blumeria graminis f. sp. hordei
Bindschedler et al.,
School of Biological Sciences, The University of Reading, P. O. Box 221, Reading RG6 6AS, United Kingdom,
Centre for Bioinformatics, Imperial College, Fleming Building, South Kensington Campus, London SW7 2AZ, United Kingdom
... to predict ORFs. Putative ORFs were determined with the FGENESH prediction program
using either the Leptosphaeria maculans or the Sclerotinia sclerotiorum ORF prediction
models (SoftBerry, Inc.). Putative classical secretion ...
PLoS Pathog.
2009 January; 5(1): e1000261.
Genomic Survey of the Non-Cultivatable Opportunistic Human Pathogen, Enterocytozoon bieneusi
Akiyoshi et al.,
1Division of Infectious Diseases, Department of Biomedical Sciences, Tufts Cummings School of Veterinary Medicine, North Grafton, Massachusetts, United States of America
2Marine Biological Laboratory, Woods Hole, Massachusetts, United States of America
... ECU08_1090/ECU08_1100). Introns. DNA sequences of contigs greater than 10 kb
were analyzed by FGENESH (http://www.softberry.com; [44]), an HMM-based gene
structure prediction program, to identify putative introns. For the ...
Cited by 11 - Related articles - All 7 versions
BMC Res Notes.
2009; 2: 206.
Intragenic tandem repeats in Daphnia magna: structure, function and distribution
Isabelle Colson,1 Louis Du Pasquier,1 and Dieter Ebert 1
1Basel University, Zoological Institute, Vesalgasse 1, CH-4051 Basel, Switzerland
... 18. Salamov A, Solovyev V:Ab initio gene finding in Drosophila genomic DNA. Genome
Res 2000,10: 516-522. 19. Fgenesh [http://linux1.softberry.com/berry.phtml?topic=
fgenesh&group=programs&sy bgroup=gfind]. Page 13. - 12 - 20. ...
World Journal of Microbiology and Biotechnology
Volume 25, Number 6 / June, 2009, pp. 989-995
Characteristic analysis of transformants in T-DNA mutation library of Monascus ruber
Shao et al.,
(1) College of Food Science and Technology, Huazhong Agricultural University, Hongshan District, 430070 Wuhan, Hubei, People’s Republic of China
... et al. 2004) was carried out to extend the DNA sequences flanking TAIL-PCR
products. Up to now, we have amplified eight full DNA sequences, which were
submitted to FGENESH (http://linux1.softberry.com/berry. phtml) to ...
PLoS Pathogens
January 2009, Volume 5, Issue 1, e1000261. doi:10.1371/journal.ppat.1000261
Genomic Survey of the Non-Cultivatable Opportunistic
Human Pathogen, Enterocytozoon bieneusi
Akiyoshi et al.,
1 Division of Infectious Diseases, Department of Biomedical Sciences, Tufts Cummings School of Veterinary Medicine, North Grafton, Massachusetts, United States of
America, 2 Marine Biological Laboratory, Woods Hole, Massachusetts, United States of America
... ECU08_1090/ECU08_1100). Introns. DNA sequences of contigs greater than 10 kb
were analyzed by FGENESH (http://www.softberry.com; [44]), an HMM-based gene
structure prediction program, to identify putative introns. For the ...
PNAS
February 17, 2009 vol. 106 no. 7 2295-2300 doi: 10.1073/pnas.0807350106
Duplicate genes increase expression diversity in closely related species and allopolyploids
Misook Ha a,b,c, Eun-Deok Kim a and Z. Jeffrey Chen a,b,c,d
Sections of aMolecular Cell and Developmental Biology and
dIntegrative Biology
bCenter for Computational Biology and Bioinformatics, and
cInstitute for Cellular and Molecular BiologyOne University StationA-4800University of TexasAustinTX 78712
... The sequencing reads were assembled and edited. A. arenosa genes were annotated using
FGENESH (www.softberry.com) and BLAST against cDNA sequences of A. thaliana. Annotated
genomic sequences are deposited in GenBank (accession no. FJ461780). ...
Plant Physiology
149:286-296 (2009)
A Germin-Like Protein Gene Family Functions as a Complex Quantitative Trait Locus Conferring Broad-Spectrum Disease Resistance in Rice
Manosalva et al.,
Bioagricultural Sciences and Pest Management and Program in Plant Molecular Biology, Colorado State University, Fort Collins, Colorado 80523–1177 (P.M.M., R.M.D, J.E.L.); Plant Pathology, Kansas State University, Manhattan, Kansas 66502–5502 (P.M.M.);
... cgi) using the HTGS database. FGENESH (http://www.softberry.com/berry.phtml) was
used to predict putative oxalate oxidase and OsGLP from significant rice bacterial
artificial chromosome hits. All nucleotide and inferred amino ...
Plant Journal.
60(1):181-193, October 2009.
Genome organization of the tomato sun locus and characterization of the unusual retrotransposon Rider
Jiang N, Gao D, Xiao H, van der Knaap E.
Department of Horticulture, Michigan State University, East Lansing, MI 48824, USA.
... Tomato eIF4a6 was used to assess equal loading and mRNA and cDNA quality. Primer sequences
are listed in Table S3. Annotations TOP. The gene sequences were identified using the ab initio
gene prediction program FGENESH (http://www.softberry.com/berry.phtml ). ...
Nucleic Acids Research
2009, Vol. 37, Database issue D750-D754 doi:10.1093/nar/gkn887
SpBase: the sea urchin genome database and web site
R. Andrew Cameron, Manoj Samanta, Autumn Yuan, Dong He and Eric Davidson
Center for Computational Regulatory Genomics, Beckman Institute 139–74, California Institute of Technology, Pasadena, CA 91104, USA
... were independently employed by individual groups to arrive at sets of gene models
for eventual annotation: Gnomon at NCBI (13); FgenesH from Softberry (14,15 ...
FGENESH 2008
Nature
2008, 4doi:10.1038/nature07410
The Phaeodactylum genome reveals the evolutionary history of diatom genomes.
Bowler et al.
1. CNRS UMR8186, Department of Biology, Ecole Normale Supe'rieure, 46 rue d'Ulm, 75005 Paris, France
2. Stazione Zoologica 'Anton Dohrn', Villa Comunale, I-80121 Naples, Italy
... Gene predictors used for these annotations included ab initio Fgenesh 12 trained on sets of known
genes and reliable homology-based gene models from P. tricornutum and T.pseudonana, and homology-based Fgenesh+ 12
and Genewise 13 seeded by BLASTX alignments against sequences in the NCBI non-redundant protein set. ...
Nature
2008, 452, 949 - 955.
The genome of the model beetle and pest Tribolium castaneum.
Richards et al.
1. Human Genome Sequencing Cente
2. Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA.
... Work at the BCM-HGSC was funded by grants from the NHGRI and USDA. FgenesH and FgenesH++ analysis
was donated by Softberry Inc. This research was additionally supported in part by the Intramural...
Nature
2008, 452, 991 - 996.
The draft genome of the transgenic tropical fruit tree papaya (Carica papaya Linnaeus)
Ming et al.
Hawaii Agriculture Research Center, Aiea, Hawaii 96701, USA
Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois
61801, USA
...in training ab initio gene prediction software Augustus, GlimmerHMM and SNAP. Ab initio gene prediction software Fgenesh, Genscan and
TWINSCAN were trained on Arabidopsis. Spliced alignments of proteins from the plant division of...
Nature
Volume 453 Number 7198 pp1064 - 1071 (19 Jun 2008), doi: 10.1038/nature06967
The amphioxus genome and the evolution of the chordate karyotype.
Putnam et al.
# Department of Energy Joint Genome Institute, Walnut Creek California 94598, USA
# Center for Integrative Genomics, Department of Molecular and Cell Biology, University of
California, Berkeley, California 94720, USA
... A\Supplementary Note 3. Annotation of protein coding genes
3.1 Expressed sequence tag sequencing.
cDNA libraries for amphioxus were prepared from gastrula and neurula
stage embryos, and from
larvae as described by 6, and a single library was created for
Petromyzon marinus (sea lamprey).
Approximately 32,000 expressed sequence tags (ESTs) were attempted
from each library.
(Supplementary Table S6).
3.2 Gene prediction, functional annotation and quality control.
The JGI Annotation Pipeline was used for annotation of the amphioxus
v1.0 assembly described
here. The pipeline includes the following steps: (1) repeat masking,
(2) mapping ESTs, full length
cDNAs, and putative full length known genes, (3) gene structure
prediction using several methods,
(4) protein functional annotation using several methods, and (5)
combining gene predictions into a
non redundant representative set of gene models, which are subject to
genome-scale analysis. The
genomic sequence, predicted genes and annotations of amphioxus,
together with available
evidence, are available at the JGI Genome Portal
(www.jgi.doe.gov/Amphioxus) and from GenBank
under accession number ABEP01000000.
Transposons were masked using RepeatMasker 7 tools and a custom
library of manually curated
repeats (see above Supplementary Note 2.4). 480,070 ESTs were
clustered into 77,402 consensus
sequences and both individual ESTs and consensus sequences were mapped
onto genome assembly
using BLAT4.
Gene predictors used for annotation of amphioxus v1.0 included ab
initio FGENESH 8, homology-
based FGENESH+ 8, homology-based GENEWISE 9, and EST-based ESTEXT (Grigoriev,
unpublished, available upon request). ...
Nature
452, 88 - 92 (06 Mar 2008), doi: 10.1038/nature06556, Letter
The genome of Laccaria bicolor provides insights into mycorrhizal symbiosis
Martin et al.,
MR 1136, INRA-Nancy Universite, Interactions Arbres/Microorganismes, INRA-Nancy, 54280
Champenoux, France.
...in the scaffold assembly (Supplementary Table 2). Genome annotation Gene models were predicted
using FgenesH, homology-based FgenesH+ (ref. 18) and Genewise, as well as EuGAne and TwinScan, and alignments of several complementary DNA...
Nature
451, 193 - 196 (10 Jan 2008), doi: 10.1038/nature06453, Letter
Identification of the sex genes in an early diverged fungus
Alexander Idnurm, Felicia J. Walton, Anna Floyd, Joseph Heitman
Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North
Carolina 27710, USA.
...were searched with BLASTp, BLASTn or tBLASTn programs.
Gene predictions from unannotated genomic DNA were made with FGENESH
software using the settings for Schizosaccharomyces pombe. HMG domains
were aligned in ClustalW, in MacClade...
Genetics
Published Articles Ahead of Print: December 15, 2008,
doi:10.1534/genetics.108.093583
Molecular Analysis of a Large Subtelomeric NBS-LRR Family in Two Representative Genotypes of the Major Gene Pools of Phaseolus vulgaris
Valerie et al.,
Institut de Biotechnologie des Plantes
University of Vienna
Institut Pasteur
... Arbor, MI, USA). The genomic sequence was annotated by using the gene prediction
program Fgenesh (Softberry website) and was manually ...
PLoS Genet.
2008 November; 4(11): e1000261.
Zebrafish Mutants calamity and catastrophe Define Critical Pathways of Gene–Nutrient Interactions in Developmental Copper Metabolism
Erik C. Madsen and Jonathan D. Gitlin
Edward Mallinckrodt Department of Pediatrics, Washington University School of Medicine, St. Louis, Missouri, United States of America
... This contig was scanned for potential genes using the FGENESH program (www.softberry.
com) and comparing to the Ensembl database (www.ensembl.org). ...
BMC Plant Biology
2008, 8:133 doi:10.1186/1471-2229-8-133
The lipoxygenase gene family: a genomic fossil of shared polyploidy between
Glycine max and Medicago truncatula
Shin et al.,
Department of Plant Science, Seoul National University, Seoul 151-921, Korea
... FgeneSH on an Arabidopsis matrix, because the resultswere better suited for BLASTZ
resultsthan that of the Medicago matrix (http://www.softberry.com). Each ...
BMC Genomics
2008, 9:555 doi:10.1186/1471-2164-9-555
New insights into the origin of the B genome of hexaploid wheat: Evolutionary
relationships at the SPA genomic region with the S genome of the diploid
relative Aegilops speltoides
Salse et al.,
Organisation and Evolution of Plant Genomes (OEPG), UMR INRA 1165 - CNRS 8114
UEVE - Unite de Recherche en Genomique Vegetale (URGV). 2, rue Gaston Cremieux,
CP5708, 91057 Evry cedex. France.
Gene structures and putative functions were identified by combining results of
BLASTN and BLASTX alignments against dbEST (http://www.ncbi.nlm.nih.gov/) and
SwissProt databases (http://expasy.org/sprot/), with results of 2 gene predictor programs,
Page 17
15
Eugene [53] with rice (Oryza sativa) training version and FgeneSH [54] (with default
parameters (http://sun1.softberry.com/).
BMC Genetics
2008, 9:78 doi:10.1186/1471-2156-9-78
Genomic Complexity of the Variable Region-Containing Chitin-Binding Proteins
in Amphioxus
Dishaw et al.,
All Children’s Hospital,Department of Molecular Genetics,801SixthStreet South,St. Petersburg,FL
33701,USA
... html),FGENESH and FGENESH+ (http://linux1.softberry.com/all.htm) or
genomescan[63,66] (http://genes.mit.edu/genomescan. html).Details ...
BMC Evolutionary Biology
2008, 8:115
doi:10.1186/1471-2148-8-115
Roots of angiosperm formins: the evolutionary history of plant FH2
domain-containing proteins
Michal Grunt, Viktor Zarsky and Fatima Cvrckova
Department of Plant Physiology, Faculty of Sciences, Charles University, Vinicna' 5,
CZ 128 43 Praha 2, Czech Republic
... For each new gene, splice sites were predicted using at least three of the following
eukaryotic gene-prediction programs: GeneMark.hmm [84], FGENESH [85] at the
Softberry, Inc. website [86] ...
Appl. Environ. Microbiol.
December 2008 doi:10.1128/AEM.01889-08
Telomere organization in the ligninolytic basidiomycete Pleurotus ostreatus
Gumer Perez, Jasmyn Pangilinan, Antonio G. Pisabarro, and Lucia Ramirez
Genetics and Microbiology Research Group, Department of Agrarian Production, Public University of Navarre, 31006 Pamplona, Spain; DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598, USA
... The Hidden 153 Markov Model (HMM)-based program FGENESH was used for web-based
gene 154 prediction (http://www.softberry.com/berry.phtml). ...
International Journal of Integrative Biology
2008 v.3 No 1, 50
SNP in Granule Bound Starch Synthase-I (GBSS-I) gene in Indian rice genotypes
SK Srivastava, U Roy
... The genes for both the BACs have been predicted using FGENESH software
(http://www.softberry.com), which revealed the presence of 23 and 34 genes respectively ...
International Journal of Plant Genomics
Volume 2008, Article ID 391259, 8 pages doi:10.1155/2008/391259
Conserved Microsynteny of NPR1 with Genes Encoding
a Signal Calmodulin-Binding Protein and a CK1-Class Protein
Kinase in Beta vulgaris and Two Other Eudicots
David Kuykendall, Jonathan Shao, and Tammy Murphy
Molecular Plant Pathology Laboratory, Agricultural Research Service, United States Department of Agriculture,
10300 Baltimore Avenue, Building 004, Room 120, Beltsville, MD 20705, USA
... The sequence contig was
screened for coding sequence using a combination of the
following programs: GeneMark [18, 19] for eukaryotes
(http://exon.gatech.edu/GeneMark/eukhmm.cgi), GenScan
(http://genes.mit.edu/GENSCAN.html), FGENESH (http://
softberry.com/), and GRAIL ...
BMC Genomics
2008, 9:563 doi:10.1186/1471-2164-9-563
The UDP-glucosyltransferase multigene family in Bombyx mori
Huang et al.,
The Key Sericultural Laboratory of Agricultural Ministry, Institute of Sericulture and
Systems Biology, Southwest University, Chongqing 400715, China
... query sequence and its flanking regions were extracted, and put into Softberry
database for predicting new genes by using FGENESH taking the available insect...
CURRENT SCIENCE
VOL. 95, NO. 8, 25 OCTOBER 2008
Identification of candidate gene-based
markers (SNPs and SSRs) in the zinc and iron
transporter sequences of maize (Zea mays L.)
Arti Sharma and R. S. Chauhan
Advanced Centre of Hill Bioresources and Biotechnology, CSK HP Agricultural University, Palampur 176 062, India
Department of Biotechnology and Bioinformatics, Jaypee University of Information Technology, Waknaghat, P.O. Dumehar Bani,
Kandaghat, Solan 173 215, India
... for open reading frames (ORFs), including the promoter regions and the 3?UTRs using
gene prediction algorithms of FGenesH (http:// sun1.softberry.com/berry ...
Yeast
Sequencing Report 2008 Volume 25 Issue 9, Pages 673 - 679
The gap-filling sequence on the left arm of chromosome 2 in fission yeast Schizosaccharomyces pombe
Sasaki et al.,
ASPEX Division, Research Centre, Asahi Glass Co., Ltd., Japan
... Corporation). ORFs, introns and exons were predicted using FGENESH
(http://www.softberry.com/) (Sala- mov et al., 2000) on an Sz. ...
Insect Biochemistry and Molecular Biology
Volume 38, Issue 12, December 2008, Pages 1111-1120
A genomewide survey of homeobox genes and identification of novel structure of the Hox cluster in the silkworm, Bombyx mori
Chai et al.,
The Key Sericultural Laboratory of Agricultural Ministry, College of Biotechnology, Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, China
... The intergenic sequences where the lost homeobox genes were found were further put
into the Softberry database for predicting new genes by using the FGENESH ...
International Journal of Integrative Biology
2008 Volume 2 N.3 pp.153-156
Sprome: A database on promoters of abiotic stress inducible genes in rice
R Sundheep, L Arul, P Nagarajan, P Balasubramanian
...FGENESH, a gene prediction tool based on Hidden Markov Model (HMM) was used to predict the presence of plausible
Exon/UTR in the putative promoter region (http://www.softberry.com/berry ...
Trends in Biochemical Sciences
Volume 33, Issue 12, December 2008, Pages 577-582
Eukaryote polyphosphate kinases: is the 'Kornberg' complex ubiquitous?
Paul Hooley, Michael P. Whitehead and Michael R.W. Brown
School of Applied Sciences, Wulfruna Street, University of Wolverhampton, Wolverhampton, WV1 1SB, UK
... Genome projects perform automatic annotations using gene-finding programs such as
FGENESH (Softberry) or Artemis (Sanger Centre), with somewhat arbitrary cut ...
Heredity
12 Nov 2008, doi: 10.1038/hdy.2008.119
Evolutionary fate of rhizome-specific genes in a non-rhizomatous Sorghum genotype
C S Jang, T L Kamps, H Tang, J E Bowers, C Lemke, A H Paterson
1. 1Plant Genome Mapping Laboratory, University of Georgia, Athens, GA, USA
2. 2Plant Genomics Lab, Department of Applied Plant Sciences Technology, Kangwon National University, Chuncheon, Korea
... Alternatively, gene structures were predicted by FGENESH gene prediction software (http://sun1.softberry.com/berry.phtml) with the training set for monocot plants. Orthologs of Oryza sativa corresponding to...
Theor Appl Genet
DOI 10.1007/s00122-008-0888-y
Fine genetic mapping of xa24, a recessive gene for resistance
against Xanthomonas oryzae pv. oryzae in rice
Xiaoming Wu, Xianghua Li, Caiguo Xu and
Shiping Wang
National Key Laboratory of Crop Genetic Improvement,
National Center of Plant Gene Research (Wuhan),
Huazhong Agricultural University, Wuhan 430070, China
... Gene prediction analysis was performed with the programs GENSCAN (http://genes.mit.
edu/GENSCAN.html), FGE- NESH (http://www.softberry.com/berry.phtml) and Gene ...
Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 71-79 doi:10.1016/j.gene.2008.07.027
SRWD: A novel WD40 protein subfamily regulated by salt stress in rice (Oryzasativa L.)
Ji Huang et al.
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
... Using corresponding genomic sequence, the opening read frame (ORF) was predicted
by Fgenesh program at Softberry server (http://www.softberry.com) and this ...
Molecular Plant
2008 1(5):830-838; doi:10.1093/mp/ssn045
Fine Mapping of Spr3, a Locus for Spreading Panicle from African Cultivated Rice (Oryza glaberrima Steud.)
Ji-Jing Luo, Wei Hao, Jian Jin, Ji-Ping Gao and Hong-Xuan Lin
National Key Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, The Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China
... The counterpart DNA sequences of the interval defined by the markers L4359 and L4264
of Nipponbare were predicted with FGENESH of Softberry (www.softberry.com ...
Genome
Volume 51, Number 6, 1 June 2008 , pp. 452-464(13)
Comparative genomic analysis of the whale (Pseudorca crassidens) PRNP locus
Kim, Dae-Won et al.
... Ab initio gene pre- diction was performed on the genomic sequences using FGENESH
(SoftBerry, Inc., Mount Kisco, New York; http:// www.softberry.ru/berry.phtml ...
Fungal Genetics and Biology
Volume 45, Issue 11, November 2008, Pages 1487-1496 doi:10.1016/j.fgb.2008.08.009
Characterization of the atromentin biosynthesis genes and enzymes in the homobasidiomycete Tapinella panuoides
Patrick Schneider, Sarah Bouhired and Dirk Hoffmeister
Pharmaceutical Biology and Biotechnology, Albert-Ludwigs-Universitat, Stefan-Meier-Strasse 19, 79104 Freiburg, Germany
... The Aspergillus or Phanerochaete search algorithms of FGENESH (Softberry, Mount
Kisco, NY) were used to predict gene structures and exon/intron junctions. 2.5. ...
Molecular Phylogenetics and Evolution
Volume 49, Issue 1, October 2008, Pages 349-355 doi:10.1016/j.ympev.2008.04.025
Molecular evolution and diversification of plant cysteine proteinase inhibitors: New insights after the poplar genome
M. Margis-Pinheiro et al.
a Programa de Pos-graduacao em Genetica e Biologia Molecular, Departamento de Genetica, Universidade Federal do Rio Grande do Sul, Brazil
b Programa de Pos-graduacao em Biologia Celular e Molecular, Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, Brazil
c Departamento de Bioquimica, Instituto de Ciencias Basicas da Saude, Universidade Federal do Rio Grande do Sul, Brazil
... Genomic sequences from Arabidopsis thaliana and Oryza sativa were also analyzed
in the FGENESH gene structure prediction program (http://www.softberry.com/). ...
J. Biol. Chem.
Vol. 283, Issue 40, 26859-26868, October 3, 2008 doi:10.1074/jbc.M804979200
Ergot Alkaloid Biosynthesis in Aspergillus fumigatus:
OVERPRODUCTION AND BIOCHEMICAL CHARACTERIZATION OF A 4-DIMETHYLALLYLTRYPTOPHAN N-METHYLTRANSFERASE
Ole Rigbers and Shu-Ming Li
From the Heinrich-Heine-Universitat Dusseldorf, Institut fur Pharmazeutische Biologie und Biotechnologie, Universitatsstrasse 1, D-40225 Dusseldorf, Germany and the Philipps-Universitat Marburg, Institut fur Pharmazeutische Biologie, Deutschhausstrasse 17A, D-35037 Marburg, Germany
... Computer-assisted Sequence Analysis-FGENESH (Softberry, Inc.) and the DNASIS software
package (version 2.1; Hitachi Software Engineering, San Bruno, CA) were ...
Gene
Volume 418, Issues 1-2, 15 July 2008, Pages 41-48 doi:10.1016/j.gene.2008.04.005
Is crab duplex-specific nuclease a member of the Serratia family of non-specific nucleases?
V. E. Anisimova et al.
a Shemiakin and Ovchinnikov Institute of Bioorganic Chemistry RAS, Miklukho-Maklaya 16/10, 117871 Moscow, Russia
b Evrogen JSC, Miklukho-Maklaya 16/10, 117871 Moscow, Russia
... The putative N- and/or C-terminal terminal ends were searched in the genomic
regions using FGENESH software (http://sun1.softberry.com). ...
Int J Plant Genomics
2008: 348621. Published online 2008 June 18. doi: 10.1155/2008/348621.
Development in Rice Genome Research Based on Accurate Genome Sequence
Takashi Matsumoto, Jianzhong Wu, Baltazar A. Antonio, and Takuji Sasaki
Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, 2-1-2, Kannondai, Tsukuba, Ibaraki 3058602, Japan
... It retrieves rice sequences from GenBank and analyzes them with gene prediction
programs such as Genscan [31] and FgeneSH (http://www.softberry.com/berry.phtml ...
Molecular Genetics and Genomics
Volume 279, Number 5 / May 2008 pp. 473-480
Construction of a fosmid library of cucumber ( Cucumis sativus ) and comparative analyses of the eIF4E and eIF(iso)4E regions from cucumber and melon ( Cucumis melo )
J. D. F. Meyer, W. Deleu3, J. Garcia-Mas and M. J. Havey
(1) Department of Horticulture, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA
(2) Vegetable Crops Unit, Agricultural Research Service, US Department of Agriculture, Department of Horticulture, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA
(3) IRTA, Centre de Recerca en Agrigenomica CSIC-IRTA-UAB, Carretera de Cabrils Km 2, 08348 Cabrils (Barcelona), Spain
... 1997; http://www.ncbi.nlm.nih.gov/ BLAST/), GENESCAN (Burge and Karlin 1997; http://
www.genes.mit.edu/GENSCAN.html), and FGENESH (http://www.softberry.com). ...
Molecular Breeding
Volume 22, Number 4 / November 2008 pp. 593-602
Cloning and sequence diversity analysis of GmHs1 pro-1 in Chinese domesticated and wild soybeans
Cuiping Yuan et al.
(1) Institute of Crop Sciences, Chinese Academy of Agricultural Sciences/Crop Germplasm & Biotechnology, Ministry of Agriculture, Beijing, 100081, China
(2) Institute of Crop Germplasm Resources, Shanxi Academy of Agricultural Sciences, Taiyuan, 030031, China
... ORF and amino acid sequence were predicted with FGENESH 2.5 software (http://www.
softberry.com) and used as a basis to estimate sequence diversity at ...
Genetics.
Published Articles Ahead of Print: September 9, 2008, doi:10.1534/genetics.108.092304
Dynamics and differential proliferation of transposable elements during the evolution of the B and A genomes of wheat
Mathieu Charles et al.
1 URGV (INRA-CNRS-UEVE),
2 CEA Genoscope,
3 Murdoch University,
4 INRA
... Six genes (of known or unknown function) and two putative genes were identified using
the FGENESH prediction software (http://www.softberry.
com) and by identification of homologs in rice (Figure ...
Gene
Volume 420, Issue 2, 1 September 2008, Pages 135-144 doi:10.1016/j.gene.2008.05.019
Expression analysis of rice A20/AN1-type zinc finger genes and characterization of ZFP177 that contributes to temperature stress tolerance
Ji Huang et al.
State key laboratory of crop genetics and germplasm enhancement, Nanjing Agricultural University, Nanjing 210095, China
... By database searching and FgeneSH prediction (http://www.softberry.com), it was
found 12 putative proteins containing both A20 and AN1 zinc finger motifs in ...
Molecular Breeding
Volume 22, Number 4 / November 2008 pp. 603-612
Gene identification and allele-specific marker development for two allelic low phytic acid mutations in rice ( Oryza sativa L.)
Zhao et al.
(1) IAEA-Zhejiang University Collaborating Center, National Key Laboratory of Rice Biology and Key Laboratory of Chinese Ministry of Agriculture for Nuclear-Agricultural Sciences, Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou, 310029, China
(2) Institute of Crop Science and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
(3) Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Wagramer Strasse 5, P.O. Box 100, 1400 Vienna, Austria
... et al. 2004). Gene prediction was made using the FGENESH program available
on http://www.softberry.com/berry.phtml. PCR primers ...
Crop Sci
48:S-49-S-68 (2008)
Structural Features of the Endogenous CHS Silencing and Target Loci in the Soybean Genome
Jigyasa H. Tuteja and Lila O. Vodkin
Dep. of Crop Sciences, 384 ERML, 1201 W. Gregory Dr., Univ. of Illinois, Urbana, IL 61801.
... For ab initio predictions, FGeneSH with the Medicago truncatula-based training
set (http://www.softberry.com; verified 9 Jan. 2008) was run. ...
Gene
Volume 411, Issues 1-2, 31 March 2008, Pages 27-37
Multiple tandem gene duplications in a neutral lipase gene cluster in Drosophila
Irene Horne and Victoria S. Haritos
CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia
... Genomic regions containing significant sequence similarity in multiple regions were
then examined for genes using FGENESH on Softberry (http://www.softberry.com ...
J. Virol.
July 2008, p. 6697-6710, Vol. 82, No. 13 doi:10.1128/JVI.00212-08
A single Banana streak virus integration event in the banana genome as the origin of infectious endogenous pararetrovirus (EPRV)
Philippe Gayral et al.,
CIRAD BIOS, UMR Biologie et Ge'ne'tique des Interactions Plante-Parasite (BGPI), TA 4-54/K Campus international de Baillarguet, F-34398 Montpellier Cedex 5, France;
... genes (FgenesH for monocot plants (44), softberry software (http://www.softberry.
com) and 184 ACCEPTED at Google Indexer on May 20, 2008 jvi.asm.org ...
Int. J. Mol. Sci.
2008, 9, 1717-1729; DOI: 10.3390/ijms9091717
Are the Genes nadA and norB Involved in Formation of
Aflatoxin G1
Kenneth C. Ehrlich, Leslie L. Scharfenstein Jr., Beverly G. Montalbano and
Perng-Kuang Chang
Southern Regional Research Center, 1100 Robert E. Lee Blvd, P.O. Box 19687, New Orleans, LA
70179, USA
... a coding sequence with a single intron are predicted for nadA in A. parasiticus
SU-1 and BN008 isolates based on an analysis using the Softberry FGENESH coding ...
New Phytologist
Volume 179 Issue 1 Page 196-208, July 2008
Magnaporthe grisea avirulence gene ACE1 belongs to an infection-specific gene cluster involved in secondary metabolism
Jerome Collemare et al.,
UMR5240 CNRS/UCB/INSA/BAYER CropScience, 14-20 Rue Pierre Baizet, 69263 Lyon cedex 09, France
... FgenesH (http://www.softberry.com) was used to identify introns using
Schizosaccharomyces pombe and Neurospora crassa matrices. ...
Chembiochem
Volume 9 Issue 7, Pages 1019 - 1023, 2008
Synthetic Strategy of Nonreducing Iterative Polyketide Synthases and the Origin of the "Classical Starter-Unit Effect"
Jason M. Crawford, Dr., Anna L. Vagstad, Karen P. Whitworth, Kenneth C. Ehrlich, Dr., Craig A. Townsend, Dr.
1Department of Chemistry, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218, USA, Fax: (+1) 410-516-8420
2Southern Regional Research Center, United States Department of Agriculture, 1100 RE Lee Boulevard, New Orleans, LA 70124, USA
... by using the revised sequence re- sulted in an alternative splicing pattern that
translated through the GXCXG motif (FGENESH, http://www.softberry.com, Sup ...
Trends in Plant Science
doi:10.1016/j.tplants.2008.02.009
Diamonds in the rough: mRNA-like non-coding RNAs
Linda A. Rymarquis, James P. Kastenmayer, Alexander G. Huttenhofer and Pamela J. Green
Delaware Biotechnology Institute, University of Delaware, 15 Innovation Way, Newark, DE 19711, USA
213501 Hamlet Square Court, Germantown, MD 20874, USA
3Innsbruck Biocentre, Division of Genomics and RNomics, Innsbruck Medical University, Fritz-Pregl Stra?e 3, 6020 Innsbruck, Austria
... The remaining RNAs are screened for ORFs, using programs such as GeneMark [25],
GenScan [26], Fgenesh (www.softberry.com) or EST scan [27]. ...
Mycological Research
Volume 112, Issue 2, February 2008, Pages 216-224
Processing sites involved in intron splicing of Armillaria natural product genes
Mathias Misieka and Dirk Hoffmeister
Pharmaceutical Biology and Biotechnology, Albert-Ludwigs-Universitat, Stefan-Meier-Strasse 19, 79104 Freiburg, Germany
... For exon/intron identification we used the Aspergillus and Phanerochaete mode
implemented in FGENESH (Softberry, Mount Kisco, NY) and Augustus (Stanke & ...
Current Bioinformatics
Volume 3, Number 2, May 2008 , pp. 87-97(11)
Genome Annotation in Plants and Fungi: EuGene as a Model Platform
Foissac, Sylvain et al.,
... Simultaneously, a specific version of FGenesH was built for M. truncatula
by the SoftBerry company (http://www.- softberry.com/). ...
Mol Biol Evol.
25(5):892-902; doi:10.1093/molbev/msn029
Comparative analysis of the MIR319a microRNA locus in Arabidopsis and related Brassicaceae
Norman Warthmann, Sandip Das, Christa Lanz and Detlef Weigel
Department of Molecular Biology, Genome Center, Max Planck Institute for Developmental Biology, D-72076 Tubingen, Germany
... 2005) and FGENESH (www.softberry.com) were used to predict putative novel ORFs,
and validated using TBLASTN against the NCBI nr database. 6 Page 7. ...
FEMS Yeast Research
Volume 8 Issue 3 Page 432-441, May 2008
The endogenous adrenodoxin reductase-like flavoprotein arh1 supports heterologous cytochrome P450-dependent substrate conversions in Schizosaccharomyces pombe
Kerstin M. Ewen, Burkhard Schiffler, Heike Uhlmann-Schiffler, Rita Bernhardt, Frank Hannemann
Department of Biochemistry, Saarland University, Saarbrucken, Germany; and Department of Medical Biochemistry, Saarland University, Homburg, Germany
... The program fgenesh (http://www.softberry.com) was applied to identify the position
and composition of the arh1 gene as well as to deduce the amino acid ...
Eukaryotic Cell
February 2008, p. 368-378, Vol. 7, No. 2
A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes
A. Gioti et al.,
UMR1290 BIOGER-CPP, INRA, Route de St-Cyr, 78026 Versailles, France
... were improved manually for seven genes, one of which was not predicted by automatic
software Blastx alignment data; FGenesh (http://www.softberry.com) and ...
DNA Research
2008 15(2):93-102; doi:10.1093/dnares/dsn001
Sequence Level Analysis of Recently Duplicated Regions in Soybean [Glycine max (L.) Merr.] Genome
Kyujung Van et al.,
Department of Plant Science, Seoul National University, San 56-1, Sillim-dong, Gwanak-gu, Seoul 151-921, South Korea
... Also, gene annotation was conducted with the web-based gene prediction programs
FGENESH (http://sun1.softberry.com/berry.phtml) and GeneMark (http://exon.gatech ...
Insect Biochemistry and Molecular Biology
Volume 38, Issue 3, March 2008, Pages 331-345
Annotation and expression profiling of apoptosis-related genes in the yellow fever mosquito, Aedes aegypti
Bart Bryanta, Carol D. Blairb, Ken E. Olsonb and Rollie J. Clem
Molecular, Cellular, and Developmental Biology Program, Arthropod Genomics Center, Division of Biology, Ackert Hall, Kansas State University, Manhattan, KS, USA
bArthropod-Borne and Infectious Diseases Laboratory, Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO, USA
... Genscan (http://genes.mit.edu/GENSCAN.html) and fgenesh (http://www.SoftBerry.com)
were used to predict genes and complete missing regions of some EST contigs. ...
Plant Physiology
146:940-951 (2008)
Characterization of the Monoterpene Synthase Gene tps26, the Ortholog of a Gene Induced by Insect Herbivory in Maize
Changfa Lin et al.,
Waksman Institute, Rutgers University, Piscataway, New Jersey 08855 (C.L., B.S., Z.X., H.K.D.); Department of Plant Biology, Rutgers University, New Brunswick, New Jersey 08901 (B.S., Z.X., H.K.D.);
... Analysis of the sequence by the gene-finding program Fgenesh (www.softberry.com)
predicted that, like stc1, tps26 consisted of seven exons. ...
Disease Markers
Volume 24, Number 2 / 2008 Pages 111-117
Analysis of Crohn's disease-related CARD15 polymorphisms in Spanish patients with idiopathic uveitis
N. Rodriguez-Perez, A. Aguinaga-Barrilero, Marina B. Gorrono-Echebarria, Mercedes Perez-Blas, J.M. Marti'n-Villa
Inmunologia, Facultad de Medicina, Universidad Complutense de Madrid, Madrid, Spain
Servicio de Oftalmologia, Hospital Universitario Principe de Asturias, Alcala de Henares, Madrid, Spain
... Analysis carried out with GEN- SCAN (http://genes.mit.edu/GENSCAN.html), FCGENESH
(http://www.softberry.com/berry.phtml) and GRAIL (http://grail.lsd.ornl.gov ...
Crop Sci
48:S-49-S-68 (2008)
Structural Features of the Endogenous CHS Silencing and Target Loci in the Soybean Genome
Jigyasa H. Tuteja and Lila O. Vodkin
Dep. of Crop Sciences, 384 ERML, 1201 W. Gregory Dr., Univ. of Illinois, Urbana, IL 61801.
... For ab initio predictions, FGeneSH with the Medicago truncatula-based training
set (http://www.softberry.com; verified 9 Jan. 2008) was run. ...
Journal of Integrative Plant Biology
Volume 50 Issue 4 Page 466-474, April 2008
Cell-wall Invertases from Rice are Differentially Expressed in Caryopsis during the Grain Filling Stage
Yong-Qin Wang et al.,
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, the Chinese Academy of Sciences, Beijing 100101, China; Graduate School of the Chinese Academy of Sciences, Beijing 100049, China
... Splice site prediction was carried out with programs GENSCAN (http://genes.mit.edu/
GENSCAN.html) and FGENESH (http://www.softberry.com/berry.phtml). ...
Journal of Integrative Plant Biology
Volume 50 Issue 1 Page 62-75, January 2008
Cloning and Expression Analysis of Rice Sucrose Transporter Genes OsSUT2M and OsSUT5Z
Ai-Jun Sun et al.,
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, the Chinese Academy of Sciences, Beijing 100101, China; 2Graduate School of the Chinese Academy of Sciences, Beijing 100049, China
... The ORF of these two potential sucrose transporters were figured out by FGENESH
(http://www.softberry.com/), and primers used for RT-PCRs were designed by ...
Molecular Plant
2008 1(3):471-481; doi:10.1093/mp/ssn014
Mutation of a Gene in the Fungus Leptosphaeria maculans Allows Increased Frequency of Penetration of Stomatal Apertures of Arabidopsis thaliana
Candace E. Elliott, Harjono, and Barbara J. Howlett
School of Botany, The University of Melbourne, Melbourne, Vic 3010, Australia
Current address: Laboratory of Forest Protection, Faculty of Forestry, Gadjah Mada University, Yogyakarta, Indonesia 55281
... using a primer walking strategy. Genes on the cosmid were predicted using
FGENESH software (www.softberry.com). A BLASTp search (www ...
Plant Physiology
146:200-212 (2008)
Recurrent Deletions of Puroindoline Genes at the Grain Hardness Locus in Four Independent Lineages of Polyploid Wheat
Wanlong Li, Li Huang and Bikram S. Gill
Wheat Genetic and Genomic Resources Center, Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506–5502
... Protein-coding genes were predicted using the program FGENESH (http://sun1.softberry.
com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind) with the ...
Genomics
Volume 91, Issue 5, May 2008, Pages 467-475
Improved detection and annotation of transposable elements in sequenced genomes using multiple reference sequence sets
Nicolas Buisinea 1, Hadi Quesneville, 2 and Vincent Colot
Unite' de Recherche en Ge'nomique Ve'ge'tale, INRA UMR1165–CNRS UMR8114–Universite' d'Evry Val d'Essonne, 2 rue Gaston Cre'mieux, 91057 Evry, France
Laboratoire Bioinformatique et Ge'nomique, Institut Jacques Monod, Tour 42, 2 place Jussieu, 75251 Paris, France
... The functional content of each RU sequence was predicted using FGENESH
(http://sun1.softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind ...
Nucleic Acids Research,
2008, Vol. 36, Database issue D298-D302
ChromDB: The Chromatin Database
Karla Gendler, Tara Paulsen and Carolyn Napoli
BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA
... In many cases, we have derived our own transcript models from genomic sequences
using FGNESH or FGENESH+ licensed from Softberry (http://www.softberry.com). ...
Nature Biotechnology
26, 553 - 560 (2008)
Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina)
Diego Martinez et al.,
Los Alamos National Laboratory/Joint Genome Institute, PO Box 1663, Los Alamos, New Mexico 87545, USA.
Novozymes, Inc., 1445 Drew Ave., Davis, California 95618, USA.
... an ab initio gene predictor, Fgenesh 37 , specifically trained for this genome,
and two homology-based gene predictors, Fgenesh+ (http://www.softberry.com) and ...
FGENESH 2007
Genome Res.
17:1389-1398, 2007
Conrad: Gene prediction using conditional random fields
David DeCaprio et al.,
The Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142, USA
... data. Conrad was trained on the entire reference set and Fgenesh was trained
by Softberry (Salamov and Solovyev 2000 Go). Results. ...
PNAS
July 10, 2007 | vol. 104 | no. 28 | 11844-11849
A GeneTrek analysis of the maize genome
Renyi Liu et al.,
Department of Genetics, University of Georgia, Athens, GA 30602; and Department of Agronomy, Iowa State University, Ames, IA 5001
... BAC sequences were first subject to ab initio gene prediction with FGENESH
(www.softberry.com) using the matrix for monocot plants. ...
Antonie van Leeuwenhoek
Volume 91, Number 4 / May, 2007 pp. 373-391
Tagging target genes of the MAT1-2-1 transcription factor in Fusarium verticillioides ( Gibberella fujikuroi MP-A)
Anita Keszthelyi et al.,
Agricultural Biotechnology Center, Szent-Gyorgyi A. u. 4, H-2100 Godollo, Hungary
.. Sequence data were analyzed with the Lasergene (DNAStar Inc., Madison, Wisconsin,
USA) software package and the FGENESH program (www.softberry.com). ...
Genome
Volume 50, Number 6, 1 June 2007 , pp. 595-609(15)
Diversity of the trifunctional histidine biosynthesis gene (his) in cereal Phaeosphaeria species
Wang, Chih-Li et al.,
... acc. No. DQ312266) using the FGENESH program (http://www.softberry.com)
with As- pergillus as the organism parameter (Fig. 1). The ...
Current Genetics
Volume 52, Number 1 / July, 2007 pp. 11-22
Mating-type loci of heterothallic Diaporthe spp.: homologous genes are present in opposite mating-types
Satoko Kanematsu. Yoshihiko Adachi and Tsutae Ito
Apple Research Station, National Institute of Fruit Tree Science, NARO, Shimokuriyagawa, Morioka 020-0123, Japan
, National Agricultural Research Center for Tohoku Region, NARO, Akahira, Morioka 020-0198, Japan
... Genes, introns, exons and transcription initiation sites of Diaporthe W- and G-types
were predicted by analysis with FGENESH (http://www.softberry.com) on N ...
Plant Molecular Biology
Volume 65, Numbers 1-2 / September, 2007 pp. 189-203
Rapid evolution and complex structural organization in genomic regions harboring multiple prolamin genes in the polyploid wheat genome
Shuangcheng Gao et al.,
Key Laboratory of Crop Germplasm & Biotechnology, MOA, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, National Key Facility for Crop Gene Resources and Genetic Improvement, No. 12 South Street, Zhongguancun, Beijing, 100081, P.R. China
... FGENESH (http://www.softberry.com/ nucleo.html) and GENESCAN (http://genemark.
mit.edu/ GENESCAN.htm) were used for gene prediction. ...
Plant Molecular Biology
Volume 65, Number 4 / November, 2007 pp. 439-451
Molecular cloning and expression analysis of a monosaccharide transporter gene OsMST4 from rice ( Oryza sativa L.)
Yongqin Wang et al.,
State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Beijing, 100101, China
... Splice site prediction was per- formed with programs GENSCAN (http://www.genes.mit.
edu/GENSCAN.html) and FGENESH (http://www. softberry.com/berry.phtml). ...
Plant Physiology
145:29-40 (2007)
Chlorophyll-Deficient Rice Mutant with Impaired Chlorophyllide Esterification in Chlorophyll Biosynthesis
Ziming Wu et al.,
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing 210095, China (Z.W., B.H., L.J., C.W., J.W.);
... 2, B and C). Within this region, two open reading frames (ORFs) were predicted
using the program FGENESH 2.2 (www.softberry.com). ...
TAG Theoretical and Applied Genetics
Volume 115, Number 2 / July, 2007 pp. 159-168
Physical mapping and identification of a candidate for the leaf rust resistance gene Lr1 of wheat
Ji-Wen Qiu et al.,
State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 100101, China
... tauschii lines were translated into protein sequences using the online gene prediction
program Fgenesh (http://sunl.Softberry.com/cgi-bin/programs/gWnd/ Fgenesh ...
Fungal Genetics and Biology
Volume 44, Issue 10, October 2007, Pages 1002-1010
Comparison of loline alkaloid gene clusters across fungal endophytes: Predicting the co-regulatory sequence motifs and the evolutionary history
Brandi L. Kutil et al.,
Department of Plant Pathology and Microbiology, Texas A&M University (2132), College Station, TX 77843-2132, USA
.. of coding sequences based on previously identified cDNAs ([Spiering et al., 2002]
and [Spiering et al., 2005]) and FGENESH (http://www.softberry.com/berry.phtml ...
Peptides
Volume 28, Issue 6, June 2007, Pages 1282-1291
Neuropeptide precursors in Tribolium castaneum
Andinet Amare and Jonathan V. Sweedler
Department of Chemistry and The Institute of Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, United States
... The FGENESH version 2.5 (www.softberry.com) and Augustus version 1.8.2
(http://augustus.gobics.de/submission) gene prediction programs were used to predict ...
Mol. BioSyst.,
2007, 3, 794 - 802, DOI: 10.1039/b705803a
Distinctive expression and functional regulation of the maize (Zea mays L.) TOR kinase ortholog
Lourdes Teresa Agredano-Moreno, Homero Reyes de la Cruz, Leon Patricio
Martinez-Castilla and Estela Sanchez de Jimenez
... OsTOR was obtained with the Gene Builder system (http://www.itba.mi.cnr.it/webgene)
and confirmed with the FGENESH 2.4 program from the Softberry webpage (http ...
Plant Physiology and Biochemistry
Volume 45, Issue 1, January 2007, Pages 6-14
Computational identification and phylogenetic analysis of the MAPK gene family in Oryza sativa
Qingpo Liu and Qingzhong Xue
Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, No 268, Kaixuan Road, Hangzhou, Zhejiang 310029, China
... Redundant hits were removed by manual inspection. Gene structure prediction was
performed using the online web server FGENESH (http://www.softberry.com). 2.2. ...
Fungal Genetics and Biology
Volume 44, Issue 5, May 2007, Pages 415-429
Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum
Ioannis Stergiopoulos et al.,
Laboratory of Phytopathology, Wageningen University and Research Centre, Binnenhaven 5, 6709 PD Wageningen, The Netherlands
... Barcelona, Spain) and the FEX (Solovyev et al., 1994) and FGENESH (Salamov and Solovyev,
2000) programs from the MOLQUEST software package (Softberry Inc. ...
Nucleic Acids Research
(2007), doi:10.1093/nar/gkm768
ChromDB: The Chromatin Database
Karla Gendler, Tara Paulsen and Carolyn Napoli
BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA
... In many cases, we have derived our own transcript models from genomic sequences
using FGNESH or FGENESH+ licensed from Softberry (http://www.softberry.com). ...
Microbiology
153 (2007), 3409-3416;
A 7-dimethylallyltryptophan synthase from Aspergillus fumigatus: overproduction, purification and biochemical characterization
Anika Kremer, Lucia Westrich and Shu-Ming Li
Heinrich-Heine-Universitat Dusseldorf, Institut fur
Pharmazeutische Biologie und Biotechnologie, Universitatsstrasse 1, D-40225 Dusseldorf, Germany,
Eberhard-Karls-Universitat Tubingen, Pharmazeutische Biologie, Auf der Morgenstelle 8, D-72076
Tubingen, Germany
... FGENESH (Softberry; www.softberry.com/berry.phtml) and the DNASIS software package
(version 2.1; Hitachi Software Engineering) were used for intron prediction ...
General and Comparative Endocrinology
Volume 153, Issues 1-3, August-September 2007, Pages 59-63
Evolutionary conservation of bursicon in the animal kingdom
Tom Van Loy et al.,
Animal Physiology and Neurobiology, Laboratory for Developmental Physiology, Genomics and Proteomics, Zoological Institute, K.U.Leuven, Naamsestraat 59, B-3000, Belgium
... ncbi.nih.gov/gorf) and, in addition, were conducted to the gene prediction program
FGENESH based on hidden markov models, available on http://www.softberry.com ...
Fungal Genetics and Biology
Volume 44, Issue 2, February 2007, Pages 77-87
Extracellular oxidative systems of the lignin-degrading Basidiomycete Phanerochaete chrysosporium
Phil Kersten and Dan Cullen
Forest Products Laboratory, USDA, One Gifford Pinchot Drive, Madison, WI 53705, USA
... Predictions were based on ab initio methods Fgenesh (Salamov and Solovyev, 2000),
homology-based methods, Fgenesh+ (www.softberry.com) and Genewise (Birney and ...
Molecular Plant Pathology
Volume 8 Issue 1 Page 111-120, January 2007
Isolation and characterization of the mating type
locus of Mycosphaerella fijiensis, the causal agent of
black leaf streak disease of banana
LAURA CONDE-FERRAEZ et al.,
Centro de Investigacion Cientifica de Yucatan (CICY), Calle 43 no. 130, Chuburna
de Hidalgo, C.P. 97200, Merida, Yucatan, Mexico
... Identification of open reading frames (ORFs) and gene predictions were performed
using FGENESH and FGENESH+ software (SoftberryTM, http:/ / www.softberry.com ...
Chinese Science Bulletin
Volume 52, Number 7 / April, 2007 pp. 903-911
Genetic and physical mapping of AvrPi7 , a novel avirulence
gene of Magnaporthe oryzae using physical position-ready markers
Feng ShuJie, Wang Ling, Ma JunHong, Lin Fei and Pan QingHua
Laboratory of Plant Resistance and Genetics, College of Natural Resources and Environmental Science, South China Agricultural University, Guangzhou, 510642, China
Laboratory of Plant Protection, College of Horticulture, South China Agricultural University, Guangzhou, 510642, China
... for fine mapping of the Avr gene locus based on the se- quence of the candidate
genes predicted using the gene annotation system Softberry FGENESH (http://www. ...
Plant Molecular Biology
Volume 64, Number 5 / July, 2007 589-600
New insights into Oryza genome evolution: high gene colinearity
and differential retrotransposon amplification
Shibo Zhang et al.,
(1) Department of Plant and Microbial Biology, University of California, Berkeley, CA 94720, USA
... BLASTN, BLASTX, and TBLASTX against TIGR’s Rice Gene Indices database and NCBI’s
nonredundant and dbEST databases; FGENESH (http:// www.softberry.com/nucleo ...
DNA AND CELL BIOLOGY
Volume 26, Number 6, 2007 Pp. 369-385
Genomics, Evolution, and Expression of TBPL2,
a Member of the TBP Family
CINZIA DI PIETRO et al.,
Dipartimento di Scienze Biomediche-Unita` di Biologia Genetica e BioInformatica, Universita` di Catania, Catania, Italy, EU.
Genomic sequences
were analyzed using several gene prediction tools
(GPTs): Genescan (http://genes.mit.edu/GENSCAN.html),
GeneMark (http://opal.biology.gatech.edu/GeneMark/index
.html), FGENESH (http://www.softberry.com/berry.phtml?topic
=gfind&prg=FGENESH),
Chinese Science Bulletin
Volume 52, Number 7 / April, 2007 912-921
Rapid genome evolution in Pms1 region of rice revealed by comparative sequence analysis
Yu JinSheng et al.,
National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan, 430070, China
... For gene prediction, the sequences were ana- lyzed with several gene prediction
programs including FGENESH (monocot training set, http://www.softberry. ...
Journal of Integrative Plant Biology
Volume 49 Issue 5 Page 655-663, May 2007
The 6-phosphogluconate Dehydrogenase Genes Are Responsive to Abiotic Stresses in Rice
Fu-Yun Hou, Ji Huang, Shan-Lin Yu and Hong-Sheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
... One assembled cDNA sequence containing a complete ORF (opening reading frame) of
1 524 bp was obtained using the FGENESH program (http://www.softberry.com) and ...
Molecular Plant Pathology
Volume 8 Issue 3 Page 307-319, May 2007
Molecular and cytological responses of Medicago truncatula
to Erysiphe pisi
DAWN FOSTER-HARTNETT et al.,
Department of Plant Pathology, University of Minnesota, 495 Borlaug Hall, St Paul, MN 55108, USA
... BAC sequences with > 98% identity were collected, corresponding coding regions were
predicted using FGENESH software (http://www.softberry.com), and the 1.5-kb ...
Plant Science
Volume 172, Issue 4, April 2007, Pages 708-721
Genome-wide analysis and identification of genes related to
potassium transporter families in rice (Oryza sativa L.)
R. Naga Amruthaa, P. Nataraj Sekhara, Rajeev K. Varshneyb and P.B. Kavi Kishora,
aDepartment of Genetics, Osmania University, Hyderabad 500007, India
bInternational Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru 502325, India
... and Karlin, 1997; http:// genes.mit.edu/GENSCAN.html), GenomeScan [30];
http://genes.mit.edu/ genomescan.html), FGENESH [31]; http://www.softberry.com/berry ...
Molecular Biology and Evolution, 2007, doi:10.1093/molbev/msm116
PIF-like Transposons Are Common in Drosophila and Have Been Repeatedly Domesticated to Generate New Host Genes
Claudio Casola, A. Michelle Lawing, Esther Betran and Cedric Feschotte
Department of Biology University of Texas, Arlington
... The structure of each DPLG coding sequence was initially predicted using FGENESH
(http://www.softberry.com/berry.phtml) and refined by multialignment with ...
Journal of Virology,
June 2007, p. 6491-6501, Vol. 81, No. 12
Genomic and Morphological Features of a Banchine
Polydnavirus: Comparison with Bracoviruses and Ichnoviruses
Renee Lapointe et al.,
Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 du PEPS, Quebec, Quebec G1V 4C7, Canada
... html), the Gene Construction Kit 2 program (Texco Inc.), Genchek v. 2061 (Ocimum
Biosolutions), and FGENESH, with the Apis mellifera settings (www.softberry.com ...
The Plant Journal
Volume 49 Issue 2 Page 173-183, January 2007
Characterization of the centromere and peri-centromere retrotransposons
in Brassica rapa and their distribution in related Brassica species
Ki-Byung Lim et al.,
1School of Applied Biosciences, College of Agriculture and Life Sciences, Kyungpook National University, Daegu 702-701, Korea,
2Department of Plant Science, College of Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Korea,
... Gene annotation was achieved using the web-based gene prediction program FGENE-SH
Arabidopsis ( http:/ / www.softberry.com/ berry.phtml ). Sequence analysis. ...
Journal of Molecular Evolution
Volume 64, Number 3 / March, 2007 354-363
Molecular Phylogeny, Evolution, and Functional Divergence of the
LSD1-Like Gene Family: Inference from the Rice Genome
Qingpo Liu 1 and Qingzhong Xue 1
(1) Department of Agronomy, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, 310029, P. R. China
... The FGENESH software (http://www.softberry.com) was used to predict the
intron/exon structure of putative rice LSD1-like genes. ...
BMC Microbiology
2007, 7:61 doi:10.1186/1471-2180-7-61
Structure and evolution of a proviral locus of
Glyptapanteles indiensis bracovirus
Christopher A Desjardins et al.,
The Institute for Genomic Research, a division of J. Craig Venter Institute, Rockville, Maryland, USA
...A combination of Softberry's FGENESH trained on the honey bee (Apis mellifera) and the Beijing Genome Institute's BGF trained on the silkmoth (Bombyx mori) were most accurate ...
...Gene models were generated with a variety of software: Softberry's FGENESH [77] using both the honey bee (Apis mellifera) and fruit fly (Drosophila melanogaster) training sets,...
PNAS
| May 1, 2007 | vol. 104 | no. 18 | 7705-7710
The tiny eukaryote Ostreococcus provides genomic insights into the paradox of plankton speciation
Brian Palenik et al.,
aScripps Institution of Oceanography, University of California at San Diego, La Jolla, CA 92093-0202; cJoint Genome Institute and Stanford Human Genome Center, Stanford University School of Medicine, 975 California Avenue, Palo Alto, CA 94304;
... Gene prediction methods used for annotation of two Ostreococcus genomes included
ab initio Fgenesh (40), homology-based Fgenesh+ (SoftBerry), Genewise (41 ...
Nature Biotechnology
25, 319 - 326 (2007)
Published online: 4 March 2007 | doi:10.1038/nbt1290
Genome sequence of the lignocellulose-bioconverting and
xylose-fermenting yeast Pichia stipitis
Thomas W Jeffries et al.,
US Department of Agriculture, Forest Service, Forest Products Laboratory, One Gifford Pinchot Drive, Madison, Wisconsin 53705, USA.
Department of Bacteriology, University of Wisconsin-Madison, 420 Henry Mall, Madison, Wisconsin 53706, USA.
... Gene prediction methods used for analysis of the P. stipitis genome include ab initio
Fgenesh 44 , homology-based Fgenesh+ (http://www.softberry.com/) and ...
Functional & Integrative Genomics
Volume 7, Number 1 / January, 2007 17-35
Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes
Nagendra K. Singh et al.,
Rice Genome Laboratory, National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India
... Gene prediction was performed on individual BAC/PAC clones using FGENESH trained
for monocot species (http://www.softberry.com) (Salamov and Solovyev 2000). ...
Molecular Microbiology
Volume 64 Issue 3 Page 755-770, May 2007
Molecular analysis of the cercosporin biosynthetic gene
cluster in Cercospora nicotianae
Huiqin Chen, Miin-Huey Lee, Margret E. Daub, Kuang-Ren Chung
Citrus Research and Education Center, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA.
... positions were deduced from comparisons of genomic and cDNA sequences and/or predicted
using the fgenesh gene-finding software at http://www.softberry.com. ...
Plant Physiology
144:623-636 (2007)
Molecular Evolution of Lysin Motif-Type Receptor-Like Kinases in Plants
Xue-Cheng Zhang et al.,
Division of Plant Sciences and National Center for Soybean
Biotechnology (X.-C.Z., X.W., S.F., J.W., M.L., H.T.N., G.S.)
and Division of Biochemistry, Department of Molecular Microbiology and
Immunology (G.S.), University of Missouri, Columbia, Missouri 65211;
and United States Department of Agriculture-Agricultural Research
Service and Department of Agronomy, Iowa State University, Ames, Iowa 50011 (S.B.C.)
... Center. BAC sequences were annotated using the dicot species model and
Arabidopsis matrix of FGENESH (www.softberry.com). Annotated ...
FGENESH 2006
Nature
443, 931 - 949 (26 Oct 2006)
Insights into social insects from the genome of the honeybee Apis mellifera
The Honeybee Genome Sequencing Consortium
...to produce a master gene list: the Official Gene Set (OGS). The component gene sets
were from NCBI, Ensembl, Softberry (Fgenesh), an evolutionarily conserved
core set and a set based on Drosophila orthologues (Supplementary...
PNAS
| October 24, 2006 | vol. 103 | no. 43 | 15794-15799
Vitamin K-dependent proteins in Ciona intestinalis,
a basal chordate lacking a blood coagulation cascade
John D. Kulman*, Jeff E. Harris*, Noriko Nakazawa, Michio Ogasawara, Masanobu Satake, and Earl W. Davie*,
*Department of Biochemistry, University of Washington, Seattle, WA 98195; Department of Biology, Faculty of Science, Chiba University, Chiba 263-8522, Japan; and Institute of Development, Aging, and Cancer, Tohoku University, Sendai 980-8575, Japan
... scaffolds. The resulting sequences were analyzed for probable intron/exon
boundaries with FGENESH (Softberry, Mount Kisco, NY). ...
TAG Theoretical and Applied Genetics
Volume 113, Number 6 / October, 2006 1147-1158
The barley serine/threonine kinase gene Rpg1 providing
resistance to stem rust belongs to
a gene family with five other members encoding kinase domains
R. Brueggeman 1 , T. Drader 2 and A. Kleinhofs 1, 2
(1) Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420, USA
(2) School of Molecular Biosciences, Washington State University, Pullman, WA 99164-4234, USA
... gene struc- tures were predicted by sequence comparison with the Rpg1 cDNA sequence
and using the FGENESH gene prediction program (http://www.softberry.com). ...
Annual Review of Phytopathology
Vol. 44: 337-366 (Volume publication date September 2006)
The Dawn of Fungal Pathogen Genomics
Jin-Rong Xu,1 You-Liang Peng,2 Martin B. Dickman,3 and Amir Sharon4
1Department of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 47907
... at the Broad Institute, gene structures are predicted using the Calhoun annotation
system that is a combination of FGENESH (http://www.softberry.com),
FGENESH+ ...
Insect Molecular Biology
Volume 15 Issue 5 Page 597-602, October 2006
Expression of insulin pathway genes during the period of caste
determination in the honey bee, Apis mellifera
D. E. Wheeler, N. Buck, J. D. Evans
Department of Entomology, University of Arizona, Tucson AZ USA, USDA ARS, Bee Research Laboratory, Beltsville, MD 20705 USA
... Primers were designed based on cDNA sequences from the official gene list or on
the basis of FGENESH ( http:/ / www.softberry.com ) predictions of genomic ...
BMC Genomics.
2006; 7: 321
Quantitative analysis of cell-type specific gene expression in the
green alga Volvox carteri
Ghazaleh Nematollahi,#1 Arash Kianianmomeni,#1 and Armin Hallmann1
1Department of Cellular and Developmental Biology of Plants, University of Bielefeld, Universitatsstr. 25, D-33615 Bielefeld, Germany
...Exon-intron prediction of Volvox genes was done using
FGENESH software (Softberry, Mount Kisco, NY) and by polypeptide
sequence comparisons with homologs from other organisms using ...
Developmental Biology
300 (2006) 2-8
Shedding genomic light on Aristotle's lantern
Erica Sodergren et al.,
Human Genome Sequencing Center, Baylor College of Medicine, One Baylor Plaza, Alkek N1519, Houston, TX 77030, USA
...using software developed at Ensembl (Potter
et al., 2004; Sea Urchin Genome Sequencing Consortium,
2006) and installed at BCM-HGSC, NCBI (gnomon software;
Souvorov et al., 2004), Softberry (FgenesH software; Salamov
and Solovyev, 2000; Solovyev, 2001),...
Genetics.
2006 November; 174(3): 1493 - 1504.
Types and Rates of Sequence Evolution at the High-Molecular-Weight Glutenin Locus in Hexaploid Wheat and Its Ancestral Genomes
Yong Qiang Gu et al.,
United States Department of Agriculture-Agricultural Research Service, Western Regional Research Center, Albany, California 94710
...FGENESH (http://www.softberry.com/nucleo.html) and GENESCAN (http://genemark.mit.edu/GENESCAN.htm) were used for gene prediction...
DNA Sequence,
Volume 17, Issue 3 June 2006 , pages 223 - 230
Isolation and characterization of the RanGAP gene in the mosquito Aedes aegypti
Sung-Jae Cha a; Neil Lobo b; Becky Debruyn b; David W. Severson b
a Department of Molecular Microbiology and Immunology, Johns Hopkins School of Public Health, Malaria Research Institute. Baltimore, MD. USA
b Department of Biological Sciences, Center for Tropical Disease Research and Training, University of Notre Dame. Notre Dame, IN. USA
... submitted to two gene finding programs: GENSCAN (http://genes.mit.edu/ GENSCAN.html)
using the vertebrate database and FGENESH (http://www.softberry.com/berry ...
Molecular Plant Pathology
Volume 7 Issue 6 Page 485-497, November 2006
The global nitrogen regulator, FNR1, regulates fungal nutrition-genes
and fitness during Fusarium oxysporum pathogenesis
HEGE HVATTUM DIVON, CARMIT ZIV, OLGA DAVYDOV, ODED YARDEN, ROBERT FLUHR
1Department of Plant Science, Weizmann Institute of Science, 76100 Rehovot, Israel
... The sequence was, in the Softberry gene prediction database ( http:/ /
www.softberry.com/ berry.phtml ; FGENESH), predicted to contain an open reading ...
Genetics.
2006 October; 174(2): 1017-1028.
Sequence Conservation of Homeologous Bacterial Artificial Chromosomes
and Transcription of Homeologous Genes in Soybean (Glycine max L. Merr.)
Jessica A. Schlueter,* Brian E. Scheffler, Shannon D. Schlueter,* and Randy C. Shoemaker‡1
*Department of Genetics, Developmental and Cellular Biology, Iowa State University, Ames, Iowa 50011, USDA-ARS MSA Genomics Laboratory, Stoneville, Mississippi 38776 and ‡USDA-ARS-CICGR, Ames, Iowa 50011
... Genscan with Arabidopsis thaliana-based parameters (Burge and Karlin 1997), FgeneSH
with Medicago truncatula-based parameters (http://www.softberry.com) and ...
Applied and Environmental Microbiology,
October 2006, p. 6527-6532, Vol. 72, No. 10
The Homologue of het-c of Neurospora crassa
Lacks Vegetative Compatibility Function in Fusarium proliferatum
Zoltan Kerenyi,1 Brigitta Olah,1,2 Apor Jeney,1 Laszlo Hornok,1,2 and John F. Leslie3*
Agricultural Biotechnology Center, Szent-Gyorgyi A. u. 4., H-2100 Godoll,
Hungary,
1 Department of Agricultural Biotechnology and Microbiology, Mycology Group,
Hungarian Academy of Sciences, Szent Istvan University, Pater K. u. 1., H-2103 Godoll,
Hungary,
2 Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University, Manhattan, Kansas 66506-55023
... Sequence data were analyzed with the Lasergene software package (DNAStar Inc., Madison,
Wis.) and the FGENESH program (http://www.softberry.com). ...
Genetics
2006 November; 174(3): 1671 - 1683
Genetic Dissection of Intermated Recombinant Inbred Lines Using a New Genetic Map of Maize
Yan Fu et al.,
*Interdepartmental Genetics Graduate Program, Iowa State University, Ames, Iowa 50011, Department of Agronomy, Iowa State University, Ames, Iowa 50011
... 2004) alignments between genomic and EST sequences or predicted using FGENESH
(http://www.softberry.com) as described (Yao et al. 2005). ...
ChemBioChem
2006 Volume 7, Issue 1 , Pages 158 - 164
Reverse Prenyltransferase in the Biosynthesis of Fumigaclavine C in
Aspergillus fumigatus: Gene Expression, Purification, and Characterization of Fumigaclavine C Synthase FGAPT1
Inge A. Unsold, Shu-Ming Li, Priv. Doz. Dr. *
Eberhard-Karls-Universitat Tubingen, Pharmazeutische Biologie, Auf der Morgenstelle 8, 72076 Tubingen, Germany,
... FGENESH (Softberry, Inc., www.softberry.com/berry.phtml) and the DNASIS software
package (version 2.1: Hitachi Software Engineer- ing, San Bruno, CA) were used ...
Fungal Genetics and Biology
43 (2006) 316-325
Development of a Fusarium graminearum AVymetrix GeneChip for
proWling fungal gene expression in vitro and in planta
Ulrich Guldener et al.,
Technische Universität Munchen, Chair of Genome Oriented Bioinformatics, Center of Life and Food Science,
D-85350 Freising-Weihenstephan, Germany
... to the automatically pre- dicted set from the Broad Institute, a second automatic
gene call set was developed at MIPS using FGENESH (www.softberry.com) with a ...
The Journal of Clinical Endocrinology & Metabolism
2006 Vol. 91, No. 11 4587-4592
Identification of Three Novel Mutations in the GATA3
Gene Responsible for Familial Hypoparathyroidism and Deafness
in the Chinese Population
Wei-Yih Chiu, Huan-Wen Chen, Hwei-Wen Chao, Lee-Tzong Yann and Keh-Sung Tsai
Departments of Laboratory Medicine (W.-Y.C., H.-W.Cha, K.-S.T.) and Internal Medicine (W.-Y.C., L.-T.Y, K.-S.T.), National Taiwan University Hospital, Taipei 100, Taiwan; and Department of Internal Medicine (H.-W.Che), Lo-Tung Pohai Hospital, Ilan 256, Taiwan
... is useful. We used the FGENESH program (www.softberry.com) based on the
consensus sequence of exon-intron junctions (ag ... gt rule ...
CURRENT SCIENCE
VOL. 91, NO. 4, 25 AUGUST 2006 510-515
Bioinformatics approach toward
identification of candidate genes for
zinc and iron transporters in maize
R. S. Chauhan
Bioinformatics Centre, Advanced Centre of Hill Bioresources and
Biotechnology, CSK HP Agricultural University,
Palampur 176 062, India
... using gene prediction algorithms of FGenesH 18 (http://www.softberry.com/
berry.phtml? topic= fgenesh&group=programs&subgroup=gfind ...
Acta Biochimica et Biophysica Sinica
Volume 38, Number 11, November 2006 , pp. 812-820(9)
Sequencing and Analysis of a Genomic Fragment
Provide an Insight into the Dunaliella viridis Genomic Sequence
SUN, Xiao-Ming et al.,
Shanghai Key Laboratory of Bio-energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444, China
... Gene prediction was carried out using GENSCAN (http://genes.mit.edu/GENSCAN.
html) and FGENESH (http://www.softberry.com/berry.html). ...
Functional & Integrative Genomics
Volume 6, Number 4 / October, 2006 pp. 338-341
Drought tolerance genes in rice
Huazong Zeng, Yang Zhong and Lijun Luo
Institute of Biodiversity Science, School of Life Sciences, Fudan University, Shanghai, 200433, People’s Republic of China
Shanghai Agro-Biological Gene Center, Shanghai, 201106, People’s Republic of China
... ncbi.nih.gov/) through BLAST. After this, Fgenesh soft- ware (http://www.
softberry.com) was used to predict candidate genes. All ...
Genome
Volume 49, Number 3, 1 March 2006, pp. 209-218(10)
Molecular structure and organization of the wheat genomic manganese superoxide dismutase gene
Baek, Kwang-Hyun; Skinner, Daniel Z.; Ling, Peng; Chen, Xianming
... softberry.com/berry.phtml?topic=fgenesh&group=programs&subgroup=gfind; Salamov
and Solovyev 2000) and GeneScan (http://genes.mit.edu/GENSCAN. ...
Nucleic Acids Research
2006 34(17):4685-4701
Organization of chromosome ends in the rice blast
fungus, Magnaporthe oryzae
Cathryn Rehmeyer et al.,
Department of Plant Pathology, University of Kentucky Lexington, KY 40546 USA
... The masked sequences were then used for gene prediction with Fgenesh (67) trained
on M.oryzae sequences (Softberry, www.softberry.com). ...
TAG Theoretical and Applied Genetics
Volume 113, Number 5 / September, 2006 pp.875-883
Identification and fine mapping of AvrPi15,
a novel avirulence gene of Magnaporthe grisea
Jun-Hong Ma et al.,
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China
... out with the CAG markers, which were developed based on the sequence of the candidate
genes predicted using the gene annotation system, Softberry FGENESH ...
The Plant Cell
18:1339-1347 (2006)
Sequence-Level Analysis of the Diploidization Process in the Triplicated FLOWERING LOCUS C Region of Brassica rapa
Yang et al.,
Brassica Genomics Team, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441-707, Korea
... Gene annotation was achieved using the web-based gene prediction program
FGENESH Arabidopsis (http://www.softberry.com/berry.phtml). ...
Genome Research
16:618-626, 2006
Haplotype variation in structure and expression of a gene cluster associated with a quantitative trait locus for improved yield in rice
He et al.,
State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, China
... 1997 Go) programs. Sequence analysis and gene prediction were performed by using
the gene-finding programs FGENESH (http://www.softberry.com/berry.phtml). ...
Molecular Genetics and Genomics
Volume 275, Number 5 / May, 2006 pp. 450-459
Master: a novel family of PIF/Harbinger-like transposable elements identified in carrot (Daucus carota L.)
Dariusz Grzebelus, Yuan-Yeu Yau and Philipp W. Simon
Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, 31-425 Krakow, Poland
USDA-ARS Vegetable Crops Research Unit and Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI 53706, USA
... ORF and exon/intron localization were predicted using GenScan (URL: http://www.genes.
mi- t.edu/GENSCAN.html) and FGenesh (URL: http:// www.softberry.com). ...
Planta
Volume 223, Number 6 / May, 2006 pp. 1134-1144
Identification and characterization of an Arabidopsis homogentisate phytyltransferase paralog
Venkatesh et al.
Monsanto Company, 800 N. Lindbergh Boulevard, St. Louis, MO 63167, USA
... http://hmmer.wustl.edu/). Gene prediction software FGENESH was procured
from Softberry Inc., NY, USA. Dicot model provided with ...
Development Genes and Evolution
Volume 216, Number 4 / April, 2006 pp. 198-208
A comparative study of sperm morphology, cytology and activation in
Caenorhabditis elegans, Caenorhabditis remanei and Caenorhabditis briggsae
Geldziler et al.
Department of Genetics, Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA
... The genome sequence around the sequence thus identified was used as an input for
the gene prediction algorithms FGeneSH (http://www.softberry.com/berry. ...
Mol. Ecol.
Volume 15 Issue 5 Page 1367 -1378. April 2006
Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa
Gilchrist et al.
Department of Botany, University of British Columbia, Vancouver, BC, Canada V6T 1Z4
... Gene models were predicted using fgenesh (Salamov & Solovyev 2000) through
the Softberry website ( http:/ / www.softberry.com ). ...
Genome Research
16:618-626, 2006
Haplotype variation in structure and expression of a gene cluster associated with a quantitative
trait locus for improved yield in rice
Guangming He et al.
1 State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433, China;
... 1997 Go) programs. Sequence analysis and gene prediction were performed by using
the gene-finding programs FGENESH (http://www.softberry.com/berry.phtml). ...
The Plant Cell
18:1339-1347 (2006)
Sequence-Level Analysis of the Diploidization Process in the Triplicated FLOWERING LOCUS C
Region of Brassica rapa[W],[OA]
Tae-Jin Yanga et al.
a Brassica Genomics Team, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441-707, Korea
... Gene annotation was achieved using the web-based gene prediction program
FGENESH Arabidopsis (http://www.softberry.com/berry.phtml). ...
Medical Mycology
Publisher: Taylor & Francis
Issue: Volume 44, Number 3 / May 2006
Pages: 211 - 218
The role of the sakA (Hog1) and tcsB (sln1) genes in the oxidant adaptation of Aspergillus fumigatus
Chen Du A1, Jacqueline Sarfati A2, J-P Latge A2, Richard Calderone A1
A1 Department of Microbiology & Immunology, Georgetown University Medical Center, Washington, DC, USA
A2 Aspergillus Unit, Institut Pasteur, Paris, France
... tcsB gene and phenotype of the deletion mutant DNA sequence analysis of tcsB
(gene-finding software FGENESH. WWW.softberry.com) revealed a long Fig. ...
Molecular Genetics and Genomics
Issue: Volume 275, Number 5
Date: May 2006
Pages: 504 - 511
A complete physical map of a wild beet (Beta procumbens) translocation in sugar beet
Daniela Schulte1, Daguang Cai1, Michael Kleine1, 2, Longjiang Fan1, 3, Sheng Wang1, 3 and Christian Jung1
(1) Plant Breeding Institute, Christian-Albrechts-University Kiel, Olshausenstr. 40, 24098 Kiel, Germany
(2) Present address: PLANTON GmbH, Am Kiel-Kanal 44, 24106 Kiel, Germany
(3) Institute of Bioinformatics and Institute of Crop Science, Zhejiang University, 310029 Hangzhou, China
... An ab initio ORF-analysis with the FgeneSH program on http://www.sun1.softberry.
com was performed to iden- tify putative coding regions using the A. thaliana ...
Molecular Genetics and Genomics
Issue: Volume 275, Number 5
Date: May 2006
Pages: 450 - 459
Master: a novel family of PIF/Harbinger-like transposable elements identified in carrot (Daucus carota L.)
Dariusz Grzebelus1, Yuan-Yeu Yau2, 3, 4 and Philipp W. Simon2
(1) Department of Genetics, Plant Breeding and Seed Science, Agricultural University of Krakow, 31-425 Krakow, Poland
... ORF and exon/intron localization were predicted using GenScan (URL: http://www.genes.
mi- t.edu/GENSCAN.html) and FGenesh (URL: http:// www.softberry.com). ...
Development Genes and Evolution
Issue: Volume 216, Number 4
Date: April 2006
Pages: 198 - 208
A comparative study of sperm morphology, cytology and activation in
Caenorhabditis elegans, Caenorhabditis remanei and Caenorhabditis briggsae
Brian Geldziler1, Indrani Chatterjee1, Pavan Kadandale1, Emily Putiri1, Rajesh Patel2 and Andrew Singson1
(1) Department of Genetics, Waksman Institute, Rutgers University, Piscataway, NJ 08854, USA
(2) Department of Pathology, Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA
... The genome sequence around the sequence thus identified was used as an input for
the gene prediction algorithms FGeneSH (http://www.softberry.com/berry. ...
Planta
Issue: Volume 223, Number 6
Date: May 2006
Pages: 1134 - 1144
Identification and characterization of an Arabidopsis homogentisate phytyltransferase paralog
Tyamagondlu V. Venkatesh1, Balasulojini Karunanandaa1, Daniel L. Free2, Jeannie M. Rottnek2, Susan R. Baszis2 and Henry E. Valentin3
(1) Monsanto Company, 800 N. Lindbergh Boulevard, St. Louis, MO 63167, USA
... http://hmmer.wustl.edu/). Gene prediction software FGENESH was procured
from Softberry Inc., NY, USA. Dicot model provided with ...
TAG Theoretical and Applied Genetics
Issue: Volume 112, Number 6
Date: April 2006
Pages: 1179 - 1191
Molecular cytogenetics and DNA sequence analysis of an apomixis-linked BAC in
Paspalum simplex reveal a non pericentromere location and partial microcolinearity with rice
Ornella Calderini1, Song B. Chang2, 6, Hans de Jong2, Alessandra Busti1, Francesco Paolocci1, Sergio Arcioni1, Sacco C. de Vries3, Marleen H. C. Abma-Henkens4, Rene M. Klein Lankhorst4, Iain S. Donnison5 and Fulvio Pupilli1
(1) Institute of Plant Genetics CNR, Perugia via della madonna alta 130, 06128 Perugia, Italy
... Gene structure and predicted protein sequences were obtained from assembled contigs
using the FGENESH program at the SoftBerry site (http://www.softberry.com ...
ChemBioChem
2006, Volume 7, Issue 1 , Pages 158 - 164
Reverse Prenyltransferase in the Biosynthesis of Fumigaclavine C in Aspergillus fumigatus: Gene Expression, Purification, and Characterization of Fumigaclavine C Synthase FGAPT1
Inge A. Unsold, Shu-Ming Li, Priv. Doz. Dr.
Eberhard-Karls-Universitat Tubingen, Pharmazeutische Biologie, Auf der Morgenstelle 8, 72076 Tubingen, Germany, Fax: (+49) 7071-29-5250;
... FGENESH (Softberry, Inc., www.softberry.com/berry.phtml) and the DNASIS software
package (version 2.1: Hitachi Software Engineer- ing, San Bruno, CA) were used ...
Genetics
Genetics, Vol. 173, 131-149, May 2006
Searching for neuronal left/right asymmetry:
Genome wide analysis of nematode receptor-type guanylyl cyclases
Christopher O. Ortiz et.al.,
Howard Hughes Medical Institute
Department of Biochemistry and Molecular Biophysics
Columbia University Medical Center
701 W.168th Street
New York, NY 10032
... Wormbase WS149), we suspected that C. briggsae genes may have been incorrectly
predicted. We therefore ran the FGENESH program at www.softberry.com (S ALAMOV ...
Genome Biology
2006, 7:R16 doi:10.1186/gb-2006-7-2-r16
The role of transposable element clusters in genome evolution and loss of synteny in the rice blast fungus Magnaporthe oryzae
Michael R Thon et al.,
Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843, USA
The gene prediction program FGENESH
(Softberry Corporation, Mount Kisco, NY, USA) trained to predict M. oryzae genes [3] was used to identify 1,151 putative gene coding sequences.
Genetics
Published Articles Ahead of Print, published on February 19, 2006 as 10.1534/genetics.105.054791
Distribution of microsatellites in the genome of Medicago truncatula: A resource of genetic
markers that integrate genetic and physical maps.
Jeong-Hwan Mun et al.,
Department of Plant Pathology, University of California, Davis, CA, USA.
... Gene-coding regions were predicted in M. truncatula using the eudicot version of
FGENESH (www.softberry.com). BAC-end sequences were divided into gene- ...
Theor Appl Genet
(2006)
DOI 10.1007/s00122-005-0201-2
Development of four phylogenetically-arrayed BAC libraries and sequence
of the APA locus in Phaseolus vulgaris
James Kami, Vale´ rie Poncet, Vale´ rie Geffroy,
Paul Gepts
Department of Plant Sciences, Section of Crop and Ecosystem
Sciences, University of California, Mailstop 1, 1 Shields Avenue,
Davis, CA 95616-8780, USA
... www.genes.cs.wustl.edu/), and FGENESH (http:// www.softberry.com/; trained with
Nicotiana tabacum, Medicago truncatula, Dicot or Monocot). ...
Molecular Ecology
15 (5), 1367-1378.
- April 2006
Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa
ERIN J. GILCHRIST et al.,
Department of Botany, University of British Columbia, Vancouver, BC, Canada V6T 1Z4
... Gene models were predicted using fgenesh (Salamov & Solovyev 2000) through
the Softberry website ( http:/ / www.softberry.com ). ...
Applied and Environmental Microbiology
, March 2006, p. 1793-1799, Vol. 72, No. 3
Characterization of Two Polyketide Synthase Genes Involved in Zearalenone Biosynthesis in Gibberella zeae
Iffa Gaffoor1 and Frances Trail1,2
Departments of Plant Biology,1 Plant Pathology, Michigan State University, East Lansing, Michigan 488242
... portions of the sequence. Using this complete sequence, FGENESH software
(http://www. softberry. com) with organism-specific parameters ...
Medical Mycology
Volume 44, Number 3 / May 2006
Pages: 211 - 218
The role of the sakA (Hog1) and tcsB (sln1) genes in the oxidant adaptation of Aspergillus fumigatus
Chen Du A1, Jacqueline Sarfati A2, J-P Latge A2, Richard Calderone A1
A1 Department of Microbiology & Immunology, Georgetown University Medical Center, Washington, DC, USA
A2 Aspergillus Unit, Institut Pasteur, Paris, France
... tcsB gene and phenotype of the deletion mutant DNA sequence analysis of tcsB
(gene-finding software FGENESH. WWW.softberry.com) revealed a long Fig. ...
Genetics
Vol. 172, 2491-2499, April 2006
Tracing Nonlegume Orthologs of Legume Genes Required for Nodulation and Arbuscular Mycorrhizal Symbioses
Hongyan Zhu1, Brendan K. Riely2, Nicole J. Burns3, Jean-Michel Ané3
1Department of Plant and Soil Sciences, University of Kentucky, Lexington, KY 40546
... GenBank database. Gene prediction was performed by FGENESH (http://www.
softberry.com/berry.phtml?topic=gfind). Sequence alignments ...
TAG Theoretical and Applied Genetics
Issue: Volume 112, Number 4
Date: February 2006
Pages: 618 - 626
Structural variation and evolution of a defense-gene cluster in natural populations of Aegilops tauschii
Steven A. Brooks1, 3, Li Huang2, Marie N. Herbel2, Bikram S. Gill2, Gina Brown-Guedira1 and John P. Fellers1
(1)Plant Science and Entomology Unit, Department of Plant Pathology, USDA-ARS, Manhattan, KS 66506, USA
... FGENESH 1.1 (http:// www.softberry.com) was used for coding sequence (CDS)
prediction with monocot genomic DNA param- eters. Putative ...
Plant Physiology
, March 2006, Vol. 140, pp. 998-1008
Point Mutations with Positive Selection Were a Major Force during the Evolution of a Receptor-Kinase Resistance Gene Family of Rice
Xinli Sun, Yinglong Cao and Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... 1997 Go). The gene prediction programs used were GENSCAN (Burge and Karlin,
1997 Go) and FGENESH (http://www.softberry.com). The ...
Mol Gen Genomics
Volume 275, Number 5 / May, 2006 pp. 504-511
A complete physical map of a wild beet ( Beta procumbens) translocation
in sugar beet
Daniela Schulte, Daguang Cai, Michael Kleine,
Longjiang Fan, Sheng Wang, Christian Jung
Plant Breeding Institute, Christian-Albrechts-University Kiel,
Olshausenstr. 40, 24098 Kiel, Germany
... An ab initio ORF-analysis with the FgeneSH program on http://www.sun1.softberry.
com was performed to iden- tify putative coding regions using the A. thaliana ...
Molecular Microbiology
2006, 60 (1), 67-80
Lost in the middle of nowhere: the AvrLm1 avirulence gene of the Dothideomycete Leptosphaeria maculans
Lilian Gout 1 et al.,
Phytopathologie et Methodologies de la Detection, INRA, F-78026 Versailles, France.
... genscan ( http:/ / genes.mit.edu/ GENSCAN.html ) was used with vertebrate and
Arabidopsis settings and fgenesh ( http:/ / www.softberry.com ) was set with N ...
J Gen Virol
87 (2006), 311-322
Characterization and transcriptional analysis of protein tyrosine phosphatase genes and an ankyrin
repeat gene of the parasitoid Glyptapanteles indiensis polydnavirus in the parasitized host
D. E. Gundersen-Rindal and M. J. Pedroni
US Department of Agriculture, Agricultural Research Service, Insect Biocontrol Laboratory, Bldg 011A, Room 214, BARC West, Beltsville, MD 20705, USA
... nih.gov/gorf/gorf.html (only large ORFs are shown)], FGENESH [ab initio ... gambiae and
Apis mellifera insect gene parameters; http://www.softberry.com (Salamov & ...
FGENESH 2005
Current Biology
2005, Volume 15, Issue 16, Pages 1508-15
Select a website below to get this article
Causier et al.,
... 25], GeneMark.hmm (http://opal.biology.gatech.edu/genemark/eukhmm.cgi) [26] (each
with the Arabidopsis dataset), and FGENESH (http://www.softberry.com/) (with ...
Plant Molecular Biology
Volume 58, Number 6 / August, 2005, pp. 809-822
The Medicago truncatula SUNN Gene Encodes a CLV1-like Leucine-rich Repeat Receptor Kinase that Regulates Nodule Number and Root Length
Elise et al.,
(1) Department of Genetics, Biochemistry and Life Science Studies, Clemson University, 100 Jordan Hall, Clemson, SC 29634, USA
(2) Laboratoire des Interactions Plantes-Microorganismes, Unité Mixte de Recherche, CNRS-INRA, 31326 Castanet-Tolosan cédex, France
... Genes in this region were predicted using FGENESH (http:// www.softberry.com) (Salamov
and Solovyev, 2000) using parameters for the M. truncatula genome, the ...
TAG Theoretical and Applied Genetics
Volume 111, Number 3 / August, 2005, pp. 467-478
Toward closing rice telomere gaps: mapping and sequence characterization of rice subtelomere regions
Yang et al.,
(1) Brassica Genomics Team, National Institute of Agricultural Biotechnology, RDA, Suwon, 441-707, Korea
(2) Arizona Genomics Institute, University of Arizona, 303 Forbes building, Tucson, AZ 85721, USA
... while the detection of putative genes was analyzed using sev- eral web-based gene
prediction programs including: FGENE-SH MONOCOT (http://www.softberry.com/ber ...
Chromosoma
Volume 114, Number 2 / July, 2005, pp. 103-117
In-depth sequence analysis of the tomato chromosome 12 centromeric region: identification of a large CAA block and characterization of pericentromere retrotranposons
Yang et al.,
(1) Brassica Genomics Team, National Institute of Agricultural Biotechnology (NIAB), RDA, Suwon, 441-707, South Korea
(2) Arizona Genomics Institute, 303 Forbes building, University of Arizona, Tucson, AZ 85721, USA
... Gene an- notation was achieved using several web-based gene pre- diction programs
such as FGENE-SH Arabidopsis (http:// www.softberry.com/berry.phtml ...
Journal of Molecular Evolution
Volume 61, Number 4 / October, 2005, pp. 559-569
Plant Photoreceptors: Phylogenetic Overview
Patricia Lariguet1 and Christophe Dunand1
(1) Department of Plant Biology, University of Geneva, Quai Ernest Ansermet 30, Geneva 4, CH-1211, Switzerland
... quences were analyzed for the presence of the gene with different programs such
as FGenesh (http://www.softberry.com/ber- ry.phtml) and GenScan (http://genes ...
Journal of Molecular Evolution
Volume 60, Number 5 / May, 2005, pp. 615-634
Structure, Evolution, and Expression of the Two Invertase Gene Families of Rice
Xuemei Ji1, 2, Wim Van den Ende3, Andre Van Laere3, Shihua Cheng2 and John Bennett 1
1) Plant Breeding, Genetics and Biochemistry Division, International Rice Research Institute, DAPO, 7777, Metro Manila, Philippines
(2) Chinese National Rice Research Institute, 359 Tiyuchang Road, Hangzhou, Zhejiang, 310006, China
... supplemented the above methods with the use of Genscan (http://genes.mit.edu/
GENSCAN.html) (Burge and Karlin 1997) and FGENESH (http://www.softberry.ru/berry ...
Genetics
Published Articles Ahead of Print: May 6, 2005, Copyright © 2005
doi:10.1534/genetics.105.041616
Centric regions of soybean (Glycine max L. Merr.) chromosomes consist of retroelements and tandemly repeated DNA and are structurally and evolutionarily labile
Lin et al.,
1 Purdue University
2 USDA-ARS-CICGR, and Department of Agronomy
3 University of Minnesota
... Fifteen potential genes were found on the BAC using FGENESH (http://www.softberry.
com/berry.phtml) (Table 2). Three of the fifteen (4-6) ...
TAG Theoretical and Applied Genetics
Volume 111, Number 6 / October, 2005, pp. 1080-1086
Delimitation of the rice wide compatibility gene S5n to a 40-kb DNA fragment
Qiu et al.,
(1) National Key Laboratory of Crop Genetic Improvement, and National Center of Plant Gene Research-Wuhan, Huazhong Agricultural University, Wuhan, 430070, China
... Gene prediction analysis of the 40-kb DNA fragment using FGENSH (http://www.softberry.
com) identified five putative open reading frames (ORFs; Fig. 2). Both ...
Molecular Genetics and Genomics
Volume 274, Number 6 / December, 2005, pp. 569-578
High-resolution mapping, cloning and molecular characterization of the Pi-k h gene of rice, which confers resistance to Magnaporthe grisea
Sharma et al.,
(1) National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India
... The 143,537 bp region of Nipponbare identified by physical mapping was then analysed
with FGENESH software (http://www.softberry.com) to detect putative genes. ...
Genetics
2005 July; 170(3): 1221–1230.
doi: 10.1534/genetics.105.041616.
Pericentromeric Regions of Soybean (Glycine max L. Merr.) Chromosomes Consist of Retroelements and Tandemly Repeated DNA and Are Structurally and Evolutionarily Labile
Lin et al.,
*Department of Agronomy, Purdue University, West Lafayette, Indiana 47907
†Purdue University Genomics Core, Department of Horticulture, Purdue University, West Lafayette, Indiana 47907
... Fifteen potential genes were found on the BAC using FGENESH (http://www.softberry.
com/berry.phtml) (Table 2). Three of the 15 (4-6) were derived from either ...
Genomics
Volume 85, Issue 6, June 2005, Pages 666-678
Biosilica formation in spicules of the sponge Suberites domuncula: Synchronous expression of a gene cluster
Schroder et al.,
aInstitut fur Physiologische Chemie, Abteilung Angewandte Molekularbiologie, Johannes Gutenberg-Universitat, Duesbergweg 6, D-55099 Mainz, Germany
... Four open reading frames (ORFs) were predicted using the program FGENESH ("softberry"):
putative ankyrin repeat protein ANKrp_SUBDO (SDANKrp), silicatein ...
Genetics
2005 February; 169(2): 891–906.
doi: 10.1534/genetics.104.034629.
Structure and Evolution of the r/b Chromosomal Regions in Rice, Maize and Sorghum
Zuzana Swigonova,* Jeffrey L. Bennetzen,†1 and Joachim Messi
*Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854-8020
†Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907-1392
... Finnzyme, Helsinki). Sequence analysis: Genes predicted by FGENESH
(http://www.softberry.com/berry.phtml? topic=gfind&prg=FGENESH ...
Genetics
2005 March; 169(3): 1403–1414.
doi: 10.1534/genetics.104.035972.
Gene Clusters for Insecticidal Loline Alkaloids in the Grass-Endophytic Fungus Neotyphodium uncinatum
Martin J. Spiering,* Christina D. Moon,*1 Heather H. Wilkinson,† and Christopher L. Schardl*2
*Department of Plant Pathology, University of Kentucky, Lexington, Kentucky 40546-0312
†Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas 77843-2132
... with the search parameters for the N. crassa genome, genomic DNA sequences were
entered into the FGENESH gene prediction program (http://www.softberry.com/berry ...
Genetics
2005 July; 170(3): 1209–1220.
doi: 10.1534/genetics.105.040915.
DNA Rearrangement in Orthologous Orp Regions of the Maize, Rice and Sorghum Genomes
Jianxin Ma,*† Phillip SanMiguel,‡ Jinsheng Lai,§ Joachim Messing,§ and Jeffrey L. Bennetzen*†1
Department of Genetics, University of Georgia, Athens, Georgia 30602
†Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907
... Sequence analysis and annotation: Gene-finding programs FGENESH (http://www.softberry.
com/berry.phtml?topic=gfind&prg=FGENESH) with the monocot training set ...
PNAS
August 23, 2005 vol. 102 no. 34 12282-12287
Quality assessment of maize assembled genomic islands (MAGIs) and large-scale experimental verification of predicted genes
Yan Fu et al.,
*Interdepartmental Genetics Graduate Program, §Interdepartmental Bioinformatics and Computational Biology Graduate Program, **L. H. Baker Center for Bioinformatics and Biological Statistics
... fgenesh (Softberry, Mount Kisco, NY) was used for ab initio gene prediction with
monocot parameters and the GC option that uses all potential GC donor splice ...
PNAS
December 27, 2005 vol. 102 no. 52 19243-19248
Analysis and mapping of randomly chosen bacterial artificial chromosome clones from hexaploid bread wheat
Devos et al.,
Departments of *Crop and Soil Sciences, †Plant Biology, and §Genetics, University of Georgia, Athens, GA 30602
... The gene prediction program fgenesh, with the monocot (maize, rice, wheat, and barley)
training set (www.softberry.com), was used to predict genes. ...
Eukaryotic Cell
November 2005, p. 1926-1933, Vol. 4, No. 11
Functional Analysis of the Polyketide Synthase Genes in the Filamentous Fungus Gibberella zeae (Anamorph Fusarium graminearum)
Gaffoor et al.,
Department of Plant Biology, Michigan State University, East Lansing, Michigan 48824,1 Mycotoxin Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, Peoria, Illinois 61604,2
... Ab initio gene identification was accomplished using FGENESH (http://www.softberry.
com) with organism-specific parameters for Neurospora crassa (12). ...
Cytokine
Volume 32, Issue 5, 7 December 2005, Pages 219-225
Expression of nine-banded armadillo (Dasypus novemcinctus) interleukin-2 in E. coli
Adams et al.,
Laboratory Research Branch National Hansen's Disease Programs, Louisiana State University, School of Veterinary Medicine, Skip Bertman Drive, Baton Rouge, LA 70803, USA
... The genomic sequence was submitted to FGENESH (http://www.softberry.com) to derive
a putative cDNA and a corresponding translation for the putative amino acid ...
Comparative and Functional Genomics
Volume 6 (2005), Issue 3, Pages 138-146doi:10.1002/cfg.465
The Korea Brassica Genome Project: a Glimpse of the Brassica Genome Based on Comparative Genome Analysis With Arabidopsis
Tae-Jin Yang et al.,
1National Institute of Agricultural Biotechnology (NIAB), 224 Suinro Gwonseon-gu, Gyeonggi-do, Suwon 441–707, Korea
2Chungnam National University, Gungdong 220, Chungnam, Daejeon 305–764, Korea
... Gene annotation was achieved using several web based gene prediction programs,
eg FGENE-SH Arabidopsis (http://www.softberry.com/berry. ...
Plant Molecular Biology
Volume 59, Number 1 / September, 2005, pp.191-203
Transcription Factors in Rice: A Genome-wide Comparative Analysis between Monocots and Eudicots
Xiong et al.,
(1) Present address: Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 100101 Beijing, China
... BGI) (Yu et al., 2002) (http://www.genomics.org.cn/) and the genes were predicted
using FGENESH (Salamov and Solovyev, 2000) (http://www.softberry.com/). ...
Molecular Biology and Evolution
2005 22(10):2084-2089; doi:10.1093/molbev/msi202
MUSTANG Is a Novel Family of Domesticated Transposase Genes Found in Diverse Angiosperms
Rebecca K. Cowan, Douglas R. Hoen, Daniel J. Schoen and Thomas E. Bureau
McGill University, Biology Department, Montreal, Quebec H3A 1B1, Canada
... through AP006877 and National Center for Biotechnology Information [NCBI] accession
number AE016959), predicted using FGENESH (http://www.softberry.com/berry ...
Plant Molecular Biology
Issue: Volume 57, Number 3 Date: February 2005 Pages: 445 - 460
Evaluation of five ab initio gene prediction programs for the discovery of maize genes
Hong Yao1, 4 et al
Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, 50011-3650, USA.
ABSTRACT
Five ab initio programs (FGENESH, GeneMark.hmm, GENSCAN, GlimmerR and Grail) were evaluated for their accuracy in predicting maize genes. Two of these programs, GeneMark.hmm and GENSCAN had been trained for maize; FGENESH had been trained for monocots (including maize), and the others had been trained for rice or Arabidopsis. Initial evaluations were conducted using eight maize genes (gl8a, pdc2, pdc3, rf2c, rf2d, rf2e1, rth1, and rth3) of which the sequences were not released to the public prior to conducting this evaluation. The significant advantage of this data set for this evaluation is that these genes could not have been included in the training sets of the prediction programs. FGENESH yielded the most accurate and GeneMark.hmm the second most accurate predictions. The five programs were used in conjunction with RT-PCR to identify and establish the structures of two new genes in the a1-sh2 interval of the maize genome. FGENESH, GeneMark.hmm and GENSCAN were tested on a larger data set consisting of maize assembled genomic islands (MAGIs) that had been aligned to ESTs. FGENESH, GeneMark.hmm and GENSCAN correctly predicted gene models in 773, 625, and 371 MAGIs, respectively, out of the 1353 MAGIs that comprise data set 2.
Nature
434, 980-986 (21 April 2005)
The genome sequence of the rice blast fungus Magnaporthe grisea
Dean et al.,
Center for Integrated Fungal Research, North Carolina State University, Raleigh, North Carolina 27695, USA
School of Biological and Chemical Sciences, University of Exeter, Washington Singer Laboratories, Exeter EX4 4QG, UK
...Gene predictions were performed using FGENESH/FGENESH1 + trained on M. grisea sequences (SoftBerry) and GENEWISE (Sanger Center) and validated against 65 characterized M. grisea genes. Additional information and gene identification...
Nature
436, 793 - 800 (11 Aug 2005)
The map-based sequence of the rice genome
International Rice Genome Sequencing Project
...the remaining centromere gaps. Annotation and bioinformatics Gene models were predicted using FGENESH (http://www.softberry.com/berry.phtml?topic = fgenesh) using the monocot trained matrix on the native and repeat-masked...
Nature Genetics
37 997 - 1002 (01 Sep 2005) Letters
Gene duplication and exon shuffling by helitron-like transposons generate intraspecies diversity in maize
Morgante et al.,
1 Dipartimento di Scienze Agrarie ed Ambientali, Universita' di Udine, Via delle Scienze 208, 33100 Udine, Italy.
2 DuPont Crop Genetics Research, DuPont Experimental Station Building E353, Wilmington, Delaware 19880-353, USA.
...at http://www.girinst.org/~vladimir/RC/Data1.htm. We obtained FGENSH splicing site predictions from http://www.softberry.com/berry.phtml. Primer3 is available at http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi. Note:...
European Journal of Plant Pathology
Issue: Volume 112, Number 1 Date: May 2005 Pages: 23 - 29
Leptosphaeria maculans, a fungal pathogen of Brassica napus, secretes a subtilisin-like serine protease
Leanne M. Wilson and Barbara J. Howlett
1 School of Botany, The University of Melbourne, Parkville, Victoria, 3010, Australia
... DNA and cDNA sequences were compared to identify intron positions, which confirmed those predicted by FGENESH gene prediction software (www.softberry.com). ...
Current Genetics
Issue: Volume 47, Number 5 Date: May 2005 Pages: 307 - 315
During attachment Phytophthora spores secrete proteins containing thrombospondin type 1 repeats
Andrea V. Robold1 and Adrienne R. Hardham1
(1) Plant Cell Biology Group, Research School of Biological Sciences, The Australian National University, Canberra, ACT 2601, Australia
... info.html). The DNA sequence was searched for introns using the soft- ware program FGENESH (http://www.softberry. com/berry.phtml ...
Microbiology
151 (2005), 1499-1505
Overproduction, purification and characterization of FgaPT2, a dimethylallyltryptophan synthase from Aspergillus fumigatus
Inge A. Unsold and Shu-Ming Li
Pharmazeutische Biologie, Pharmazeutisches Institut, Eberhard-Karls-Universitat Tubingen, Auf der Morgenstelle 8, 72076 Tubingen, Germany
... FGENESH (Softberry; www.softberry.com/berry.phtml) and the DNASIS software package (version 2.1; Hitachi Software Engineering) were used for intron prediction ...
Eukaryotic Cell
March 2005, p. 526-535, Vol. 4, No. 3
Sex-Specific Homeodomain Proteins Sxi1a and Sxi2a Coordinately Regulate Sexual Development in Cryptococcus neoformans
Christina M. Hull,1, Marie-Josee Boily,1 and Joseph Heitman1,2*
Department of Molecular Genetics and Microbiology,1 the Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina2
... Sequence manipulations. Splice predictions of candidate gene sequences for SXI2a were facilitated with a Softberry algorithm (www.softberry.com). ...
New Phytologist
167 (1), July 2005, 239-247.
Identification of perennial ryegrass (Lolium perenne (L.)) and meadow fescue (Festuca pratensis (Huds.)) candidate orthologous sequences to the rice Hd1(Se1) and barley HvCO1 CONSTANS-like genes through comparative mapping and microsynteny
P. Armstead, L. Skot, L. B. Turner, K. Skot, I. S. Donnison, M. O. Humphreys and I. P. King
... Predictions of mRNA and protein sequences were carried out using FGENESH and
FGENESH+ software ( http:/ / www.softberry.com/ berry.phtml ). ...
Plant Physiology
May 2005, Vol. 138, pp. 38-46
BIOINFORMATICS-PLANT DATABASES
Databases and Information Integration for the Medicago truncatula Genome and Transcriptome1
Steven B. Cannon et al
Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota 55108 (S.B.C., X.W., E.K.S.C., J.V., J.M., N.D.Y.)
... Annotation involves a multi-institution pipeline, relying on Medicago-trained FGENESH
(Salamov and Solovyev, 2000 ) predictions, the EuGene (Foissac et al ...
Plant Physiology
May 2005, Vol. 138, pp. 18-26
BIOINFORMATICS-PLANT DATABASES
The Institute for Genomic Research Osa1 Rice Genome Annotation Database1
Qiaoping Yuan et al
The Institute for Genomic Research, Rockville, Maryland 20850
... The ab initio gene finders used in the rice EGC pipeline include FGENESH (monocot
matrix; Salamov and Solovyev, 2000 ), GeneMark.hmm (rice matrix; Lukashin and ...
Genome Research
15:577-582, 2005
Closing in on the C. elegans ORFeome by cloning TWINSCAN predictions
Chaochun Wei1 et al.
1 Laboratory for Computational Genomics and Department of Computer Science and Engineering, Washington University, St. Louis, Missouri 63130, USA
... Finally, we compared TWINSCAN with two other gene-prediction systems that have recently
been developed for nematodes-FGENESH (Salamov and Solovyev 2000 ...
Plant Physiology
April 2005, Vol. 137, pp. 1174-1181
UPDATE ON SEQUENCING MEDICAGO TRUNCATULA AND LOTUS JAPONICUS
Sequencing the Genespaces of Medicago truncatula and Lotus japonicus1
Nevin D. Young et al
Department of Plant Pathology, University of Minnesota, St. Paul, Minnesota 55108 (N.D.Y., S.B.C.)
... (These estimates are based on FGENESH predictions [Salamov and Solovyev, 2000] using a Mt-trained matrix, retaining peptides with a BLASTP match at 10e-4 to the UniProt NREF100 database of peptides [Apweiler et al., 2004]. This estimate for Lj differs from the published value of 1 gene per 10.1 kb [Asamizu et al., 2003a] due to the use here of the FGENESH gene-calling algorithm so Mt and Lj could be compared directly.)...
...This estimate increases to 6,500 when Lj genes are predicted by the Mt-trained FGENESH algorithm described earlier...
International Journal of Cancer
Volume 109, Issue 1 , Pages 71 - 75
Candidate regions of tumor suppressor locus on chromosome 9q31.1 in gastric cancer
Naoto Kakinuma 1 et al
1Novartis Pharma Tsukuba Research Institute, Ibaraki, Japan
2Laboratory of Molecular and Genetic Information, Institute for Molecular and Cellular Biosciences, University of Tokyo, Tokyo, Japan
3Second Department of Surgery, Gunma University School of Medicine, Gunma, Japan
... predict the genes between D9S277 and D9S127 in 9q31.1, the gene prediction tools
also in the UCSC Genome Browser having Acembly, Ensembl, FGENESH , GenScan and ...
Genome Research
15:54-66, 2005
Gene and alternative splicing annotation with AIR
Liliana Florea1,4,5 et al
1 Informatics Research, Applied Biosystems, Rockville, Maryland 20850, USA;
... Ab initio prediction programs such as GenScan (Burge and Karlin 1997 ),
FGENESH (Salamov and Solovyev 2000 ), Genie (Kulp et al. ...
Nucleic Acids Research
2005, Vol. 33, Database issue D399-D402
SilkDB: a knowledgebase for silkworm biology and genomics
Jing Wang1 et al
1 College of Life Sciences, Peking University, Beijing 100871, China,
... BGF is a self-developed ab initio program based on GenScan (9) and FGENESH (10),
and was successfully utilized for our rice genome annotation (11). ...
Clinical Cancer Research
Vol. 11, 4029-4036, June 1, 2005
A Molecular Signature in Superficial Bladder Carcinoma Predicts Clinical Outcome
Lars Dyrskjot1 et al
Authors' Affiliations: 1 Molecular Diagnostic Laboratory, Department of Clinical Biochemistry
... array comprising 59,619 probe sets representing 46,000 unique sequences, including
known genes, expressed sequence tag clusters, and FGENESH-predicted exons ...
BMC Evolutionary Biology
2005, 5:1
The WRKY transcription factor superfamily: its origin in eukaryotes and expansion in plants
Yuanji Zhang* and Liangjiang Wang
Address: Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK 73402, USA
... Despite minor differences in the gene structure prediction, both gene prediction programs FGENESH and GENSCAN agree on the major features of the protein ...
PLoS Biol.
2005 June; 3(6): e181.
RAG1 Core and V(D)J Recombination Signal Sequences Were Derived from Transib Transposons
Vladimir V Kapitonov1 and Jerzy Jurka1
1Genetic Information Research Institute, Mountain View, California, United States of America
David Nemazee, Academic Editor
... Using FGENESH [33], we detected that the RAG1 core-like open reading frame (ORF)
in the contig 29068 forms a terminal exon (positions 1154-2947) of an ...
Genetics
Published Articles Ahead of Print, published on February 16, 2005 as 0.1534/genetics.104.036327
Identification and Characterization of Regions of the Rice Genome Associated with Broad-
Spectrum, Quantitative Disease Resistance
Randall J. Wisser R.J * et al.
*Department of Plant Breeding and Genetics, Institute for Genomic Diversity, Cornell
University, Ithaca, New York 14853
... GENSCAN (B URGE and K ARLIN 1997) and FGENESH (S ALAMOV and S OLOVYEV 2001)
to predict open reading frames. Further searches against ...
Plant Physiology
January 2005, Vol. 137, pp. 176-189
Annotations and Functional Analyses of the Rice WRKY Gene Superfamily Reveal Positive and Negative Regulators of Abscisic Acid Signaling in Aleurone Cells1,[w]
Zhen Xie2 et al
Department of Biological Sciences, University of Nevada, Las Vegas, Nevada 89154
... First of all, three genes (OsWRKY41, -43, and -44) were reannotated using FGENESH
(www.softberry.com), because the first introns of these genes were too small ...
PLoS Biol
3(6): e181 (2005)
RAG1 Core and V(D)J Recombination Signal Sequences Were Derived from Transib Transposons.
Vladimir V. Kapitonov1*, Jerzy Jurka1*
1 Genetic Information Research Institute, Mountain View, California, United States of America
... Using FGENESH [33], we detected that the RAG1 core-like open reading frame (ORF)
in the contig 29068 forms a terminal exon (positions 1154-2947) of an ...
Plant and Cell Physiology 2005 46(1):3-13; doi:10.1093/pcp/pci503
From Mapping to Sequencing, Post-sequencing and Beyond
Takuji Sasaki1, Takashi Matsumoto, Baltazar A. Antonio and Yoshiaki Nagamura
National Institute of Agrobiological Sciences, 2-1-2 Kannondai, Tsukuba, Ibaraki 305-8602, Japan
... The gene predictions by programs such as Genescan (Burge and Karlin 1997 ), FGENESH
[see Appendix 1 (4)] and Genemark [see Appendix 1 (5)], BLAST (Altschul et ...
Nature Biotechnology, 2005
Improving the nutritional value of Golden Rice through increased pro-vitamin A content
JA Paine, CA Shipton, S Chaggar, RM Howells, MJ ...
... Arabidopsis thaliana psy and rice psy (AY024351) genes identified genomic sequences
of similarity in which genes were predicted using FGENESH algorithm with ...
Genetics
Published Articles Ahead of Print, published on January 16, 2005 as 10.1534/genetics.104.035543
THE GENETIC BASIS FOR INFLORESCENCE VARIATION BETWEEN FOXTAIL AND GREEN MILLET (POACEAE)
Andrew N. Doust*, Katrien M. Devos1, Mike D. Gadberry*, Mike D. Gale, & Elizabeth A. Kellogg*
*University of Missouri-St. Louis, Department of Biology, One University Boulevard, St.
Louis, MO 63121, USA
... Each of these contigs was scanned using FGENESH (S ALAMOV and S OLOVYEV
2000), and open reading frames (ORFs) were translated and ...
PLoS Biol
3(1): e13 January 2005
Sorghum Genome Sequencing by Methylation Filtration
Joseph A. Bedell et al.
Bioinformatics, Orion Genomics, Saint Louis, Missouri, United States of America,
... additional parameters: wordmask=seg; lcmask; M=1; N=-1; Q=3; R=3; kap; E=1e-10;
hspmax=0. To look for potentially novel genes, we used FGENESH (http://www ...
BMC Genomics
2005, 6:11 doi:10.1186/1471-2164-6-11
FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells
Demet Nalbant et al.
Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas 79430, USA
... These results were compared against genes assembled by two gene prediction programs,
FGENESH: http://www.softberry.com/berry.phtml and GENSCAN: http://genes.mit ...
Plant Physiology
July 2005, Vol. 138, pp. 1205-1215
Complex Organization and Evolution of the Tomato Pericentromeric Region at the FER Gene Locus1,[w]
Romain Guyot et al.
Institute of Plant Biology, University of Zurich, 8008 Zurich, Switzerland (R.G., E.S., B.K., H.-Q.L.); and Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Chaoyang District, Beijing 100101, China (X.C., Y.S., Z.C., H.-Q.L.)
... Putative genes were determined by a combination of coding region prediction software
(GENSCAN, FGENESH, and MZEF with Arabidopsis and/or monocot matrix ...
J Gen Virol
86 (2005), 973-983; DOI 10.1099/vir.0.80833-0
Cloning, characterization and analysis by RNA interference of various genes of the Chelonus inanitus polydnavirus
Marianne Bonvin et al
Institute of Cell Biology, University of Berne, Baltzerstrasse 4, CH-3012 Bern, Switzerland
... 12g1forw (5'-GAGTCCATGCCGAATGTCAC-3') and 12g1rev (5'-CTTCTTGCACAGCGACGAAC-3') were set to amplify the middle region of 12g1, as predicted with FGENESH 1.0 and ...
BMC Plant Biol.
2005, 5:15
Highly syntenic regions in the genomes of soybean, Medicago truncatula, and Arabidopsis thaliana
Mudge et al.,
1Dept of Plant Pathology, 495 Borlaug Hall, University of Minnesota, St. Paul, MN 55108 USA
... Genes were predicted in G. max and M. truncatula genomic sequences using the dicot
(Arabidopsis) matrix of FGENESH [59,60]http://www.softberry.com webcite. ...
PNAS
February 1, 2005 vol. 102 no. 5 1566-1571
A computational and experimental approach to validating annotations and gene predictions in the Drosophila melanogaster genome
Mark Yandell et al
Howard Hughes Medical Institute and Department of Molecular and Cell Biology, University of California, Life Sciences Addition, Berkeley, CA 94720-3200; and Department of Genome Sciences, Lawrence Berkeley National Laboratory, One Cyclotron Road, Mailstop 64-121, Berkeley, CA 94720
... genes, based on a microarray-based approach that involved hybridizing randomly primed
cDNA against probes corresponding to a large set of FGENESH predictions. ...
Insect Molecular Biology
Volume 14 Issue 2 Page 113 - 119 April 2005
Detection and analysis of alternative splicing in the silkworm by aligning expressed sequence tags with the genomic sequence
X.-F. Zha et al
Correspondence: Dr Qing-You Xia, The Key Sericultural Laboratory of Agricultural Ministry, Southwest Agricultural University, Chongqing 400716, China.
... previously predicted silkworm genes in the genomic sequences by BGF, a newly developed
program based on GENSCAN (Burge & Karlin, 1997) and FGENESH (Salamov & ...
Microbiology
151 (2005), 2199-2207;
DOI 10.1099/mic.0.27962-0
Overproduction, purification and characterization of FtmPT1, a brevianamide F prenyltransferase from Aspergillus fumigatus
Alexander Grundmann and Shu-Ming Li
Pharmazeutische Biologie, Pharmazeutisches Institut, Eberhard-Karls-Universitat Tubingen, Auf der Morgenstelle 8, 72076 Tubingen, Germany
... FGENESH (Softberry, Inc., http://www.softberry.com/berry.phtml) and the DNASIS software
package (version 2.1; Hitachi Software Engineering) were used for ...
FGENESH 2002-2004
Fungal Genetics and Biology
Volume 41, Issue 1, January 2004, Pages 23-32
Contig assembly and microsynteny analysis using a bacterial artificial chromosome library for Epichloe festucae, a mutualistic fungal endophyte of grasses
Brandi L Kutil a, Gang Liu a, 1, Julia Vrebalov b and Heather H Wilkinson
aDepartment of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77845-2132, USA
bBoyce Thompson Institute for Plant Research, Ithaca, NY 14853-1801, USA
... Contigs were also submitted to FGENESH (http://www.softberry.com/berry.phtml)
to predict ORFs using N. crassa as the training set. ...
Eukaryotic Cell
April 2004, p. 420-429, Vol. 3, No. 2
Cryptococcus neoformans Virulence Gene Discovery through Insertional Mutagenesis
Alexander Idnurm, Jennifer L. Reedy, Jesse C. Nussbaum, and Joseph Heitman
Department of Molecular Genetics and Microbiology, Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 27710
... FGENESH software (SoftBerry) was used to search for coding regions within the sequence,
and BLAST searches were conducted against the GenBank database to infer ...
Breeding Science
Vol. 54 (2004) , No. 2 165-175
Molecular Characterization of a 313-kb Genomic Region Containing the Self-incompatibility Locus of Ipomoea trifida, a Diploid Relative of Sweet Potato
Rubens Norio Tomita et al.,
1) Faculty of Bioresources, Mie University
2) Division of Natural Science, Osaka Kyoiku University
3) Life Science Research Center, Mie University
... gatech.edu/GeneMark), GENE- SCAN (http://genes.mit.edu/GENESCAN), GlimmerM (http://
www.tigr.org/tdb.glimmerm/glmr) and FGENESH (http:// softberry.com/berry ...
J. Biol. Chem
Vol. 279, Issue 18, 18550-18558, April 30, 2004
The Two-pore Domain K+ Channel, TRESK, Is Activated by the Cytoplasmic Calcium Signal through Calcineurin
Gabor Czirjak, Zsuzsanna E. Toth, and Peter Enyedi
From the Department of Physiology and Laboratory of Neuromorphology, Semmelweis University, H-1444 Budapest, Hungary
... The conceptual coding region of the new channel was calculated from the neighboring
genomic sequences by the FGENESH program at the Softberry site on the World ...
Genome Res.
2004. 14: 1916-1923 doi:
10.1101/gr.2332504
Close Split of Sorghum and Maize Genome Progenitors
Swigonova et al.,
1Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854, USA
2Department of Biological Sciences and Genetics Program, West Lafayette, Indiana 47907, USA
... Genes predicted by FGENESH (www.softberry.com) and GENSCAN (http://genes.mit.edu/
GENSCAN.html) programs were further analyzed by homology searches using BLAST ...
PNAS
October 26, 2004 vol. 101 no. 43 15289-15294
Estimating genome conservation between crop and model legume species
Choi et al.,
Department of Plant Pathology and §College of Agricultural and Environmental Sciences Genomics Facility, University of California, One Shields Avenue, Davis, CA 95616; ¶Department of Plant Pathology, University of Minnesota, St. Paul, MN 55108
... NCBI (18). Ab initio gene prediction involved the eudicot version of fgenesh
(www.softberry.com/berry.phtml?topic=gfind). Gene prediction ...
PNAS
January 20, 2004 vol. 101 no. 3 700-707
Pattern of diversity in the genomic region near the maize domestication gene tb1
Richard M. Clark†, Eric Linton‡,§, Joachim Messing‡, and John F. Doebley†
†Laboratory of Genetics, University of Wisconsin, Madison, WI 53706; and ‡Waksman Institute, Rutgers University, Piscataway, NJ 08854
... default" and DNA source set to "Grasses." Nonrepetitive DNA was analyzed for genes
by using the fgenesh gene prediction software (www.softberry.com/berry ...
Eukaryotic Cell
October 2004, p. 1088-1100, Vol. 3, No. 5
Introns and Splicing Elements of Five Diverse Fungi
Kupfer et al.,
Department of Microbiology and Immunology, University of Oklahoma Health Sciences Center, Oklahoma City,2 Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma,1
... Translation of the DNA sequences was done by using FGENSH at the Softberry website
(http://www.softberry.com/) with either the S. pombe or the N. crassa matrix ...
Journal of Experimental Biology
207, 4573-4586 (2004)
Functional characterisation of the Anopheles leucokinins and their cognate G-protein coupled receptor
Jonathan C. Radford, Selim Terhzaz, Pablo Cabrero, Shireen-A. Davies and Julian A. T. Dow
Institute of Biomedical and Life Sciences, Division of Molecular Genetics, University of Glasgow, Glasgow G11 6NU, UK
... This region plus the surrounding 20 kb of genomic sequence either side was then
analysed with the Softberry FgenesH gene prediction program (www.softberry.com ...
TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 4 Date: August 2004 Pages: 681 - 689
Linkage disequilibrium and sequence diversity in a 500-kbp region around the adh1 locus in elite maize germplasm
Mark Jung et al
(1) DuPont Crop Genetics, Experimental Station, P.O. Box 80353, Wilmington, DE 19880-0353, USA
... 1). Gene locations were defined by several methods. Annotations provided in Tikhonov
et al. (1999) were first used, then FGENESH gene-finding software ...
DNA Sequence - The Journal of Sequencing and Mapping
Issue: Volume 15, Number 4 / August, 2004 Pages: 269 - 276
Isolation, Characterization and Expression Analysis of a Leaf-specific Phosphoenolpyruvate Carboxylase Gene in Oryza sativa
Chang-Fa Lin et al
State Key Laboratory of Genetic Engineering Institute of Genetics, School of Life Sciences, Fudan University Shanghai 200433 P.R.China
... tools of GeneMark (http://opal. biology.gatech.edu/geneMark/) and Softberry
(http://www.softberry.com). For the isolation of putative ...
Nature Genetics
36, 40 - 45 (01 Jan 2004)
Complete sequencing and characterization of 21,243 full-length human cDNAs
Ota et al.
...PSORT II, http://psort.ims.u-tokyo.ac.jp/; DIGIT, http://digit.ims.u-tokyo.ac.jp;
FGENESH, http://www.softberry.com/berry.phtml; GENSCAN, http://genes.mit.edu/GENSCAN.html; HMMGENES, http://www.cbs.dtu.dk/services/HMMgene/; HUNT...
Plant Molecular Biology
Issue: Volume 54, Number 4 Date: March 2004 Pages: 519 - 532
Genome-Wide Analysis of the GRAS Gene Family in Rice and Arabidopsis
Chaoguang Tian1, Ping Wan1, Shouhong Sun1, Jiayang Li1 and Mingsheng Chen1*
(1) Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 100101, China
... database. FGENESH (Salamov and 90 Solovyev, 2000) was used for gene prediction. ...
pre- 207 dicted by FGENESH (minor discrepancies exist due 208 ...
Mycological Research
(2004), 108: 853-857 Cambridge University Press
Combining transcriptome data with genomic and cDNA sequence alignments to make confident functional assignments for Aspergillus nidulans genes
Andrew H. SIMS a1, Manda E. GENT a1, Geoffrey D. ROBSON a1, Nigel S. DUNN-COLEMAN a2 and Stephen G. OLIVER a1c1
a1 School of Biological Sciences, University of Manchester, The Michael Smith Building, Oxford Road, Manchester M13 9PT, UK.
... Kingdom. Page 2. Genewise, FGENESH, FGENESH+) consisting of 9541 putative
open reading frames (ORFs) was released in June 2003. We ...
TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 1 Date: June 2004 Pages: 129 - 139
Gene content and density in banana (Musa acuminata) as revealed by genomic sequencing of BAC clones
R. Aert1, 2, L. Sagi2 and G. Volckaert1
(1) Laboratory of Gene Technology, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, 3001 Leuven, Belgium
Present address: Laboratory of Tropical Crop Improvement, Katholieke Universiteit Leuven, (2) Kasteelpark Arenberg 13, 3001 Leuven, Belgium
... gsc.riken.go.jp), FGENESH version 1.1 (Salamov and Solovyev 2000; http://www.softberry.
com), genemark.hmm version 2.2a (Lukashin and Borodovsky 1998; http ...
Genome Research
14:2503-2509, 2004
EAnnot: A genome annotation tool using experimental evidence
Li Ding et al
Genome Sequencing Center, Washington University School of Medicine, St. Louis, Missouri 63110, USA
...Some ab initio programs, such as Genscan (Burge and Karlin 1997 ) and FGENESH (Salamov and Solovyev 2000 ) are based on intrinsic characteristics of coding sequence (e.g., codon usage, consensus splice sites, etc.) and require training on known genes from the organism...
TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 7 Date: November 2004 Pages: 1434 - 1447
Full-genome analysis of resistance gene homologues in rice
B. Monosi1, R. J. Wisser2, L. Pennill1 and S. H. Hulbert1
(1) Department of Plant Pathology, Kansas State University, Manhattan, KS 66506-5502, USA
(2) Department of Plant Pathology, Cornell University, Ithaca, NY 14853, USA
... DNA sequences were analyzed using the gene prediction programs GENSCAN (Burge and
Karlin 1997; http://genes.mit.edu/GENSCAN.html) and FGENESH (Salamov and ...
arXiv:q-bio.GN/0402046 v1 27 Feb 2004
Sublinear growth of Information in DNA sequences
Giulia Menconi
Dipartimento di Matematica Applicata and C.I.S.S.C. Centro Interdisciplinare
per lo Studio dei Sistemi Complessi Universit`a di Pisa
Via Bonanno Pisano 25/b 56126 PISA - Italy
...As a result, four putative genes G1, G2, G3 and G4 have been located by means of Hidden Markov Model-based program FGENESH2 that has been created for predicting multiple genes and their structure in genomic DNA sequences. The analysis via FGENESH has been exploited with respect to known genes in Arabidopsis thaliana. Their predicted position is illustrated in Figure 13.
...2This program is available at the website www.softberry.com to which we refer con-cerning the reliability and e_ciency of the algorithm....
Current Opinion in Plant Biology
2004, 7:732-736
Consistent over-estimation of gene number in complex plant genomes
Jeffrey L Bennetzen1,4, Craig Coleman2,7, Renyi Liu1,5, Jianxin Ma1,6 and
Wusirika Ramakrishna3,8
1 Department of Genetics, University of Georgia, Athens, Georgia 30602,
USA
...We have found that the standard gene-discovery programs FGENESH, GeneMark and GENSCAN annotate segments of most retrotransposons and many invertedrepeat transposable elements as genes. Using FGENESH to annotate maize BAC clones, for instance, 70-100% of the predicted genes are actually from transposable elements...
The Plant Cell
16:2795-2808 (2004)
Spotted leaf11, a Negative Regulator of Plant Cell Death and Defense, Encodes a U-Box/Armadillo Repeat Protein Endowed with E3 Ubiquitin Ligase Activity
Li-Rong Zeng et al
a Department of Plant Pathology, Ohio State University, Columbus, Ohio 43210
... in spl11. Exons predicted in G3 by the programs GENSCAN and FGENESH using
different matrixes are displayed in dark gray. (D) RFLP ...
Human Genomics,
Volume 1, Number 2, January 2004, pp. 146-149(4)
The truth about mouse, human, worms and yeast
Authors: David R. Nelson1; Daniel W. Nebert2
1: Department of Molecular Sciences and The UT Center of Excellence in Genomics and Bioinformatics, University of Tennessee, Memphis, Tennessee 38163, USA 2: Department of Environmental Health and Center for Environmental Genetics (CEG), University of Cincinnati Medical Center, Cincinnati, Ohio 45267-0056, USA
... unpublished data, 2003; see also Ref. [7]), FGENESH, 21 TWINSCAN 22 and
the Ensembl annotation pipeline. 23 The output of the four ...
Genome Biology
2004, 5:R73 doi:10.1186/gb-2004-5-10-r73
A comprehensive transcript index of the human genome generated using microarrays and computational approaches
Eric E Schadt et al
1Rosetta Inpharmatics LLC, 12040 115th Avenue NE, Kirkland, WA 98034, USA
...GrailEXP 4.0 [47], GENSCAN 1.0 [48], FGENESH [49], and FGENESH+ [49]ab initio gene-prediction algorithms were run independently across the entire genome assembly to augment alignment-based gene identification methods...
Genome Research
14:988-995, 2004
GeneWise and Genomewise
Ewan Birney1,3, Michele Clamp2 and Richard Durbin2
1 The European Bioinformatics Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK; 2 The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK
...There has been a long history of successful ab initio programs which do not use any additional evidence to predict genes on genomic DNA, of which Genscan (Burge and Karlin 1997 ) and FGENESH (Solovyev and Salamov 1997 ) are two of the most successful cases....
...Another class of evidence-based gene prediction programs are ones which use external evidence to influence the scoring of potential exons, including SGP-2 (Parra et al. 2003 ), Genie (Kulp et al. 1996 ), Genomescan (Yeh et al. 2001 ), HMMGene (Krogh 2000 ), and FGENESH++ (Solovyev and Salamov 1997 )...
PNAS
February 17, 2004 vol. 101 no. 7 1910-1915
Type I MADS-box genes have experienced faster birth-and-death evolution than type II MADS-box genes in angiosperms
Jongmin Nam et al
Institute of Molecular Evolutionary Genetics and Department of Biology, Pennsylvania State University, University Park, PA 16802
...Because annotation of rice gene was still in progress at the
time of this study, we ourselves conducted gene annotation by using the
computer program FGENESH (www.softberry.com) from the genome sequences obtained from TIGR and the Rice Genome Database (China) (25).
Functional & Integrative Genomics
Issue: Volume 4, Number 2 Date: May 2004 Pages: 102 - 117
Sequence analysis of the long arm of rice chromosome 11 for rice-wheat synteny
Nagendra K. Singh et al.,
Indian Initiative for Rice Genome Sequencing, National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India
... Wherever RiceGAAS data were not available, the genes were predicted by FGENESH trained
for monocot plant species (http:// www.softberry.com/berry.phtml). ...
TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 1 Date: June 2004 Pages: 10 - 22
Annotation of a 95-kb Populus deltoides genomic sequence reveals a disease resistance gene cluster and novel class I and class II transposable elements
M. Lescot et al
1. Department of Plant Systems Biology, Flanders Interuniversity Institute for Biotechnology, Ghent University, Technologiepark 927, 9052 Gent, Belgium
... 1999; http://www.tigr.org/tdb/glimmerm/glmr_form.html), and FGENESH for dicots or
monocots (Salamov and Solovyev 2000; http://www.softberry.com/). ...
BIOINFORMATICS, 2004 vol.20 N.9 p.1416-1427
J Yuan, B Bush, A Elbrecht, Y Liu, T Zhang, W Zhao ... -
... suchasGRAIL(Lopezetal., 1994; Roberts, 1991; Uberbacher et al., 1996), GENESCOPE
(Murakami and Takagi, 1998), FGENESH (Salamov and Solovyev, 2000), GeneMark ...
Molecular Plant Pathology
Volume 5 Issue 6 Page 515 - November 2004
Heading for disaster: Fusarium graminearum on cereal crops
RUBELLA S. GOSWAMI AND H. CORBY KISTLER
... This pipeline uses a combination of the programs FGENESH and FGENESH+ (Salamov and Solovyev, 2000) modified by Softberry ( http:/ / www.softberry.com ) with ...
Nucleic Acids Research
2004, Vol. 32, Database issue D41-D44
MIPS: analysis and annotation of proteins from whole genomes
H. W. Mewes et al
1 Institute for Bioinformatics (MIPS), GSF National Research Center for Environment and Health, Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany and 2 Technische Universitat Munchen, Chair of Genome Oriented Bioinformatics, Center of Life and Food Science, D-85350 Freising-Weihenstephan, Germany
... The genome of 40 Mb encodes 10 000 proteins automatically predicted by the program FGENESH (http://softberry. com), specifically trained for Neurospora. ...
Annual Review of Genomics and Human Genetics
Vol. 5: 15-56 (Volume publication date September 2004)
COMPARATIVE GENOMICS
Webb Miller, Kateryna D. Makova, Anton Nekrutenko, and Ross C. Hardison
The Center for Comparative Genomics and Bioinformatics, The Huck Institutes of Life Sciences, and the Departments of Biology, Computer Science and Engineering, and Biochemistry and Molecular Biology, Pennsylvania State University, University Park, Pennsylvania
... These algorithms include Genscan, the most popular gene prediction tool (24), GenMark
(117), FGENESH (155), GeneID (144), and others (for an excellent overview ...
DNA and Cell Biology
May 2004, Vol. 23, No. 5: 311-324
Harbinger Transposons and an Ancient HARBI1 Gene Derived from a Transposase
Vladimir V. Kapitonov , Jerzy Jurka
Genetic Information Research Institute, Mountain View, California.
... We used FGENESH (Salamov and Solovyev, 2000) and GeneScan (Burge and Karlin, 1997)
for the identification of exons and introns. The d N /d S ratio, ...
Nucleic Acids Research
2004, Vol. 32, Database issue D377-D382
BGI-RIS: an integrated information resource and comparative analysis workbench for rice genomics
Wenming Zhao et al
1 Beijing Genomics Institute (BGI), Chinese Academy of Sciences (CAS), Beijing Airport Industrial Zone-B6, Beijing 101300, China
... The contig sequences were annotated for gene content by using automated processes
that involve ab initio gene finders, such as FGENESH (http://www.softberry.com ...
Genome Research
14:1932-1937, 2004
Characterization of the Maize Endosperm Transcriptome and Its Comparison to the Rice Genome
Jinsheng Lai et al
1 Waksman Institute, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854, USA;
... A total of 54,397 putative genes could be predicted for the rice genome from this
data set (Table 3) using the FGENESH program with the default setting for ...
Plant Molecular Biology
Issue: Volume 54, Number 1 Date: January 2004 Pages: 55 - 69
Dynamics of the evolution of orthologous and paralogous portions of a complex locus region in two genomes of allopolyploid wheat
Xiu-Ying Kong1, 2, Yong Qiang Gu3, Frank M. You4, Jorge Dubcovsky4 and Olin D. Anderson3
1. Genetic Resources Conservation Program, University of California, Davis, CA 95616, USA
2. Institute of Crop Germplasm Resources, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
3. U.S. Dept. of Agriculture, Western Regional Research Center, Agricultural Research Service, 800 Buchanan Street, Albany, CA 94710, USA
4. Department of Agronomy and Range Sciences, University of California, Davis, CA 95616, USA
... FGENESH (http://www.softberry.com/berry.phtml) and GENES- CAN (http://genemark.
mit.edu/GENESCAN.html) were used for gene prediction. ...
Current Genetics
Issue: Volume 44, Number 6 Date: January 2004 Pages: 329 - 338
Chromosome rearrangements in isolates that escape from het-c heterokaryon incompatibility in Neurospora crassa
Qijun Xiang1 and N. Louise Glass1
Department of Plant and Microbial Biology, University of California, Berkeley, CA 94720-3102, USA
... Hypothetical proteins are predicted from FGENESH calls with overlapping Blastx
hits (but not with trusted homology), while Predicted ...
Molecular Genetics and Genomics
Issue: Volume 271, Number 4 Date: May 2004 Pages: 402 - 415
Genome-wide identification of NBS genes in japonica rice reveals significant expansion of divergent non-TIR NBS-LRR genes
T. Zhou et al
1. State Key Laboratory of Pharmaceutical Biotechnology, Department of Biology, Nanjing University, 210093 Nanjing, China
... to 5000-10,000 bp from both ends of the hits, and then the expanded nucleotide
fragments were reannotated using the gene-finding programs FGENESH (http:// www ...
Proc Natl Acad Sci U S A.
2004 June 15; 101(24): 9045-9050.
Genetic control of branching in foxtail millet
Andrew N. Doust et al
*Department of Biology, University of Missouri, 8001 Natural Bridge Road, St Louis, MO 63121; and ‡John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom
... Each of these contigs was scanned by using FGENESH (28), and identified ORFs were translated and compared with ORFs from other contigs from the same QTL region ...
Mol. Biol. Evol.
21(9):1769-1780. 2004
Merlin, a New Superfamily of DNA Transposons Identified in Diverse Animal Genomes and Related to Bacterial IS1016 Insertion Sequences
Cedric Feschotte1
Departments of Plant Biology and Genetics, The University of Georgia, Athens
... coding sequences were assembled by removing introns predicted with more than 85%
confidence by NetGene2 (http://www.cbs.dtu.dk) and/or FGENESH (http://genomic ...
Genome Research
14:1924-1931 ©2004
Gene Loss and Movement in the Maize Genome
Jinsheng Lai et al
1Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854-8020, USA; 2Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907-1392, USA
... The FGENESH program predicted four, of which three (gene 1d in the maize orp1 region; gene 5a, 5b in the rice r1 region) would produce truncated proteins ...
Internal Medicine Journal
Volume 34 Issue 3 Page 79 -90 - March 2004
Systematic genome-wide approach to positional candidate cloning for identification of novel human disease genes
H. Kiyosawa et al
Affiliations: 1Technology and Development team for Mammalian Cellular Dynamics, Bioresource Center, RIKEN Tsukuba Institute, Tsukuba, Ibaraki
...Page 1. Internal Medicine Journal 2004; 34: 79-90. O RIGINAL A RTICLE. Systematic
genome-wide approach to positional candidate. cloning ...
Molecular Microbiology
Volume 54 Issue 2 Page 407 - October 2004
Cryptococcus neoformans Kin1 protein kinase homologue, identified through a Caenorhabditis elegans screen, promotes virulence in mammals
Eleftherios Mylonakis et al
1Division of Infectious Diseases, Massachusetts General Hospital, Boston, MA 02114, USA.
... Sequences were compared with the H99 genome database at Duke University, and genes
predicted in these regions by FGENESH software ( http:/ / www.softberry.com ...
TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 5 Date: March 2004 Pages: 903 - 913
Characterization of soybean genomic features by analysis of its expressed sequence tags
Ai-Guo Tian et al
1. Plant Biotechnology Laboratory, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, 100101 Beijing, China
... six BAC-contig sequences of M. truncatula were analyzed and the results based on the gene prediction program FGENSH (Arabidopsis match/FGENESH prediction) (http ...
Current Proteomics,
Volume 1, Number 1, January 2004, pp. 41-48(8)
Annotation of the Human Genome by High-Throughput Sequence Analysis of Naturally Occurring Proteins
McGowan S.J.1; Terrett J.1; Brown C.G.1; Adam P.J.1; Aldridge L.1; Allen J.C.1; Amess B.1; Andrews K.A.1; Barnes M.1; Barnwell D.E.1
1: Oxford GlycoSciences plc, The Forum, 86 Milton Park, Abingdon, OX14 4RY, UK
... The polymorphic 'hypothetical transcriptome' was cons- tructed from transcripts
predicted by FGENES, FGENESH (Softberry Inc, Mount Kisco, NY, USA), GENSCAN ...
Chinese Science Bulletin
2004 Vol. 49 No. 4 355-362
The VER2 promoter contains repeated sequences and requires vernalization for its activity in winter wheat (Triticum aestivum L.)
XU Wenzhong et al
1. Research Center for Molecular Developmental Biology, Key Lab of Photosynthesis and Environmental Molecular Physiology, Institute of Botany, Chinese Academy of Sciences (CAS), Beijing 100093, China;
... Sequence analyses were finished using biological softwares on Internet, such as FGENESH 1.0 (Prediction of potential genes in Plant (Dct) genomic DNA). ...
TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 3 Date: February 2004 Pages: 392 - 400
Sequence variations of simple sequence repeats on chromosome-4 in two subspecies of the Asian cultivated rice
Can Li1, Yu Zhang1, Kai Ying1, Xiaolei Liang1 and Bin Han1
(1) National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China
... To characterize the possible relationship between SSRs and genes predicted by using
FGENESH, we investigated the distribution of SSRs in the rice chromosome-4 ...
Proc Natl Acad Sci U S A.
2004 June 29; 101(26): 9885-9890.
Long-range patterns of diversity and linkage disequilibrium surrounding the maize Y1 gene are indicative of an asymmetric selective sweep
Kelly Palaisa,* Michele Morgante, Scott Tingey, and Antoni Rafalski*
DuPont Crop Genetics, Molecular Genetics Group, 1 Innovation Way, Newark, DE 19711; *Department of Plant and Soil Sciences and Delaware Biotechnology Institute, University of Delaware, Newark, DE 19716
... The Y1 gene comprises a small uninterrupted gene island consisting of the Y1, an
MLO homolog lying immediately downstream of Y1, and an FGENESH-predicted gene ...
TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 8 Date: May 2004 Pages: 1449 - 1457
Positional cloning of the rice Rf-1 gene, a restorer of BT-type cytoplasmic male sterility that encodes a mitochondria-targeting PPR protein
H. Akagi et al
1. Laboratory of Plant Breeding and Genetics, Department of Biological Production, Faculty of Bioresource Sciences, Akita Prefectural University, Kaidoubata-Nishi 241-7, Shimoshinjyo-Nakano, 010-0195 Akita, Japan
... Software Develop- ment, Tokyo). Genomic sequences were also analyzed using
gene prediction programs, genescan and FGENESH. Table 1 DNA ...
Genome Research
14:942-950, 2004
The Ensembl Automatic Gene Annotation System
Val Curwen et al
1 The Wellcome Trust Sanger Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SA, UK; 2 EMBL European Bioinformatics Institute, The Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SD, UK; 3 The Broad Institute, Cambridge, Massachusetts 02141, USA
... Commonly, we use Genscan for ab initio prediction in human, mouse, and rat, but
the system is equally applicable to other methods such as FGENESH (Solovyev et ...
Gene
324 (2004) 105-115
Transcript abundance of rml1, encoding a putative GT1-like factor in rice, is up-regulated by Magnaporthe grisea and down-regulated by light
Rong Wang a,b, Guofan Honga,b, Bin Hana,*
National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China
... 1A and 2A). The structure of rml1 _ a is as same as that predicted by FGENESH software.
The 3V UTR of rml1 _ a is confirmed with the length of 596 bp. ...
Genome Biology
2004, 5:R46 doi:10.1186/gb-2004-5-7-r46
Identification of conserved gene structures and carboxy-terminal motifs in the Myb gene family of Arabidopsis and Oryza sativa L. ssp. Indica
Cizhong Jiang1, Xun Gu1, 2 and Thomas Peterson1
1Department of Genetics, Development and Cell Biology, and Department of Agronomy, Iowa State University, Ames, IA 50011, USA
2LHB Center for Bioinformatics and Biological Statistics, Iowa State University, Ames, IA 50011, USA
... FGENESH has been used successfully to predict genes in rice [9], and GenScan was
used together with it to predict genes by taking rice genomic sequences as ...
Molecular Microbiology
53 (5), 1307-1318. - September 2004
The sirodesmin biosynthetic gene cluster of the plant pathogenic fungus Leptosphaeria maculans
Donald M. Gardiner et al
1School of Botany, The University of Melbourne, Victoria, Australia 3010.
... http:/ / www.tigr.org . Putative genes were predicted using FGENESH software
at http:/ / www.softberry.com. Fungal culture. The wild type ...
Journal of Molecular Evolution
Issue: Volume 59, Number 6 Date: December 2004 Pages: 761 - 770
Analysis of the Molecular Evolutionary History of the Ascorbate Peroxidase Gene Family: Inferences from the Rice Genome
Felipe Karam Teixeira1, Larissa Menezes-Benavente1, Rogerio Margis1, 2 and Marcia Margis-Pinheiro1
(1) Laboratorio de Genetica Molecular Vegetal, Departamento de Genetica, UFRJ, 21944-970 Rio de Janeiro, Brasil
(2) Departamento de Bioquimica, Instituto de Quimica, UFRJ, 21944-970 Rio de Janeiro, Brasil
... Genomic se- quences were also analyzed in the FGENESH gene structure pre- diction
program (http://www.softberry.com/) (Solovyev 2001) and GeneMark program (http ...
Journal of Biotechnology
109 (2004) 217-226
Preparation of single rice chromosome for construction of a DNA library using a laser microbeam trap
Xiaohui Liu et al
A National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200233, China
... ers. These sequences were further annotated using gene-prediction software
FGENESH to give the pos- sible protein-coding region. ...
Science
2004, 303: 1364-1367.
Medicago truncatula DMI1 Required for Bacterial and Fungal Symbioses in Legumes
Ane et al. (2004).
... 17. HK Choi et al., Genetics, in press. 18. FGENESH, see www.softberry.com/berry.
phtml. 19. E. Bornberg-Bauer, E. Rivals, M. Vingron, Nucleic Acids Res. ...
Proc Natl Acad Sci U S A. 2004 August 24; 101(34): 12404-12410.
Inaugural Articles
Rapid recent growth and divergence of rice nuclear genomes
Jianxin Ma and Jeffrey L. Bennetzen*
Department of Genetics, University of Georgia, Athens, GA 30602
... Almost all LTR-retrotransposons, including solo LTRs, identified in our studies
were predicted as genes by the gene-finding program FGENESH (data not shown). ...
The Plant Journal
Volume 37 Issue 4 Page 517 -527 - February 2004
Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein
Xinli Sun, Yinglong Cao, Zhifen Yang, Caiguo Xu, Xianghua Li, Shiping Wang* and Qifa Zhang
National Key Laboratory of Crop Genetic Improvement, National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China
... al., 1997). Gene prediction programs used were genscan (Burge and Karlin,
1997) and FGENESH (http://www.softberry.com). Promoter ...
TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 3 Date: August 2004 Pages: 515 - 522
Physical mapping and putative candidate gene identification of a quantitative trait locus Ctb1 for cold tolerance at the booting stage of rice
K. Saito1 , Y. Hayano-Saito1, W. Maruyama-Funatsuki1, Y. Sato1 and A. Kato1
(1) National Agricultural Research Center for Hokkaido Region, Hitsujigaoka 1 , Toyohira, Sapporo, Hokkaido, 062-8555, Japan
... GENSCAN , RICEHMM , FGENESH , MZEF ), a splice prediction program ( SPLICEPREDIC-
TOR ), homology search analysis programs ( BLAST , HMMER , ...
TAG Theoretical and Applied Genetics
Issue: Volume 109, Number 4 Date: August 2004 Pages: 690 - 699
The anthracnose resistance locus Co-4 of common bean is located on chromosome 3 and contains putative disease resistance-related genes
M. Melotto1, 4 , M. F. Coelho1, A. Pedrosa-Harand2, J. D. Kelly3 and L. E. A. Camargo1
1. Departamento de Fitopatologia, Laboratorio de Genetica Molecular, ESALQ, Universidade de Sao Paulo, Piracicaba, SP, C.P. 9, 13418-900, Brazil
... and Karlin 1997; http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.
softberry.com/)-using Arabidopsis as the model or- ganism. ...
Journal of Genetics,
Vol. 83, No. 1, P. 79-99, April 2004
Structural and functional analysis of rice genome
Tyagi A. K. et al
Department of Plant Molecular Biology, University of Delhi South Campus, Benito Juarez Road,
New Delhi 110 021, India
... It inte- grates results from several gene prediction software such as GENSCAN (Burge
and Karlin 1997), FGENESH (Sala- mov and Solovyev 2000), RiceHMM (Sakata ...
The Plant Cell
16:1220-1234 (2004)
Comparative Analysis of the Receptor-Like Kinase Family in Arabidopsis and Rice
Shin-Han Shiua, et al
a Department of Ecology and Evolution, University of Chicago, Chicago, Illinois 60637
... a permissive E value cutoff of 1. The rice genes from the indica subspecies was
predicted using the whole genome shotgun assembly with FGENESH (Solovyev, 2002 ...
Genome Research
14:1474-1482 (2004) © by Cold Spring Harbor Laboratory Press ISSN 1088-9051/04;
Incongruent Patterns of Local and Global Genome Size Evolution in Cotton
Corrinne E. Grover,1 HyeRan Kim,2 Rod A. Wing,2 Andrew H. Paterson,3 and
Jonathan F. Wendel1,4
1Department of Ecology, Evolution, and Organismal Biology, Iowa State University, Ames, Iowa 50011, USA; 2Arizona Genomics Institute, University of Arizona, Tucson, Arizona 85721, USA; 3Plant Genome Mapping Laboratory, University of Georgia, Athens, Georgia 30602, USA
... Potential genes were predicted by three independent programs: FGENESH (http://www.softberry.com/), ...
Plant Physiology,
May 2004, Vol. 135, pp. 459-470
Rapid Genome Evolution Revealed by Comparative Sequence Analysis of Orthologous Regions from Four Triticeae Genomes
Yong Qiang Gu*, Devin Coleman-Derr, Xiuying Kong and Olin D. Anderson
United States Department of Agriculture-Agricultural Research Service, Western Regional Research Center, Albany, California 94710 (Y.Q.G., D.C.-D., O.D.A.); and Institute of Crop Germplasm Resources, Chinese Academy of Agricultural Sciences, Beijing 100081 China (X.K.)
... FGENESH (http://www.softberry.com/nucleo.html) and GENESCAN (http://genemark.
mit.edu/GENESCAN.htm) were used for gene prediction. ...
Plant Physiology, October 2004, Vol. 136, pp. 3177-3190
Comparative Sequence Analysis of the Region Harboring the Hardness Locus in Barley and Its Colinear Region in Rice1
Katherine S. Caldwell2, Peter Langridge and Wayne Powell*
Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, United Kingdom (K.S.C., W.P.); and School of Agriculture and Wine (K.S.C., P.L.) and Australian Centre for Plant Functional Genomics (P.L.), University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia
... jp/; Sakata et al., 2002 ), which couples the integration of several programs for
the prediction of open reading frames (GENSCAN, RiceHMM, FGENESH, MZEF) with ...
GENES & DEVELOPMENT 18:687-699, 2004
pyramus and thisbe: FGF genes that pattern the mesoderm of Drosophila embryos
Angelike Stathopoulos1, Bergin Tam1, Matthew Ronshaugen1, Manfred Frasch2 and Michael Levine1
1 Department of Molecular and Cell Biology, Division of Genetics & Development, University of California, Berkeley, California 94720-3204, USA; 2 Brookdale Department of Molecular Cell and Developmental Biology, Mount Sinai School of Medicine, New York, New York 10029, USA
... FGF protein sequences used in alignment and phylogenetic reconstruction were gathered from GenBank or inferred from genomic sequence using GENESCAN (Burge and Karlin 1997) and FGENESH...
Genome Research 14:1888-1901, 2004
Organization and Evolution of a Gene-Rich Region of the Mouse Genome: A 12.7-Mb Region Deleted in the Del(13)Svea36H Mouse
Ann-Marie Mallon et al
1 Medical Research Council Mammalian Genetics Unit, Harwell, Oxfordshire, United Kingdom; 2 Wellcome Trust Sanger Institute, Hinxton Genome Campus, United Kingdom; 3 Medical Research Council Rosalind Franklin Centre for Genomics Research, Hinxton Genome Campus, United Kingdom
... Ab initio gene structures were predicted using FGENESH (Salamov and Solovyev 2000) and GENSCAN...
Current Proteomics,
January 2004, vol. 1, no. 1, pp. 41-48(8)
Annotation of the Human Genome by High-Throughput Sequence Analysis of Naturally Occurring Proteins
Authors: McGowan S.J.1; Terrett J.1; Brown C.G.1; Adam P.J.1; Aldridge L.1; Allen J.C.1; Amess B.1; Andrews K.A.1; Barnes M.1; Barnwell D.E.1
Affiliations: 1: Oxford GlycoSciences plc, The Forum, 86 Milton Park, Abingdon, OX14 4RY, UK.
... The polymorphic 'hypothetical transcriptome' was cons- tructed from
transcripts predicted by FGENES, FGENESH (
Softberry Inc, Mount Kisco, NY, USA), GENSCAN ...
Plant Physiology , 2004
A Genome-Wide Screen Identifies Genes Required for Centromeric Cohesion
JJ Doyle, J Denarie, F Debelle, JC Prome, BB Amor, ...
... 17. HK Choi et al., Genetics, in press. 18. FGENESH, see www.softberry.com/berry.phtml. 19. E. Bornberg-Bauer, E. Rivals, M. Vingron, Nucleic Acids Res. ...
Proc Natl Acad Sci U S A.
2003 July 22; 100(15): 9055-9060.
Gene expression of a gene family in maize based on noncollinear haplotypes
Rentao Song and Joachim Messing*
Waksman Institute, Rutgers, The State University of New Jersey, 190 Frelinghuysen Road, Piscataway, NJ 08854-8020
.. The FGENESH program (Softberry, Mount Kisco, NY) was used for gene prediction analysis.
Fungal Genetics and Biology
Volume 39, Issue 1, June 2003, Pages 31-37
Analysis of loss of pathogenicity mutants reveals that repeat-induced point mutations can occur in the Dothideomycete Leptosphaeria maculans
Alexander Idnurm and Barbara J. Howlett
School of Botany, The University of Melbourne, Vic. 3010, Australia
... A 6088 bp sequence was obtained (GenBank AF525231) and an open reading frame of
529 amino acids was predicted with FGENESH software (www.softberry.com) with no ...
The Journal of Experimental Biology
206, 1275-1289 (2003)
doi: 10.1242/jeb.00261
Conservation of ecdysis-triggering hormone signalling in insects
Zitnan et al.,
1 Institute of Zoology, Slovak Academy of Sciences, Dubravska cesta 9, 84206 Bratislava, Slovakia
2 Institute of Medical Chemistry and Biochemistry, School of Medicine, Comenius University, Sasinkova 2, 81108 Bratislava, Slovakia
... The complete genomic sequence of the putative Anopheles eth gene was identified
using the Softberry FGENESH gene prediction program (Salamov and Solovyev, 2000 ...
BMC Genomics.
2003; 4: 22.
Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs
Sreedhar Oduru et al
1Department of Cell Biology & Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas. USA
... Two gene prediction programs were used FGENESH http://www.softberry.com/berry.phtml
and GENEMARK http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi?org=H ...
Insect Molecular Biology
Volume 12 Issue 4 Page 319 - August 2003
Expression of an Aedes aegypti cation-chloride cotransporter and its Drosophila homologues
V. Filippov, K. Aimanova and S. S. Gill
Affiliations. Department of Cell Biology and Neuroscience, University of California, Riverside, USA
... significant similarity to the Drosophila genes were used for gene structure prediction
with the FGENESH program available on site http:/ / www.softberry.com . ...
Developmental Biology
256 (2003) 276-289
tcl-2 encodes a novel protein that acts synergistically with Wnt signaling pathways in C. elegans
Xiaojun Zhao,a Hitoshi Sawa,b and Michael A. Hermana,*
a Program in Molecular, Cellular and Developmental Biology, Division of Biology, Kansas State University, Manhattan, KS, 66506, USA
b Laboratory for Cell Fate Decision, RIKEN, Center for Developmental Biology 2-2-3 Minatojima-minamimachi Chuo-ku, Kobe 650-0047, Japan
...CbTCL-2 is conceptually translated from a gene predicted by the FGENSH (Salamov and Solovyev, 2000; http://www.softberry.com) using defaults for C. elegans genomic sequences.
Proc Natl Acad Sci U S A.
2003 May 27; 100(11): 6569-6574.
Molecular paleontology of transposable elements in the Drosophila melanogaster genome
Vladimir V. Kapitonov* and Jerzy Jurka*
Genetic Information Research Institute, 2081 Landings Drive, Mountain View, CA 94043
...We used FGENESH (ref. 18; www.softberry.com) for identifying genes encoded by TEs.
Genetics and Molecular Biology
ISSN 1415-4757 version impresa
Genet. Mol. Biol. v.26 n.4 Sao Paulo dic. 2003
Iron homeostasis related genes in rice
Jeferson GrossI, II; Ricardo Jose SteinII; Arthur Germano Fett-NetoI, II; Janette Palma FettI, II
IUniversidade Federal do Rio Grande do Sul, Centro de Biotecnologia, Porto Alegre, RS, Brazil
...The prediction algorithms were GenScan (Burge and Karlin, 1997; http://genes.mit.edu/GENSCAN.html), GenomeScan (Burge and Karlin, 1997; http://genes.mit.edu/genomescan.html), FGENESH (Salamov and Solovyev, 2000; http://www.softberry.com/berry.phtml?topic= gfind), GeneMark.hmm (Borodovsky and Lukashin, unpublished; http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi) and GrailEXP (Xu and Uberbacher, 1997; http://compbio.ornl.gov/grailexp/)...
BMC Plant Biology 2003, 3:6
Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativa L)
Qian-Hao Zhu1,2, Mohammad Shamsul Hoque1,2, Elizabeth S Dennis1,2 and
Narayana M Upadhyaya*1,2
Address: 1CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia and 2NSW Agricultural Genomics Centre, Wagga Wagga, Australia
... Analyses of 10-kb sequence of the ~30-kb contig 239 from the China Rice Genome database harboring the BFL1 locus by gene prediction programs FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN...
..The ORF was identified by using FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN http://genes.mit.edu/GENSCAN.html.
Australasian Plant Pathology
Volume 32 Number 4 2003 pp. 511-519
Small scale functional genomics of the blackleg fungus, Leptosphaeria maculans: analysis of a 38 kb region
Alexander Idnurm, Janet L. Taylor, M. Soledade C. Pedras and Barbara J. Howlett
... vertebrate and Arabidopsis settings; Burge and Karlin 1997) and FGENESH on Neurospora
crassa and Schizosaccharomyces pombe settings (www.softberry.com), as ...
Barley Genetics Newsletter
Volume 32 Hard-copy edition pages 34 - 37
MAPPING AND SEQUENCING OF THE BARLEY PUTATIVE HYPERSENSITIVE INDUCED REACTION GENES
Nils Rostoks1, David Kudrna1 and Andris Kleinhofs1,2
1 Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164
2 School of Molecular Biosciences, Washington State University, Pullman, WA 99164
The full length coding sequence was reconstructed using a combination of FGENESH gene prediction program (http://www.softberry.com/) and alignment with cDNAs from the other barley HIR groups.
TAG Theoretical and Applied Genetics
Issue: Volume 43, Number 5 Date: August 2003 Pages: 351 - 357
Characterisation of the mating-type locus of the plant pathogenic ascomycete Leptosphaeria maculans
Anton J. Cozijnsen A1 and Barbara J. Howlett A1
A1 School of Botany The University of Melbourne 3010 Victoria Australia
...Genes, introns, exons and transcription initiation sites were predicted by analysis with FGENESH (www.softberry.com) on Neurospora crassa and...
BMC Plant Biol. 2003; 3: 6.
Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativa L)
Qian-Hao Zhu et al
1CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601, Australia
2NSW Agricultural Genomics Centre, Wagga Wagga, Australia
...Analyses of 10-kb sequence of the ~30-kb contig 239 from the China Rice Genome database harboring the BFL1 locus by gene prediction programs FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN http://genes.mit.edu/GENSCAN.html identified a single-exon gene capable of encoding a protein with the DNA binding domain of the EREBP/AP2 family of plant transcription factors [26,36], 1515 bp downstream from the Ds insertion.
.. The ORF was identified by using FGENESH http://www.softberry.com/berry.phtml/ and GENSCAN http://genes.mit.edu/GENSCAN.html. Alignment of EREBP/AP2 domains was performed using programs of Genetics Computer Group Wisconsin software suit [11].
Genetics,
Vol. 164, 655-664, June 2003, Copyright © 2003
Map-Based Cloning of Leaf Rust Resistance Gene Lr21 From the Large and Polyploid Genome of Bread Wheat
Li Huang et al
a Wheat Genetics Resource Center, Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506-5502
...In addition, FGENSH 1.1 (http://www.softberry.com) was used for gene prediction (with monocot genomic DNA parameters).
Nucleic Acids Research, 2003, Vol. 31, No. 1 229-233
The TIGR rice genome annotation resource: annotating the rice genome and creating resources for plant biologists
Qiaoping Yuan et al
The Institute for Genomic Research, 9712 Medical Center Dr., Rockville, MD 20850, USA
...The rice sequences were processed with multiple ab initio gene finders including FGENESH (http://www.softberry.com),...
... Working models were generated using the FGENESH output and putative identification for the gene was obtained from the most significant database match while models with no significant database match were labeled as hypothetical proteins.
Journal of Experimental Botany
, Vol. 54, No. 389, pp. 1995-1996, August 1, 2003
OsSET1, a novel SET-domain-containing gene from rice
Yun-Kuan Liang et al
PKU-Yale Joint Research Center of Agricultural and Plant Molecular Biology, National Key Laboratory of Protein Engineering and Plant Gene Engineering, College of Life Sciences, Peking University, 5 Yiheyuan Road, Beijing 100871, PR China
... It localizes at chromosome three in rice genome at the contig 1300 (http://www.softberry.com/berry.phtml?topic=gfind&prg=FGENESH; GenBank accession number ...
BMC Genomics 2003, 4:22
Gene discovery in the hamster: a comparative genomics approach for gene annotation by sequencing of hamster testis cDNAs
Sreedhar Oduru et al
Address: 1Department of Cell Biology & Biochemistry, Texas Tech University Health Sciences Center, Lubbock, Texas. USA
...Two gene prediction programs were used FGENESH http://www.softberry.com/berry.phtml and GENEMARK http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi?org=H.sapiens
TAG Theoretical and Applied Genetics
Issue: Volume 108, Number 5 Date: March 2004 Pages: 903 - 913
Characterization of soybean genomic features by analysis of its expressed sequence tags
Ai-Guo Tian et al
Plant Biotechnology Laboratory, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, 100101 Beijing, China
Beijing Genomics Institute, Chinese Academy of Sciences, 101300 Beijing, China
... prediction of these BAC-contig sequences was based on the gene-prediction program
FGENSH (Arabidopsis match/FGENESH
Nucleic Acids Research
2002, Vol. 30, No. I
31-34
MIPS: a database for genomes and protein sequences
 Morgenstern, M Munsterkotter, S Rudd,  Weil
... mewes@gsf.de. ACKNOWLEDGEMENTS We thank V. Solovyev (Softberry Inc., NY)
for providing and tuning the FGENSH program. This work was ...
Molecular Plant-Microbe Interactions
February 2002, Volume 15, Number 2
Pages 120-128
DOI: 10.1094/MPMI.2002.15.2.120
CPR1: A Gene Encoding a Putative Signal Peptidase That Functions in Pathogenicity of Colletotrichum graminicola to Maize
M. R. Thon, E. M. Nuckles, J. E. Takach, and L. J. Vaillanc
Department of Plant Pathology, S-305 Agricultural Sciences Center-North, University of Kentucky, Lexington 40546-0091, U.S.A.
... on-line from The Sanger Center's Computational Genomics Group); and a version of
FGENESH trained on N. crassa sequences (available on-line from Softberry, Inc ...
Fungal Genetics and Biology
Volume 36, Issue 3, August 2002, Pages 234-241
Size and complexity of the nuclear genome of the ectomycorrhizal fungus Paxillus involutus
Quere, Tomas Johansson and Anders Tunlid
Department of Microbial Ecology, Lund University, Ecology Building, S-223 62, Lund, Sweden
... gatech.edu/GeneMark/), the GlimmerM (www.tigr.org/softlab/glimmerm/), the ORF finder
(www.ncbi.nlm.nih.gov/gorf/), and the FgeneSH (www.softberry.com/nucleo ...
Drug discovery today
Vol. 7, No. 11 (Suppl.), 2002, S70-S76
www.drugdiscoverytoday.com
Genome annotation techniques: new approaches and challenges
Alistair G. Rust Emmanuel Mongin and *Ewan Birney
European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus Hinxton Cambridge UK CB10 1SD
... Examples of such prediction programs include Genscan [14] (used by Celera, ORNL
and Ensembl), FGENESH [15] (used in the Softberry and UCSC browsers as well as ...
Box 1. Useful human genome annotation and browser URLs
Human genome browsers
o UCSC Human Genome Browser: http://genome.cse.ucsc.edu/cgi-bin/hgGateway/
o Softberry Genome Explorer: http://www.softberry.com/berry.phtml?topic=genomexp
Ab initio gene prediction programs. Ab initio gene predictors rely on the statistical qualities of exons rather than on homologies. Examples of such prediction programs include Genscan [14] (used by Celera, ORNL and Ensembl), FGENESH [15] (used in the Softberry and UCSC browsers as well as Celera's pipeline) and GrailEXP [16] (ORNL).
Proc Natl Acad Sci U S A.
2002 August 20; 99(17): 11423-11428.
Identification of G protein-coupled receptors for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-receptor coevolution
Yoonseong Park,* Young-Joon Kim*, and Michael E. Adams*,
Departments of *Entomology and Cell Biology and Neuroscience, 5429 Boyce Hall,
University of California, Riverside, CA 92521
...For each Drosophila GPCR, prediction of gene structure was made in FGENESH (www.softberry.com; ref. 21) by using about 20 kb of genomic sequence surrounding highly conserved regions, particularly for 5 prime and 3 prime ends of ORFs.
Putative Drosophila GPCRs in the database were amplified by RT-PCR using primers based on gene predictions in the FGENESH gene finder (www.softberry.com; ref. 21).
21. Salamov A. A. & Solovyev, V. V. (2000) Genome Res. 10, 516-522....
Eukaryotic Cell,
October 2002, p. 719-724, Vol. 1, No. 5
Isocitrate Lyase Is Essential for Pathogenicity of the Fungus Leptosphaeria maculans to Canola (Brassica napus)
Alexander Idnurm and Barbara J. Howlett*
School of Botany, The University of Melbourne, Melbourne, Victoria 3010, Australia
... The DNA sequence obtained was compared to those in the GenBank database by using BLAST (1), and genes were predicted by using FGENESH software (http://www.softberry.com) and GENSCAN (www.bionavigator.com).
Biotech Software & Internet Report
November 2002, 3(5-6): 151-153. doi:10.1089/152791602321105834.
News
... sequence data. The genes are identified with the FGENESH11 gene modeling software
exclusively li- censed from Softberry, Inc. Automatic ...
Genome 2002 Oct;45(5):963-72.
Analysis of 106 kb of contiguous DNA sequence from the D genome of wheat reveals high gene density ...
SA Brooks, L Huang, BS Gill, JP Fellers
Department of Plant Pathology, Kansas State University, Manhattan 66506, USA.
... trix. In addition, FGENESH 1.1 (http://www.softberry.com) was used for CDS prediction with monocot genomic DNA parameters. Both ...
Molecular Genetics and Genomics
Issue: Volume 267, Number 6 Date: August 2002 Pages: 713 - 720
Genome sequencing of a 239-kb region of rice chromosome 10L reveals a high frequency of gene duplication and a large chloroplast DNA insertion
Q. Yuan, J. Hill, J. Hsiao, K. Moffat, S. Ouyang, Z. Cheng, J. Jiang, C. Buell
A1 The Institute for Genomic Research, 9712 Medical Center Drive, Rockville, MD 20850, USA
A2 Department of Horticulture, University of Wisconsin, Madison, WI 53706, USA
... The sequences were analyzed with several gene prediction programs, including FGENESH (http://www.softberry.com), Genemark.hmm (rice matrix; http://opal.biology ...
Genetics,
Vol. 162, 1389-1400, November 2002, Copyright © 2002
Different Types and Rates of Genome Evolution Detected by Comparative Sequence Analysis of Orthologous Segments From Four Cereal Genomes
Wusirika Ramakrishna et al
a Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907,
FGENESH (http://www.softberry.com/nucleo.html) with the maize training set was used for gene prediction in addition to GENSCAN (http://genes.mit.edu/GENSCAN.html) and GeneMark.hmm (http://genemark.biology.gatech.edu/Gene Mark/).
Nature
420, 316 - 320 (21 November 2002) | doi:10.1038/nature01183
Sequence and analysis of rice chromosome 4
Feng et al
National Center for Gene Research, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China
Chinese National Human Genome Center at Shanghai, 351 Guo Shoujing Road, Shanghai 201203, China
FGENESH used for annotation of rice chromosome 4.
Functional & Integrative Genomics
Issue: Volume 2, Numbers 1-2 Date: May 2002 Pages: 51 - 59
Genomic sequencing reveals gene content, genomic organization, and recombination relationships in barley
Nils Rostoks et al
A1 Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164, USA
... version 1.0 with maize parameters. The FGENESH predictions were run at http://www.softberry.com/. BAC genomic regions were defined ...
Genome 2003 Dec;46(6):1084-97
Structural organization of the barley D-hordein locus in comparison with its orthologous regions of wheat genomes
Gu et al.,
United States Department of Agriculture, Agriculture Research Service, Western Regional Research Center, Albany, CA 94710, USA
... et al. 1997) to search for additional genes. In addition, FGENESH (http://www.softberry.com/berry.phtml) and. GENESCAN (http://genes ...
PNAS
July 9, 2002 vol. 99 no. 14 9328-9333
The barley stem rust-resistance gene Rpg1 is a novel disease-resistance gene with homology to receptor kinases
R. Brueggeman et al
* Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420; Department of Plant Pathology, 495 Borlaug Hall, 1991 Upper Buford Circle, St. Paul, MN 55108-6030; and School of Molecular Biosciences, Washington State University, Pullman, WA 99164-4234
.. The gene prediction programs GENSCAN (http://genes.mit.edu/GENSCAN.html) and FGENESH (http://www.softberry.com), as well as NEURAL NETWORK PROMOTER PREDICTION (http://www.fruitfly.org/seq_tools/promoter.html) localized the putative transcription start site of the gene about 400 bp upstream of the translation start site.
Plant Physiol. 2002 December; 130(4): 1626-1635.
Contiguous Genomic DNA Sequence Comprising the 19-kD Zein Gene Family from Maize1
Rentao Song and Joachim Messing*
Waksman Institute, Rutgers, The State University of New Jersey, 190 Frelinghuysen Road, Piscataway, New Jersey 08854-8020
.. Draft sequences generated from high-throughput DNA sequencing (phase II) were subjected to gene prediction programs with FGENESH (Softberry, Inc., Mount Kisco, NY).
The Plant Cell, Vol. 14, 3213-3223, December 2002,
Structural Analysis of the Maize Rp1 Complex Reveals Numerous Sites and Unexpected Mechanisms of Local Rearrangement
Wusirika Ramakrishnaa, John Embertona, Matthew Ogdena, Phillip SanMiguelb and Jeffrey L. Bennetzen1,a
a Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907
b Purdue University Genomics Core, Purdue University, West Lafayette, Indiana 47907
... FGENESH (http://www.softberry.com/berry.phtml) with the monocot training set was
used for gene prediction, in addition to GENSCAN (http://genes.mit.edu/GENSCAN ...
Plant Physiol. 2002 December; 130(4): 1728-1738.
Comparative Sequence Analysis of the Sorghum Rph Region and the Maize Rp1 Resistance Gene Complex
Wusirika Ramakrishna, John Emberton, Phillip SanMiguel, Matthew Ogden, Victor Llaca, Joachim Messing, and Jeffrey L. Bennetzen
Department of Biological Sciences, Purdue University, West Lafayette, Indiana 47907 (W.R., J.E., M.O., J.L.B.); Purdue University Genomics Core, Purdue University, West Lafayette, Indiana 47907 (P.S.M.); and Waksman Institute, Rutgers University, Piscataway, New Jersey 08854 (V.L., J.M.)
...Annotation and sequence analysis were performed as described earlier (Dubcovsky et al., 2001 ; Song et al., 2001 ; Ramakrishna et al., 2002a ). FGENESH (http://www.softberry.com/berry.phtml) with the monocot training set was used for gene prediction in addition to GENSCAN (http://genes.mit.edu/GENSCAN.html) and GeneMark.hmm (http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi).
Rapid Genome Evolution Revealed by Comparative Sequence Analysis of Orthologous Regions from Four ...
YQ Gu, D Coleman-Derr, X Kong, OD Anderson
... FGENESH (http://www.softberry.com/nucleo.html) and GENESCAN (http://genemark.
mit.edu/GENESCAN.htm) were used for gene prediction. ...
Nature
419, 755 - 755 (17 Oct 2002) Technology Feature
Putting a name on it
Marina Chicurel
...used in the landmark publications of the draft human genome sequence. FGENESH, produced by software firm Softberry of Mount Kisco, New York,
proved particularly useful for the Syngenta-led annotation of the rice genome sequence. Good...
FGENESH_GC
PLoS ONE
2012, 7(9): e44264. doi:10.1371/journal.pone.0044264
Identification and Sequence Analysis of Metazoan tRNA 3?-End Processing Enzymes tRNase Zs.
Wang et al.,
Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, Nanjing, China
... The splicing pattern was verified using the Fgenesh and Fgenesh_GC programs provided at the Softberry website (http://linux1.softberry.com/berry.phtml??topic=fgenesh). ...
BMC Evolutionary Biology
2011, 11:219 doi:10.1186/1471-2148-11-219
A survey of green plant tRNA 3'-end processing enzyme tRNase Zs, homologs of the candidate prostate cancer susceptibility protein ELAC2
Fan et al.,
1 Laboratory of Yeast Genetics and Molecular Biology, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China
2 Jiangsu Key Laboratory for Microbes and Genomics, School of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China
...The splicing pattern was verified using the FGENESH and FGENESH_GC programs provided at the Softberry website...
Gene
Volume 451, Issues 1-2, 1 February 2010, Pages 6-14 doi:10.1016/j.gene.2009.08.018
Expression and regulation of IL-22 by bovine peripheral blood g/d T cells
Shi-Dong Ma, Cheryl A. Lancto, Shinichiro Enomoto, Mitchell S. Abrahamsen and Mark S. Rutherford
Department of Veterinary and Biomedical Sciences, University of Minnesota, 1988 Fitch Avenue, Room 295 AS/VM, St. Paul, MN 55108, USA
.. Genomic structure was deduced using FGENSH_GC program at http://www.softberry.com/berry.
phtml?topic=fgeneshgc&group=programs&subgroup=gfind, and cDNA-genomic nucleotide
sequences were aligned using Blast2 at http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2 ..
FGENES
Nucleosides, Nucleotides and Nucleic Acids
Volume 32, Issue 10, 2013 pages 529-554 DOI:10.1080/15257770.2013.832773
Gene Identification Programs in Bread Wheat: A Comparison Study
Nasiri et al.,
a Department of Agronomy and Plant Breeding, Division of Molecular Plant Genetics, College of Agricultural & Natural Resources , University of Tehran , Karaj , Tehran , Iran
b Department of Plant Biotechnology, College of Agricultural & Natural Resources , University of Tehran , Karaj , Tehran , Iran
... Ab initio gene finding in Drosophila genomic DNA. Genome Res., 10: 391–393. [CrossRef],
[PubMed] View all references ] is an HMM-based variant of Fgenes that can be easily utilized
online at softberry web server (http://linux1.softberry.com/berry.phtml). ...
Developmental & Comparative Immunology
Volume 34, Issue 2, February 2010, Pages 114-122 doi:10.1016/j.dci.2009.08.011
Presence of an unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes
Francisco Gambon-Deza a, b, Christian Sanchez-Espinelb, 1, and Susana Magadan-Mompoc, 2,
a Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain
b Shared Unity of Immunology, University of Vigo - Vigo University Hospital Complex (Hospital Meixoeiro), Edificio de Ciencias Experimentales, Rua das Abeleiras, Campus As Lagoas-Marcosende, Vigo 36310, Pontevedra, Spain
... immunoglobulin mRNAs. Limits of antibodies that were not yet published were
deduced following the instructions in the software FGENES (www.softberry.com) and
Augustus (http://augustus.gobics.de/submission). The results ...
J Mol Diagn.
2010 Jul;12(4):520-4. Epub 2010 May 27
Comprehensive characterization of a novel intronic pseudo-exon inserted within an e14/a2 BCR-ABL rearrangement in a patient with chronic myeloid leukemia
Sorel et al.,
Service Service d'Hematologie et Oncologie Biologique - INSERM U935, Centre Hospitalier Universitaire de Poitiers, 2, rue de la Miletrie, 86021 Poitiers Cedex, France.
... Georgia Institute of Technology, Atlanta, GA; version 3.0; 2005; available at http://exon.gatech.
edu/GeneMark/; accessed October 14, 2009), 6 and FGENES (SoftBerry, Mount Kisco, NY; 2007;
available at http://linux1.softberry.com/berry.phtml; accessed October 14, 2009 ...
Molecular Immunology
Volume 46, Issue 13, August 2009, Pages 2515-2523
The immunoglobulin heavy chain locus in the platypus (Ornithorhynchus anatinus)
F. Gambon-Deza, C. Sanchez-Espinel and S. Magadan-Mompo
aUnity of Inmunology, Vigo University Hospital Complex (CHUVI), Carretera de Madrid s/n., 36210 Vigo, Pontevedra, Spain
bArea of Immunology, Faculty of Biology, University of Vigo, Department of Biochemistry, Genetics and Immunology, Rua das Abeleiras, Campus As Lagoas-Marcosende, 36310 Vigo, Pontevedra, Spain
... Limits of antibodies that were not yet published (IGHD and IGHY) were deduced following the
instructions in the software FGENES (www.softberry.com) and Augustus (http://augustus.gobics.
de/submission) together with the results obtained upon comparison with the reptilian ...
Developmental & Comparative Immunology
Volume 34, Issue 2, February 2010, Pages 114-122
Presence of an unique IgT on the IGH locus in three-spined stickleback fish (Gasterosteus aculeatus) and the very recent generation of a repertoire of VH genes
F. Gambon-Deza, C. Sanchez-Espinel and S. Magadan-Mompo
a Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain
... immunoglobulin mRNAs. Limits of antibodies that were not yet published were
deduced following the instructions in the software FGENES (www.softberry.com) and
Augustus (http://augustus.gobics.de/submission). The results ...
Food and Chemical Toxicology
Volume 46, Issue 4, April 2008, Pages 1249-1256
SULT1C3, an orphan sequence of the human genome, encodes an enzyme activating various promutagens
Walter Meinl, Claudia Donath, Heiko Schneider Yasmin Sommer and Hansruedi Glat
German Institute of Human Nutrition (DIfE) Potsdam-Rehbru"cke, Department of Nutritional Toxicology, Arthur-Scheunert-Allee 114-116, 14558 Nuthetal, Germany
... SULT1 genes. No BLAST hit was observed for exon 4. It was found with the
FGENES algorithm (hosted by http://www.softberry.com). Its ...
Acta Phytopathologica et Entomologica Hungarica
Volume 43, Number 1/June 2008 pp. 1-13
Cloning and characterization of a HOG-type MAP kinase encoding gene from Fusarium proliferatum
A. L. Adam, G. Kohut, L. Hornok
Szent Istvan University Agricultural Biotechnology Center, Mycology Group of the Hungarian
Academy of Sciences, Institute of Plant Protection Pater K. u. 1 H-2103 Godollo Hungary
... Se- quence data were analyzed with the Lasergene (DNAStar Inc., USA) software
package and the FGENES program (http://www.softberry.com). ...
Plant Pathology
Volume 57 Issue 5, Pages 861 - 869 Published Online: 21 Mar 2008
Peroxidases in the early responses of different potato cultivars to infection by Potato virus YNTN
M. Milavec, K. Gruden, M. Ravnikar, M. Kovac
National Institute of Biology, Vecna pot 111, 1000 Ljubljana, Slovenia
... Intron/exon structure of the gene was determined using FGENES 1·0, available
online from SoftBerry (http://www.softberry.com/berry.phtml). ...
J. Biol. Chem.,
Vol. 281, Issue 40, 29753-29761, October 6, 2006
Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*
Juliette H. Faraco et al.,
Stanford University Center for Narcolepsy, Department of Psychiatry
and Behavioral Sciences, Stanford University, Stanford, California 94305,
the Howard Hughes Medical Institute, Stanford University, Stanford,
California 94305, and INSERM, U784, 75230 Paris, France
... rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify
potential first exons and/or splice donor sites. Signal ...
Cellular & Molecular Biology Letters
Volume 11, Number 2 / June, 2006 pp. 214-229
En/Spm-like transposons in Poaceae species: Transposase sequence variability and chromosomal distribution
Ahu Altinkut, Olga Raskina, Eviatar Nevo and Alexander Belyayev
Institute of Evolution, University of Haifa, Mt. Carmel, Haifa, 31905, Israel
... The TPase open reading frame was assembled by removing introns using the FGENES 2.0 Program
(http://www.softberry.com/berry.phtml?topic=fgenesh&group ...
Neuron
Volume 50 (2006), Issue 5, Pages 683-695
The Myotomal diwanka (lh3) Glycosyltransferase and Type XVIII Collagen Are Critical for Motor Growth Cone Migration
V. Schneider, M. Granato
University of Pennsylvania School of Medicine, Department of Cell and Developmental Biology, Philadelphia, Pennsylvania 19104
... Open reading frames within the diwanka interval were predicted with Genscan
(http://genes.mit.edu/GENSCAN.html) and Fgenes (http://www.softberry.com/berry.phtml ...
Bioinformatics
2005 21(9):1776-1781; doi:10.1093/bioinformatics/bti283
Gene finding for the helical cytokines
Darrell Conklin 1,*, Betty Haldeman 2 and Zeren Gao 2
1Department of Computing, City University London, United Kingdom
2ZymoGenetics Inc. Seattle, USA
... For comparison purposes, three other gene finding methods were also run on the same
dataset: Fgenes v1.6 (Solovyev et al., 1994), Genscan v1.0 (Burge and Karlin ...
Genes, Chromosomes and Cancer
Volume 43, Issue 1 , Pages 83 - 94 Published Online: 18 Feb 2005
Molecular cloning and characterization of FBXO47, a novel gene containing an F-box domain, located in the 17q12 band deleted in papillary renal cell carcinoma
Barbara Simon-Kayser et al
1Laboratoire d'Etude du Polymorphisme de l' ADN, Faculte de Medecine, Nantes, France
... html), GrailExp (http://grail.Isd.ornl.gov/grailexp), Fgenes (http://genomic.sanger.
ac.uk/gf/gf.shtml), and Genmark (http://www2.ebi.ac.uk/genemark). ...
Journal of Neurobiology
Volume 63, Issue 3 , Pages 235 - 254 Published Online: 4 Mar 2005
Shaw potassium channel genes in Drosophila
James J. L. Hodge 1 2, James C. Choi 2, Cahir J. O'Kane 1 *, Leslie C. Griffith 2
1Department of Genetics, University of Cambridge, Downing Site, Cambridge CB2 3EH, United Kingdom
2Department of Biology and Volen Center for Complex Systems, Brandeis University MS008, 415 South Street, Waltham, Massachusetts 02454-9110
... Intron/exon structure of Shawl was initially predicted using the Fgenes program
(Salamov and Solovyev, 2000) on the Baylor College of Medicine Genefinder ...
Current Proteomics,
January 2004, vol. 1, no. 1, pp. 41-48(8)
Annotation of the Human Genome by High-Throughput Sequence Analysis of Naturally Occurring Proteins
Authors: McGowan S.J.1; Terrett J.1; Brown C.G.1; Adam P.J.1; Aldridge L.1; Allen J.C.1; Amess B.1; Andrews K.A.1; Barnes M.1; Barnwell D.E.1
Affiliations: 1: Oxford GlycoSciences plc, The Forum, 86 Milton Park, Abingdon, OX14 4RY, UK.
... The polymorphic 'hypothetical transcriptome' was cons- tructed from transcripts predicted by Fgenes, FGENESH (Softberry Inc, Mount Kisco, NY, USA), GENSCAN ...
Nature Biotechnology
22, 1146 - 1149
5'-end SAGE for the analysis of transcriptional start sites
Hashimoto et al. (2004)..
...from expressed sequence tag (EST) maps, analysis of full-length cDNAs and computational annotation by Genscan, Genie, Fgenes and other programs.
Hemoglobin
Volume 28, Number 3 / 2004 255 - 259
An a-Thalassemia Phenotype in a Dutch Hindustani, Caused by a New Point Mutation that Creates an Alternative Splice Donor Site in the First Exon of the a2-Globin Gene
Cornelis L. Harteveld A1, Pierre W. Wijermans A2, Peter van Delft A1, Ellen Rasp A2, Hans L. Haak A2, Piero C. Giordano A1
A1 Hemoglobinopathies Laboratory, Leiden University Medical Center, PO Box 9503, 2300, Leiden, The Netherlands
A2 Leyenburg Hospital, The Hague, The Netherlands
... and GRAIL/ gap2 (Gene Recognition and Assembly Internet Link, Sequence exploration
and gene discovery Version 1.3), Genefinder, GENSCAN, Fgenes and HMMGene ...
Journal of Medical Genetics
2004;41:e52
Genomic organisation of the UDP-N-acetylglucosamine-1-phosphotransferase gamma subunit (GNPTAG) and its mutations in mucolipidosis III
A Raas-Rothschild et al
1 Department of Human Genetics, Hadassah University Medical Center, Jerusalem, Israel
... third intron is 9 kb. This structure was consistent with the exon prediction
of fgenes and Genscan. Each splice donor and acceptor ...
Current Biology
2004, Volume 14, Issue 19, Pages R832-R833
Dual capacity of a human olfactory receptor
M. Spehr, K. Schwane, S. Heilmann, G. Gisselmann, T. Hummel, H. Hatt
... (B) RT-PCR with intron spanning primers. Candidates for 5'UTR exons were identified
using FGENES and FEX software (SoftBerry, Mount Kisco, NY). ...
FGENES-M
Molecular Biology Reports
Volume 40, Issue 2 , pp 1201-1210 DOI: 10.1007/s11033-012-2162-2
Characterization of a vacuolar zinc transporter OZT1 in rice (Oryza sativa L.)
Lan et al.,
1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, People’s Republic of China
... genome database in GenBank with tblastn program. The identified homologous
sequence was further analyzed for predicting the complete ORF with FGENES-M
program (http://www.softberry.com). To verify the accuracy of gene ...
Molecular Biology Reports
Volume 36, Number 2 / February, 2009, pp. 281-287, DOI:10.1007/s11033-007-9177-0
Cloning and functional identification of two members of the ZIP (Zrt, Irt-like protein) gene family in rice (Oryza sativa L.)
Xia Yang 1, Ji Huang 1, Yan Jiang 1 and Hong-Sheng Zhang 1
(1) State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
... of China through tBLASTn algorithm program. The cDNA sequences of two putative
rice ZIP genes with a complete ORF were assembled using FGENES-M program
(http://www.softberry.com). Accord- ing to the predicted sequence ...
Molecular Biology Reports
Volume 35, Number 2 / June 2008 pp. 145-152
Molecular cloning and characterization of a novel SNAP25-type protein gene OsSNAP32 in rice ( Oryza sativa L.)
Yong-Mei Bao, Jian-Fei Wang, Ji Huang and Hong-Sheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
... The genome organization and chromo- some mapping of the OsSNAP32 were investigated
by the software FGENES-M at Softberry (http://www.softberry. ...
Molecular Genetics and Genomics
Volume 279, Number 3 / March, 2008 Pages 291-301
Cloning and characterization of three genes encoding Qb-SNARE proteins in rice
Yong-Mei Bao1, Jian-Fei Wang1, Ji Huang1 and Hong-Sheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
... The genome organization of three OsNPSNs were investigated using FGENES-M software
(http://www.softberry.com/berry.phtml) by comparing the cloned cDNAs with ...
Gene
Volume 415, Issues 1-2, 31 May 2008, Pages 1-12
Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses
Zhimin Gu et al.,
State key lab of crop genetics and germplasm enhancement, Nanjing Agricultural University, Nanjing, 210095, PR China
College of Chemistry and Life Science, Zhejiang Normal University, Jinhua, 321004, PR China
... Fgenes-M (http://www.softberry.com), Genscan (http://genes.mit.edu/GENSCAN.html),
BlastP (http://www.ncbi.nlm.nih.gov/BLAST/), National Centre for ...
Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1769, Issue 4, April 2007, Pages 220-227
A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif plays a role in salt tolerance
Ji Huang1, a, Xia Yang1, a, Mei-Mei Wang2, a, Hai-Juan Tanga, Ling-Yun Dinga, Yin Shena and Hong-Sheng Zhang, a,
aState Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
... probe sequence. The putative ORFs for these sequences were predicted with
FGENES-M program (http://www.softberry.com). ZFP182, one ...
BMC Bioinformatics. 2005; 6: 25.
Integrating alternative splicing detection into gene prediction
Sylvain Foissac1 and Thomas Schiex1
1Unite de Biometrie et Intelligence Artificielle, INRA, 31326 Castanet Tolosan, France
..This approach has been applied eg. in HMMgene or in FGENES-M (unpub.)...
Molecular Biology Reports
Volume 32, Number 3 / September, 2005 pp.177-183
Rice ZFP15 Gene Encoding for a Novel C2H2-type Zinc Finger Protein Lacking DLN box, is Regulated by Spike Development but not by Abiotic Stresses
Ji Huang1, Jianfei Wang1 and Hongsheng Zhang1
(1) State Key Laboratory of Crop Genetics and Germplasm Enhancement, Rice Research Institute, Nanjing Agricultural University, Nanjing, 210095, China
... sequence. These sequences were analyzed with FGENES-M program (http://www.
softberry.com) for predict- ing the complete ORFs. The ...
DNA Sequence - The Journal of Sequencing and Mapping
Volume 15, Number 1 / February 2004 39 - 43
Isolation and Characterization of Two cDNAs Encoding Translation Initiation Factor 1A from Rice(Oryza sativa L.)
Ji Huang, Jianfei Wang, Shengping Qiu, Hongsheng Zhang
State Key Laboratory of Crop Genetics and Germplasm Enhancement Rice Research Institute Nanjing Agricultural University 210095 Nanjing People's Republic of China
... Then the ORF without introns was assembled based on the sequence of each scaffold
using the program FGENES-M (http://www. softberry.com). ...
Plant Science
Volume 169, Issue 3, September 2005, Pages 470-477
Cloning and characterization of a novel rice gene family encoding putative dual-specificity protein kinases, involved in plant responses to abiotic and biotic stresses
Zhimin Gu, Jianfei Wang, Ji Huang and Hongsheng Zhang
National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Department of Agronomy, Nanjing 210095, China
... genomic contigs having higher homology with the probe were obtained for prediction
and assembling of putative ORFs by FGENES-M program (http://www.softberry.co
FGENESH-M
BMC plant biology
(2013). 13(1), 176. DOI:10.1186/1471-2229-13-176
An apple MYB transcription factor, MdMYB3, is involved in regulation of anthocyanin biosynthesis and flower development
Vimolmangkang, S., Han, Y., Wei, G., & Korban, S. S.
1 Department of Natural Resources and Environmental Sciences, University of Illinois, 1201 W. Gregory, Urbana, IL 61801, USA
2 Department of Pharmacognosy, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand
... Recovery of cDNA sequence encoding MdMYB3 in apple The genomic sequences
encoding MdMYB3 were analyzed using FGENESH-M program (http://www. softberry.
com), and an open reading frame (ORF) was predicted. ...
J. Exp. Bot.
(2012) 63 (1): 471-488.
doi: 10.1093/jxb/err295
Two SERK genes are markers of pluripotency in Cyclamen persicum Mill.
Savona et al.,
1‘Sapienza’ University of Rome, Dept. of Environmental Biology, Rome, Italy
2‘Sapienza’ University of Rome, Dept. of Biology and Biotechnology, Rome, Italy
... programs (http://www.expasy.org/prosite/). ORFs were found with FGENESH-M
(fgenesh-m; http://linux1.softberry.com/berry.phtml?topic=fgenesh-m&group=
programs&subgroup=gfind). Phylogenetic analysis was performed by ...
Med. Chem. Commun.
2012,3, 987-996 DOI: 10.1039/C2MD20029E
Comparative analysis of the biosynthetic systems for fungal bicyclo[2.2.2]diazaoctane indole alkaloids: the (+)/(?)-notoamide, paraherquamide and malbrancheamide pathways
Shengying Li et al.,
... Phq protein). a Genes were predicted using the FGENESH-M tool from
http://www.softberry.com; functions of gene products were predicted using BLAST
search.b -: Homology cannot be calculated due to unrelatedness. NotA ...
J. Proteome Res.
2011, 10 (10), pp 4478–4504
DOI: 10.1021/pr200284e
Genomics, Transcriptomics, and Peptidomics of Daphnia pulex Neuropeptides and Protein Hormones
Dircksen et al.,
Department of Zoology, Stockholm University, Sweden
Institute of Zoology, University of Cologne, Cologne, Germany
Department of Biology, K.U. Leuven, Belgium
... More detailed analyses and novel annotations of genes, their exon-intron boundaries were
performed usually with aid of Fgenesh-M gene finding tools (Softberry Inc., Mount Kisco, NY;
http://linux1.softberry.com/berry.phtml?topic=fgenesh-m&group=programs&subgroup=gfind ...
Biochemical and Biophysical Research Communications
Volume 354, Issue 3, 16 March 2007, Pages 668-675
Sp-tetraKCNG: A novel cyclic nucleotide gated K+ channel
Blanca Estela Galindo, Jose Luis de la Vega-Beltran, Pedro Labarca, Victor D. Vacquier and Alberto Darszon
Depto. de Genetica del Desarrollo y Fisiologia Molecular del Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo Postal 510-3, Cuernavaca, Morelos 62271, Mexico
... 3?-RACE was performed to obtain the 3?-end, and the 5?-end (684 nucleotides) was
predicted by FGENESH-M, a program at the Softberry website (http://www ...
DNA Sequence - The Journal of Sequencing and Mapping
Volume 17, Number 1 / February 2006 pp. 24 - 30
Isolation and characterization of a new Na+/H+ antiporter gene OsNHA1 from rice (Oryza sativa L.)
Zhou et al.,
Nanjing Agricultural University, State key laboratory of crop genetics and germplasm enhancement, Nanjing, 210095, China
... An expected cDNA sequence containing a complete open reading frame (ORF)
was predicted using FGENESH-M program (http://www.softberry. ...
BESTORF
BMC Genomics
2013, 14:695 doi:10.1186/1471-2164-14-695
Histoplasma yeast and mycelial transcriptomes reveal pathogenic-phase and lineage-specific gene expression profiles
Edwards et al.,
1 The Department of Microbiology, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA
2 The Department of Microbial Infection and Immunity, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA
... Separately, the RNA-seq short reads were assembled into transcript contigs de novo (ie,
independent of the reference genome sequence) using Inchworm [39] and open reading frames
extracted from the transcripts with BestORF (Molquest package, Softberry). ...
PloS one
September 02, 2013DOI: 10.1371/journal.pone.0073560
Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family
Vanessa Rodrigues Paixao-Cortes, Francisco Mauro Salzano, Maria Catira Bortolini
Departamento de Genetica and Programa de Pos-Graduacao em Genetica e Biologia Molecular, Instituto de Biociencias, Universidade Federal do Rio Grande do Sul, Porto Alegre, Rio Grande do Sul, Brazil
... The genomic sequences of possible unannotated orthologs were verified using three programs
that can predict open reading frames (ORF): BESTORF (http://linux1.softberry.com/berry.phtml??
topic=bestorf&group=programs&subgroup=gf?ind), GeneWise (http://www.ebi.ac.uk ...
Nature Biotechnology
30, 549–554 (2012) doi:10.1038/nbt.2195
Genome sequence of foxtail millet (Setaria italica) provides insights into grass evolution and biofuel potential
Zhang et al.,
BGI-Shenzhen, Chinese Ministry of Agriculture, Key Lab of Genomics, Shenzhen, China.
... Open reading frames (ORFs) were predicted using BESTORF (http://linux1.softberry.com/berry.phtml?topic=bestorf&group=programs&subgroup=gfind) with parameters trained on monocot genes without filtering of UTRs. ...
Phytopathology
August 2012, Volume 102, Number 8
Pages 741-748
http://dx.doi.org/10.1094/PHYTO-02-12-0021-R
Role of the Pathotype-Specific ACRTS1 Gene Encoding a Hydroxylase Involved in the Biosynthesis of Host-Selective ACR-Toxin in the Rough Lemon Pathotype of Alternaria alternata
Izumi et al.,
Faculty of Agriculture, Kagawa University, Miki, Kagawa 761-0795 Japan; Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430.
... Shimadze, Tsukuba, Japan). Putative open reading frames (ORFs) were identified
using BESTORF (http://linux1.softberry. com/berry.phtml) from the sequence of the
respective contigs by mass sequencing. Transcripts of ACRTS1 ...
Fungal Genetics and Biology
Volume 49, Issue 6, June 2012, Pages 470–482 DOI: 10.1016/j.fgb.2012.04.001
Transcriptome analysis of enriched Golovinomyces orontii haustoria by deep 454 pyrosequencing
We?ling et al.,
a Max-Planck-Institute for Plant Breeding Research, Department of Plant–Microbe Interactions, Carl-von-Linne-Weg 10, 50829 Cologne, Germany
b Max-Planck-Institute for Molecular Genetics, Ihnestrasse 63-73, D-14195 Berlin-Dahlem, Germany
... Open reading frames were predicted from these contigs using BestORF with the Sclerotinia
sclerotiorum matrix (Softberry, Mount Kisco, NY, USA). Predicted proteins were then
annotated by Blast2Go (Conesa et al. 2005) using default parameters. ...
PLoS Pathog
8(4): e1002643. doi:10.1371/journal.ppat.1002643
Sequential Delivery of Host-Induced Virulence Effectors by Appressoria and Intracellular Hyphae of the Phytopathogen Colletotrichum higginsianum.
Kleemann et al.,
Department of Plant-Microbe Interactions, Max-Planck-Institute for Plant Breeding Research, Cologne, Germany
Central Microscopy Max-Planck-Institute for Plant Breeding Research, Cologne, Germany
...ORFs were predicted from EST contigs with the Fusarium matrix of BESTORF (Molquest package, Softberry). ...
Nature
479, 529–533 (24 November 2011) doi:10.1038/nature10553
Ascaris suum draft genome
Jex et al.,
Faculty of Veterinary Science, The University of Melbourne, Parkville, Victoria 3010, Australia
BGI-Shenzhen, Shenzhen, 518083, China
...The open reading frame of each gene was predicted using BestORF (http://www.softberry.com). ...
PLoS ONE
2011, 6(2): e14697. doi:10.1371/journal.pone.0014697
ENCODE Tiling Array Analysis Identifies Differentially Expressed Annotated and Novel 5? Capped RNAs in Hepatitis C Infected Liver.
Folkers et al.,
Department of Medicine, University of Utah, Salt Lake City, Utah, United States of America
Huntsman Cancer Institute, University of Utah, Salt Lake City, Utah, United States of America
...The use of a sequence analysis tool (BESTORF, www.softberry.com) to predict potential coding fragments in these unannotated sequences,...
MAKARA OF SCIENCE SERIES,
VOL 15, NO 2 (2011)
ISOLATION, CLONING AND CHARACTERIZATION OF ACTIN-ENCODING CDNAS FROM JATROPHA CURCAS L. IP-2P
Ratna Yuniati, Utut Widyastuti, Didy Sopandie, Akiho Yokota, Suharsono
... tool) (http://www.ncbi.nlm.nih. gov/BLAST/) program. The analysis of open reading
frame (ORF) was carried out by using BESTORF program (http://www.softberry/bestorf/
htm). Phylogenetic analyses were conducted using MEGA ...
Appl. Comput. Math.
V.9, Special Issue, 2010, pp. 19-33
POSSIBLE FUNCTIONAL AND EVOLUTIONARY ROLE OF PLASTID DNA INSERTIONS IN RICE GENOME
YAGUT YU. AKBAROVA 1,2, VICTOR V. SOLOVYEV 3, ILHAM A. SHAHMURADOV 1
1 Bioinformatics Laboratory, Institute of Botany, Baku AZ1073, Azerbaijan
2 College of Medicine and Health Sciences, Sultan Qaboos University, Muscat, Sultanate of Oman
3 Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20, UK
... of amino acid sequences has been carried out by BLAST program [1]. Search for statistically
significant open reading frames (ORFs) and putative target compartments of proteins were done
by BESTORF and ProtComp programs, respectively (http://www.softberry.com). ...
BMC Genomics.
2010 Jul 8;11:422
Comparative analysis of secreted protein evolution using expressed sequence tags from four poplar leaf rusts (Melampsora spp.)
Joly DL, Feau N, Tanguay P, Hamelin RC.
Natural Resources Canada, Canadian Forest Service, Laurentian Forestry Centre, 1055 du PEPS, P,O, Box 10380, Stn, Sainte-Foy, Quebec, QC, G1V 4C7, Canada.
... gene models. Initial ORF prediction for Melampsora spp. was generated with the bestORF
algorithm (Softberry) using Ustilago parameters. Sequence analysis Similarity searches
for full length sequences and conserved domains were performed ...
Molecular Vision
2009; 15:2544-2553
Phenotypic characterisation and ZEB1 mutational analysis in posterior polymorphous corneal dystrophy in a New Zealand population
Vincent et al.,
1Department of Ophthalmology, New Zealand National Eye Centre, Faculty of Medical and Health Science, University of Auckland, Auckland, New Zealand; 2Ophthalmology Department, Greenlane Clinical Centre, Auckland District Health Board, Auckland, New Zealand
... Prediction of potential coding fragment in the reference mRNA (NM_0030751.4) sequence
containing the c.1A?G was performed using the BESTORF program (Softberry.Inc, Mount Kisco,
NY), and predicted translation initiation at nucleotide 788 which encodes the methionine ...
BMC Evolutionary Biology
2009, 9:97 doi:10.1186/1471-2148-9-97
Identification, distribution and molecular evolution of the pacifastin gene family in Metazoa
Bert Breugelmans, Gert Simonet, Vincent van Hoef, Sofie Van Soest, Jozef, Vanden Broeck
Department of Animal Physiology and Neurobiology, Zoological Institute, K.U.Leuven, Naamsestraat 59, B-3000 Leuven, Belgium
... presence of a signal peptide were predicted using BESTORF (http://www.softberry.com) and
SignalP (http://www.cbs.dtu.dk/services/SignalP/), respectively. ... If no complete ORF was found,
the Softberry splice finder tool (FSPLICE) was used to search the missing ...
FEBS Journal
Volume 275 Issue 6 Page 1103-1117, March 2008
Succinate dehydrogenase flavoprotein subunit expression in Saccharomyces cerevisiae– involvement of the mitochondrial FAD transporter, Flx1p
Teresa A. Giancaspero 1,
Robin Wait 2,
Eckhard Boles 3,
Maria Barile
1 Dipartimento di Biochimica e Biologia Molecolare "E. Quagliariello", Universita degli Studi di Bari, Italy
2 Kennedy Institute of Rheumatology Division, Faculty of Medicine, Imperial College London, UK
3 Institut fu"r Molekulare Biowissenschaften, J.W. Goethe-Universitat, Frankfurt am Main, Germany
... Both the NCBI tool orf finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html)
and the bestorf gene prediction program from Softberry Inc. ...
Microbiology
154 (2008), 1204-1217; DOI 10.1099/mic.0.2007/014944-0
Identification of soluble secreted proteins from appressoria of Colletotrichum higginsianum by analysis of expressed sequence tags
Jochen Kleemann, Hiroyuki Takahara, Kurt Stu"ber and Richard O'Connell
Max-Planck-Institute for Plant Breeding Research, Department of Plant–Microbe Interactions, D-50829 Koln, Germany
... different reading frame. BESTORF (Softberry) was used to confirm the ORF
of selected unique sequences. Proteins were considered ...
GENES & DEVELOPMENT
21:708-718, 2007
Ultraconserved elements are associated with homeostatic control of
splicing regulators by alternative splicing and nonsense-mediated decay
Julie Z. Ni et al.,
Center for Molecular Biology of RNA and Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz, Santa Cruz, California 95064, USA
... Once the transcripts are predicted, an ORF finder (BESTORF from Softberry,
http://www.softberry.com) is used to find the best ORF. ...
Eukaryotic Cell, March 2005, p. 526-535, Vol. 4, No. 3
Sex-Specific Homeodomain Proteins Sxi1 and Sxi2a Coordinately Regulate Sexual Development in Cryptococcus neoformans
Christina M. Hull,1, Marie-Josee Boily,1 and Joseph Heitman1,2*
Department of Molecular Genetics and Microbiology,1 the Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina2
... Sequence manipulations. Splice predictions of candidate gene sequences
for SXI2a
were facilitated with a Softberry algorithm (www.softberry.com). ...
...We utilized the BESTORF gene prediction algorithm
from Softberry, Inc., to electronically produce predicted spliced cDNA
products encoded by a 10-kb region....
SPL
Molecular and Cellular Endocrinology
Volume 348, Issue 1, 2 January 2012, Pages 313–321
Two novel mutations in the thyroglobulin gene as cause of congenital hypothyroidism: Identification a cryptic donor splice site in the exon 19
Hector M. Targovnik et al.,
a Laboratorio de Biologia Molecular, Catedra de Genetica y Biologia Molecular, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires, 1113 Buenos Aires, Argentina
b Unidad de Medicina Molecular, Departamento de Medicina, Facultad de Medicina, Universidad de Salamanca, 37007 Salamanca, Spain
c Service d’Endocrinologie Pediatrique, Hopital des Enfants, Centre Hospitalier Universitaire de Toulouse, 31059 Toulouse Cedex 9, France
... Searching for potential 5?ss sequences in the TG gene spanning exon 19 and intron 19 was
accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.html), Fsplice
(http://linux1.softberry.com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind), SPL ...
Genome
2011, 54(12): 1041-1044, DOI: 10.1139/g11-068
Isolation of a strawberry gene fragment encoding an actin depolymerizing factor-like protein from genotypes resistant to Colletotrichum acutatum
Marta Ontivero, a Gustavo Martinez Zamor a,b Sergio Salazar, c Juan Carlos Diaz Ricci, b Atilio Pedro Castagnaro a
Seccion Biotecnologia, Estacion Experimental Agroindustrial Obispo Colombres-Unidad Asociada al INSIBIO, Av. William Cross 3150, 4101 Las Talitas, Tucuman, Argentina.
bInstituto Superior de Investigaciones Biologicas (INSIBIO; CONICET- UNT) and Instituto de Quimica Biologica “Dr. Bernabe Bloj”, Universidad Nacional de Tucuman. Chacabuco 461, 4000 Tucuman. Argentina.
... The deduced amino acid sequence showed identity scores ranging between 93% and 60%,
with E values comprised between 1 ? 10 –37 and 6 ? 10 –44 . The gene prediction programs
SPL and FGENESH 2.6 (www.softberry.com) (Solovyev et al. ...
J Med Genet
2010 47: 8-21 originally published online July 1, 2009 doi: 10.1136/jmg.2009.067249
Mutations in 3 genes (MKS3, CC2D2A and
RPGRIP1L) cause COACH syndrome (Joubert
syndrome with congenital hepatic fibrosis)
Doherty et al.,
1University of Washington,
Seattle, Washington, USA
2National Institutes of Health,
Bethesda, Maryland, USA
... the likelihood that missense mutations would be deleterious was made using the PolyPhen
program.42 NetGene2 (www.cbs.dtu.dk/services/NetGene2/), Genie (www.fruitfly.org/seq_tools/
splice.html), Human Splicing Finder (www.umd.be/HSF/), SPL (linux1.softberry.com), and ...
Molecular breeding
2010, vol. 25, no4, pp. 699-722
Development of SSR markers and construction of a consensus genetic map for chicory (Cichorium intybus L.)
Cadalen et al.,
1) GIS CARTOCHIC, USTL, 59655, Villeneuve d’Ascq, France
(2) UMR USTL/INRA 1281 «Stress Abiotiques et Differenciation des Vegetaux Cultives», ERT 1067, Universite de Lille 1, 59655, Villeneuve d’Ascq, France
... Intron positions were determined and then compared to predictions by models for intron/exon
boundaries determination with RNA SPL tool, http://www.softberry.com/berry.phtml or GeneMark
cDNA, http://opal.biology.gatech.edu/Gene Mark/genemark_cDNA_all.cgi. ...
J Med Genet
doi:10.1136/jmg.2009.067249
Mutations in 3 genes (MKS3, CC2D2A and RPGRIP1L) cause COACH syndrome (Joubert syndrome with congenital hepatic fibrosis)
Doherty et al.,
University of Washington, United States
... likelihood that missense mutations would be deleterious was made using the PolyPhen
program.[42] NetGene2 (www.cbs.dtu.dk/services/NetGene2/), Genie (www.fruitfly.org/seq_tools/
splice.html), Human Splicing Finder (www.umd.be/HSF/), SPL (linux1.softberry.com), and ...
European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21
Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut
site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda
Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China
2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China
...to search for cDNA and genomic DNA of SEDL-related splice variants.7 The FSPLICE
1.0 and SPL platforms (http://www.softberry.com/) were used to predict potential splice sites in genomic DNA. SPLM was implemented to substitute for SPL..
Blood Coagulation & Fibrinolysis.
19(3):240-242, April 2008.
Four novel FXI gene mutations in three factor XI- deficient patients
de Raucourt, Emmanuelle, de Mazancourt, Philippe, Quelin, Florence
Laboratory of Haematology, Poissy-Saint-Germain-en-Laye Hospital, France.
... exon 7, but an exon prediction software did not show an effect on the probability
of splicing (website: http://www.softberry.com/cgi-bin/programs/gfind/spl.pl ...
Annals of Human Genetics
Volume 71 Issue 3 Page 325-335, May 2006
Common Polymorphisms in the CACNA1H Gene Associated with
Childhood Absence Epilepsy in Chinese Han Population
J. Liang et al.,
Department of Pediatrics, Peking University, First Hospital, Beijing, 100034, P. R. China
... cmpharm.ucsf.edu/ ), transcription factor binding sites (NIH, http:/ /
thr.cit.nih.gov/ molbio/ ), potential splicing sites (SPL, http:/ / softberry.com/ ...
J. Biol. Chem.,
Vol. 281, Issue 40, 29753-29761, October 6, 2006
Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*
Juliette H. Faraco et al.,
Stanford University Center for Narcolepsy, Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California 94305, the Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, and ¶INSERM, U784, 75230 Paris, France
... rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify
potential first exons and/or splice donor sites. Signal ...
The National Academy of Sciences
Proc Natl Acad Sci U S A. 2003 November 25; 100(Suppl 2): 14537-14542.
Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster
Hugh M. Robertson,* Coral G. Warr,and John R. Carlson
*Department of Entomology, University of Illinois, 505 South Goodwin Avenue, Urbana,
IL 61801; School of Biological Sciences, Monash University, Clayton VIC 3800, Australia;
and Department of Molecular, Cellular, and Developmental Biology, Yale University,
New Haven, CT 06520
The genes were reconstructed manually in the PAUP editor (23) by using the
expected exon/intron structures as guides and the SPL program (Softberry, www.softberry.com/berry.phtml) to locate predicted introns.
SPLM
Hum. Mol. Genet.
(2012) 21 (16): 3647-3654. doi: 10.1093/hmg/dds194
Deep intronic mutation in OFD1, identified by targeted genomic next-generation sequencing, causes a severe form of X-linked retinitis pigmentosa (RP23)
Webb et al.,
1UCL Institute of Ophthalmology, 11-43 Bath Street, London EC1V 9EL, UK,
2Jules Stein Eye Institute, University of California, 200 Stein Plaza, CA 90095-7000, USA
... SplicePredictor, http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi. FSplice, http://linux1.softberry.
com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind. SPLM, http://linux1.softberry.
com/berry.phtml?topic=splm&group=programs&subgroup=gfind. ...
European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21
Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut
site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda
Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China
2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China
... 7 The FSPLICE 1.0 and SPL platforms (http://www.softberry.com/) were used to predict
potential splice sites in genomic DNA. SPLM was implemented to substitute ...
Fex
Journal of plant physiology
2016, 195, 31-38. doi:10.1016/j.jplph.2016.03.004
In silico characterization of DNA motifs associated with the differential expression of the ornithine decarboxylase gene during in vitro cystocarp development in the red seaweed Grateloupia imbricata
Montero-Fernandez, M., Robaina, R. R., Garcia-Jimenez, P.
Departamento de Biologia, Facultad de Ciencias del Mar, Universidad of Las Palmas de Gran Canaria, E-35017 Las Palmas de Gran Canaria, Canary Islands, Spain
... FEX: http://linux1.softberry.com/berry.phtml?topic=fex&group=
programs&subgroup=gfind, Finding potential 5?-, internal and 3'-coding exons. ...
IUBMB Life
2015, Volume 68, Issue 2, pages 122–135, February 2016 DOI: 10.1002/iub.1464
Identification of differentially expressed three novel transcript variants of mouse ARNT gene
Ishqi, H. M., Ur Rehman, S., Sarwar, T., Husain, M. A., Tabish, M.
Institute
... finding tools. Gene finding tools used in our study were HMM gene (http://www.cbs.
dtu.dk/services/HMMgene/), Genebuilder (http://www.itba.mi.cnr.it/webgene/) and
FGENESH (http://linux1.softberry.com/berry.phtml). "Fex" available ...
International Journal of Bioinformatics Research and Applications
Volume 9, Number 6/2013, pp. 557-575 DOI: 10.1504/IJBRA.2013.056630
In–silico analysis for RNA–interference mechanism of a–synuclein to treat Parkinson's disease
S. Seema 1, R. Seenivasagam 2, K. Hemavathi 3
1Department of Bioinformatics, University of East London, Docklands Campus, University Way, London E16 2RD, UK
2Division of Drug Discovery and Development, Center of Molecular and Computational Biology, Department of Botany, St. Joseph's College, P.B. 27094, 36, Langford Road, Bangalore, Karnataka 560027, India
3Department of Bioinformatics, School of Chemical and Biotechnology, SASTRA University, Thanjavur - 613 402, Tamil Nadu, India
... 2009). The FEX program (Find EXon) (http://www.softberry.com/berry.phtml) predicts
internal exons by linear discriminate function, evaluating ORFs flanked by GT and
AG base pairs (the 5? and 3? ends of typical introns). ...
Plant Molecular Biology Reporter
April 2013, Volume 31, Issue 2, pp 303-313, DOI: 10.1007/s11105-012-0499-2
Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid
Seok Yien Christina Yong 1 and Ratnam Wickneswari 2
(1)Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor Darul Ehsan, Malaysia
(2)School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor Darul Ehsan, Malaysia
... cgi /iprscan.cgi). Promoter sequence was analyzed using Prediction of Plant Promoter
(http:// www.softberry.com/berry.phtml) and Neural Network Pre- diction
(http://www.fruitly.org/seq_tools/promoter.html) software. The cDNA ...
The software “Finding 5?, internal and 3? coding exons”
(http://linux.softberry.com/cgi-bin/progrmas/gfind/fex.pl) was applied to predict exon–intron boundaries.
Cell Biology International.
(2013), doi: 10.1002/cbin.10080
Computational prediction and characterisation of ubiquitously expressed new splice variant of Prkaca gene in mouse.
Banday, A. R., Azim, S., Hussain, M. A., Nehar, S. and Tabish, M.
1Faculty of Life Sciences, Department of Biochemistry, A.M. University, Aligarh, Uttar Pradesh, India
2P.G. Department of Zoology, Ranchi University, Ranchi, Jharkhand, India
... (http://cbcb.umd.edu/software/GeneSplicer/) (Pertea et al., 2001), FGENESH (http://www.softberry.
com/berry.phtml) and FEX (http://www.softberry.com/berry.phtml) and Augustus (http://augustus.
gobics.de/) (Stanke et al., 2004). Alignment analysis was carried out using ...
Molecular Immunology
Volume 46, Issues 8-9, May 2009, Pages 1679-1687
The immunoglobulin heavy chain locus in the reptile Anolis carolinensis
Francisco Gambon Deza, Christian Sanchez Espinel and Susana Magadan Mompo
aUnidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n°, Vigo 36210, Pontevedra, Spain
bInstituto Superior de Saude do Alto Ave (ISAVE), Quinta de Matos, Geraz do Minho, 4830-31 PVL, Portugal
... The constant region genes and exons were obtained by comparison with those already described
for E. macularius. A dotplot was made with E. macularius and A. carolinensis sequences using
the DNASTAR (lasergene), FGENESH and FEX software (http://www.softberry.com). ...
Fungal Genetics and Biology
Volume 44, Issue 5, May 2007, Pages 415-429
Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum
Ioannis Stergiopoulos et al.,
Laboratory of Phytopathology, Wageningen University and Research Centre, Binnenhaven 5, 6709 PD Wageningen, The Netherlands
... Barcelona, Spain) and the FEX (Solovyev et al., 1994) and FGENESH (Salamov and Solovyev,
2000) programs from the MOLQUEST software package (Softberry Inc. ...
J. Biol. Chem.,
Vol. 281, Issue 40, 29753-29761, October 6, 2006
Regulation of Hypocretin (Orexin) Expression in Embryonic Zebrafish*
Juliette H. Faraco et al.,
Stanford University Center for Narcolepsy, Department of Psychiatry and Behavioral Sciences, Stanford University, Stanford, California 94305, the Howard Hughes Medical Institute, Stanford University, Stanford, California 94305, and ¶INSERM, U784, 75230 Paris, France
... rate options. Fgenes, Fex, and Spl (Softberry.com) were used to identify
potential first exons and/or splice donor sites. Signal ...
The Journal of Immunology, 2006, 176: 4221-4234.
Complete Sequence Assembly and Characterization of the C57BL/6 Mouse Ig Heavy Chain V Region
Colette M. Johnston2, Andrew L. Wood, Daniel J. Bolland and Anne E. Corcoran3
Laboratory of Chromatin and Gene Expression, Babraham Institute, Babraham Research Campus, Cambridge CB2 4AT, United Kingdom
... and databases, thereby providing optimal consensus for gene predictions: GRAIL (
http://compblo.ornl.gov/Grail-1.3/ ), Fex ( http://www.softberry.com ), Hexon ...
Biochemical and Biophysical Research Communications
Volume 313, Issue 3, 16 January 2004, Pages 765-770
p73: in silico evidence for a putative third promoter region
A.Emre Sayana, Mario Rossia, Gerry Melinoa, b and Richard A Knight
Medical Research Council Toxicology Unit, Hodgkin Building, Lancaster Road, Leicester LE1 9HN, UK
... exons in these introns. Three out of six programs are the part of Softberry
package [24] having different algorithms. FEX is looking ...
Current Biology
2004, Volume 14, Issue 19, Pages R832-R833
Dual capacity of a human olfactory receptor
M. Spehr, K. Schwane, S. Heilmann, G. Gisselmann, T. Hummel, H. Hatt
... (B) RT-PCR with intron spanning primers. Candidates for 5'UTR exons were identified
using FGENES and FEX software (SoftBerry, Mount Kisco, NY). ...
RNASPL
BMC Genomics
2011, 12:110 doi:10.1186/1471-2164-12-110
Strain-specific copy number variation in the intelectin locus on the 129 mouse chromosome 1
Lu et al.,
The Roslin Institute and Royal (Dick) School of Veterinary Sciences, University of Edinburgh, Roslin, Midlothian, UK
... Pseudogenes were only annotated when their exons share at least 70% identity to the coding
sequences. In addition, the exon-exon junctions of the predicted transcripts were predicted with
the RNASPL program of the Softberry web server [61] to check for alternative splicing. ...
General and Comparative Endocrinology
Volume 169, Issue 3, 1 December 2010, Pages 192-196 doi:10.1016/j.ygcen.2010.09.014
Molecular cloning and characterization of preproorexin in winter skate (Leucoraja ocellata)
Erin E. MacDonald and Helene Volkoff
a Department of Biology, Memorial University of Newfoundland, St. John’s, NL, Canada A1B 3X9
b Department of Biochemistry, Memorial University of Newfoundland, St. John’s, NL, Canada A1B 3X9
... Possible exon-exon locations were predicted using RNASPL (Softberry.com) and the most
probable location was chosen based on the location of intron in known fish species (Faraco et
al., 2006) and the fact that (A/C)AG is the most common exon sequence at the donor site ...
FSPLICE
Molecular and cellular endocrinology
2016, 419, 172-184. doi:10.1016/j.mce.2015.10.014
Compound heterozygous DUOX2 gene mutations (c. 2335-1G> C/c. 3264_3267delCAGC) associated with congenital hypothyroidism. Characterization of complex cryptic splice sites by minigene analysis
Belforte, F. S. et al.,
a Laboratorio de Genetica Molecular Tiroidea, Instituto de Inmunologia, Genetica y Metabolismo (INIGEM, CONICET-UBA), Hospital de Clinicas “Jose de San Martin”, C1120AAR Buenos Aires, Argentina
b Laboratorio de Genetica y Biologia Molecular, Instituto de Inmunologia, Genetica y Metabolismo (INIGEM, CONICET-UBA), Hospital de Clinicas “Jose de San Martin”, C1120AAR Buenos Aires, Argentina
... Searching for potential 5? ss and 3? ss sequences in the DUOX2 gene spanning from intron
17 to intron 18 was accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.
html), Fsplice (http://linux1.softberry.com/berry.phtml?topic=fsplice&group ...
Journal of Cell & Tissue Research
Dec2015, Vol. 15 Issue 3, p5181-5186. 6p.
CLONING AND EXPRESSION OF PLANT CODON OPTIMIZED CRY1AC GENE IN SACCHAROMYCES CEREVISIAE
MOHAN, T. C.; KUMARA SWAMY, G. K.; KRISHNARAJ, P. U.; MISRA, H. S.; KURUVINASHETTI, M. S.
... Splice sites were predicted by using softberry FSPLICE (Find Splice Site in Genomic DNA) option
accessible through http://www.softberry.com. The sequence was analyzed for undesirable 5'
mRNA secondary structure by using tools available at http//www. genebee.com. ...
Molecular and cellular endocrinology
2015, 404, 102-112. doi:10.1016/j.mce.2015.01.032
Novel compound heterozygous Thyroglobulin mutations c. 745+ 1G> A/c. 7036+ 2T> A associated with congenital goiter and hypothyroidism in a Vietnamese family. Identification of a new cryptic 5? splice site in the exon 6
Citterio et al.,
a Laboratorio de Genetica y Biologia Molecular, Instituto de Inmunologia, Genetica y Metabolismo (INIGEM, CONICET-UBA), Hospital de Clinicas “Jose de San Martin”, C1120AAR Buenos Aires, Argentina
b Catedra de Genetica y Biologia Molecular (FFyB-UBA), C1113AAD Buenos Aires, Argentina
c Unite Endocrinologie Diabetologie Pediatrique and Centre des Maladies Rares de la Receptivite Hormonale, CHU-Angers, 49933 Angers CEDEX 9, France
... Searching for potential 5? ss sequences in the TG gene spanning from exon 6 to intron 6 and exon
40 to intron 40 was accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.html),
Fsplice (http://linux1.softberry.com/berry.phtml?topic=fsplice&group ...
ISRN Computational Biology
Volume 2013 (2013), Article ID 790240, 6 pages http://dx.doi.org/10.1155/2013/790240
Zebra Finch Glucokinase Containing Two Homologous Halves Is an In Silico Chimera
Khrustalev Vladislav Victorovich, 1 Lelevich Sergey Vladimirovich, 2 and Barkovsky Eugene Victorovich 1
1Department of General Chemistry, Belarusian State Medical University, Dzerzinskogo 83, 220116 Minsk, Belarus
2Department of Clinical Laboratory Diagnostics, Allergology and Immunology, Grodno State Medical University, Gorkogo 80, 230009 Grodno, Belarus
... Levels of 1GC; 2GC and 3GC have been calculated by “VVK Protective Buffer” [5] in those
newly described exons too. Splicing sites for “new” exons have been predicted by "FSPLICE"
algorithm from SoftBerry server (http://linux1.softberry.com/). ...
BMC Genomics
2013, 14:34 doi:10.1186/1471-2164-14-34
Developmentally regulated expression and complex processing of barley pri-microRNAs
Kruszka et al.,
1 Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University in Poznan, Umultowska 89, 61-614, Poznan, Poland
2 Computational Genomics Laboratory - Bioinformatics Laboratory, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University in Poznan, Umultowska 89, 61-614, Poznan, Poland
...Intron positions were predicted by comparisons of genomic and cDNA sequences using FSPLICE software, http://linux1.softberry.com webcite[53]. ...
Hum. Mol. Genet.
(2012) 21 (16): 3647-3654. doi: 10.1093/hmg/dds194
Deep intronic mutation in OFD1, identified by targeted genomic next-generation sequencing, causes a severe form of X-linked retinitis pigmentosa (RP23)
Webb et al.,
1UCL Institute of Ophthalmology, 11-43 Bath Street, London EC1V 9EL, UK,
2Jules Stein Eye Institute, University of California, 200 Stein Plaza, CA 90095-7000, USA
... SplicePredictor, http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi. FSplice, http://linux1.softberry.
com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind. SPLM, http://linux1.softberry.
com/berry.phtml?topic=splm&group=programs&subgroup=gfind. ...
Journal of the Peripheral Nervous System
Volume 17, Issue 2, pages 141–146, June 2012 DOI: 10.1111/j.1529-8027.2012.00405.x
Two novel missense mutations in FGD4/FRABIN cause Charcot-Marie-Tooth type 4H (CMT4H)
Baudot et al.,
1Inserm, UMR 910, “Genetique Medicale et Genomique Fonctionnelle”, Faculte de Medecine de la Timone
2Aix-Marseille Univ, UMR 910, “Genetique Medicale et Genomique Fonctionnelle”, Faculte de Medecine de la Timone, Marseille, France
... variations on splicing was assessed using the following programs: ESE finder (http://rulai.cshl.
edu/cgi-bin/tools/ESE3/esefinder.cgi?process=home), NNSplice (http://biologyhelp.awardspace.
com/desc.php?id=147&type=biotech), and FSPLICE (http://linux1.softberry.com/berry ...
Breast Cancer Research and Treatment
April 2012, Volume 132, Issue 3, pp 979-992 DOI
10.1007/s10549-011-1661-5
Assessing the RNA effect of 26 DNA variants in the BRCA1 and BRCA2 genes
Mireia Menendez et al.,
1. Hereditary Cancer Program, Genetic Diagnosis Unit, Laboratori de Recerca Translacional, Institut Catala d’Oncologia, Hospital Duran i Reynals—Bellvitge Biomedical Research Institute (ICO-IDIBELL), L’Hospitalet de Llobregat, Barcelona and Hospital Josep Trueta, IDIBGI, Gran Via 199-203, Girona, 08908, Spain
2. Human Cancer Genetics, Spanish National Cancer Centre (CNIO), Madrid, Spain
... www.fruitfly.org/seq_tools/splice. html), NetGene2 Server (http://www.cbs.dtu.dk/
services/ NetGene2/) and SoftBerry (http://linux1.softberry.com/berry. phtml?topic=
fsplice&group=programs&subgroup=gfind). In the case of intronic ...
Molecular and Cellular Endocrinology
Volume 348, Issue 1, 2 January 2012, Pages 313–321
Two novel mutations in the thyroglobulin gene as cause of congenital hypothyroidism: Identification a cryptic donor splice site in the exon 19
Hector M. Targovnik et al.,
a Laboratorio de Biologia Molecular, Catedra de Genetica y Biologia Molecular, Facultad de Farmacia y Bioquimica, Universidad de Buenos Aires, 1113 Buenos Aires, Argentina
b Unidad de Medicina Molecular, Departamento de Medicina, Facultad de Medicina, Universidad de Salamanca, 37007 Salamanca, Spain
c Service d’Endocrinologie Pediatrique, Hopital des Enfants, Centre Hospitalier Universitaire de Toulouse, 31059 Toulouse Cedex 9, France
... Searching for potential 5?ss sequences in the TG gene spanning exon 19 and intron 19 was
accomplished using the NNSplice (http://www.fruitfly.org/seq_tools/splice.html), Fsplice
(http://linux1.softberry.com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind), SPL ...
Aging Cell
(2011), 10: 896–907. doi: 10.1111/j.1474-9726.2011.00727.x
Alternative splicing factor or splicing factor-2 plays a key role in intron retention of the endoglin gene during endothelial senescence.
Blanco, F. J. and Bernabeu, C.
Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), and Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER), c/Ramiro de Maeztu 9, 28040 Madrid, Spain
... Genome Bioinformatics (http://genome.ucsc.edu/). Then, the FSPLICE and FGENESH
tools were used to predict exons and introns in the DNA sequences (http://linux1.
softberry.com/berry.phtml). The Transeq tool at the European ...
Clinical Gastroenterology and Hepatology
Volume 9, Issue 9 , Page 806, September 2011 DOI: 10.1016/j.cgh.2011.03.034
Lynch Syndrome in Young-Onset Colorectal Cancer: Reassessing the Role of the MSH6 Gene
Maria Dolores Giraldez, Antoni Castells, Sergi Castellvi-Bel
Department of Gastroenterology, Hospital Clinic, CIBERehd, IDIBAPS, University of Barcelona, Barcelona, Spain
... By applying our strategy to the Limburg study (PolyPhen [http://genetics.bwh.harvard.edu/pph/],
NNSPLICE [http://www.fruitfly.org/seq_tools/splice.html], and FSPLICE [http://linux1.softberry.
com/berry.phtml?topic=fsplice&group=programs&subgroup=gfind]), 8 of their patients ...
Phytopathologia Mediterranea
49, jan. 2011.
Amplification of Polyketide Synthase gene fragments in ochratoxigenic and nonochratoxigenic black aspergilli in grapevine.
STORARI, M., PERTOT, I., GESSLER, C., BROGGINI, G.
... Arbor, MI, USA). Putative introns were deter- mined using FSplice (www.softberry.
com) and by homology with similar PKSs found in the NCBI database using BLASTX
(http://blast.ncbi.nlm. nih.gov/Blast.cgi). Deduced amino ...
Chem. Senses
(2011) 36 (2): 149-160. doi: 10.1093/chemse/bjq105
Conservation of Indole Responsive Odorant Receptors in Mosquitoes Reveals an Ancient Olfactory Trait
Bohbot et al.,
1Departments of Biological Sciences and Pharmacology, Center for Molecular Neuroscience, Institutes of Chemical Biology and Global Health and Program in Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37235, USA
2Henry A. Wallace Beltsville Agricultural Research Center, Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Agricultural Research Service, USDA, Beltsville, MD 20705, USA
... Home.html). Matches were manually annotated using ClustalW and refined using
the Softberry Splice Site Prediction program (http://linux1.softberry.com/berry.phtml?
topic=fsplice&group=programs&subgroup=gfind). ClustalW ...
Microbiology
156 (2010), 2549-2557; DOI 10.1099/mic.0.039735-0
Molecular characterization and expression analysis of a suite of cytochrome P450 enzymes implicated in insect hydrocarbon degradation in the entomopathogenic fungus Beauveria bassiana
Nicolas Pedrini 1,2, Shizhu Zhang 1, M. Patricia Juarez 2 and Nemat O. Keyhani 1
1 Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611, USA
2 Instituto de Investigaciones Bioquimicas de La Plata, CONICET, Facultad de Ciencias Medicas, UNLP, Calles 60 y 120 (1900), La Plata, Argentina
... Sequence analyses. The sequences were analysed using programs implemented at the Biology
WorkBench website (http://workbench.sdsc.edu/); splice site analysis was performed using the
FSPLICE program at the SoftBerry server (http://www.softberry.com/berry.phtml). ...
Neurology
2010 Feb 2;74(5):366-71
Genetic contribution of FUS to frontotemporal lobar degeneration
Van Langenhove et al.,
Neurodegenerative Brain Diseases Group, Department of Molecular Genetics, VIB, University of Antwerp-CDE, Universiteitsplein 1, B-2610 Antwerpen, Belgium.
.. the protein. The effect of sequence variants on splice site function and the prediction
of alternative splice sites were assessed by the programs FSPLICE (http://www.
softberry.com), NetGene2, 27 and NNSplice. 28. RESULTS. ...
Chem. Senses
2010, doi: 10.1093/chemse/bjq105
Conservation of Indole Responsive Odorant Receptors in Mosquitoes Reveals an Ancient Olfactory Trait
Bohbot et al.,
1 Departments of Biological Sciences and Pharmacology, Center for Molecular Neuroscience, Institutes of Chemical Biology and Global Health and Program in Developmental Biology, Vanderbilt University Medical Center, Nashville, TN 37235, USA
2 Henry A. Wallace Beltsville Agricultural Research Center, Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Agricultural Research Service, USDA, Beltsville, MD 20705, USA
... Home.html). Matches were manually annotated using ClustalW and refined using
the Softberry Splice Site Prediction program (http://linux1.softberry.com/berry.phtml?
topic=fsplice&group=programs&subgroup=gfind). ClustalW ...
Neurology.
2010 Mar 9;74(10):846-50.
THAP1 mutations (DYT6) are an additional cause of early-onset dystonia
Houlden et al.,
From the Department of Molecular Neuroscience (H.H., R.P., A.M., J.H.), Sobell Department of Motor Neuroscience and Movement Disorders (S.A.S., P.S., M.E., K.P.B.), University College London Institute of Neurology, England;
... This intronic change is unlikely to be pathogenic because it did not affect splicing using the
SpliceView program (http://bioinfo.itb.cnr.it/oriel/splice-view.html), NNSPLICE 0.9
(http://www.fruitfly.org/seq_tools/splice.html), and FSPLICE 1.0 (http://linux1.softberry.com/berry. ...
Eur J Hum Genet.
2011 Jan;19(1):56-63. Epub 2010 Aug 18
Characterization of novel SLC6A8 variants with the use of splice-site analysis tools and implementation of a newly developed LOVD database
Betsalel et al.,
Metabolic Unit, Department of Clinical Chemistry, VU University Medical Center, Amsterdam, The Netherlands.
... Project 6 (http://www.fruitfly.org/seq_tools/splice.html), Netgene2 7 (http://www.cbs.dtu.dk/services/
NetGene2/), Splice Predictor 8 (http://deepc2.psi.iastate.edu/cgi-bin/sp.cgi), GenscanW 9
(http://genes.mit.edu/GENSCAN.html) and FSplice (http://linux1.softberry.com/berry.phtml ...
Hum. Mol. Genet.
2010 19 (21): 4201-4206. doi: 10.1093/hmg/ddq338
A novel SOD1 splice site mutation associated with familial ALS revealed by SOD activity analysis
Birve et al.,
1Department of Pharmacology and Clinical Neuroscience and
2Department of Medical Biosciences, Clinical Chemistry, Umea University, Umea, Sweden
... The analyses of mRNA (Fig. 1B), fibroblast extracts (Fig. 2A) and erythrocytes (Fig. 2B) combine
to show that the usage of the alternative splice site must be close to complete for the mutant allele,
which was only predicted by the program FSPLICE at www.softberry.com. ...
BMC Evolutionary Biology
2009, 9:97 doi:10.1186/1471-2148-9-97
Identification, distribution and molecular evolution of the pacifastin gene family in Metazoa
Bert Breugelmans, Gert Simonet, Vincent van Hoef, Sofie Van Soest, Jozef, Vanden Broeck
Department of Animal Physiology and Neurobiology, Zoological Institute, K.U.Leuven, Naamsestraat 59, B-3000 Leuven, Belgium
... presence of a signal peptide were predicted using BESTORF (http://www.softberry.com) and
SignalP (http://www.cbs.dtu.dk/services/SignalP/), respectively. ... If no complete ORF was found,
the Softberry splice finder tool (FSPLICE) was used to search the missing ...
PLoS ONE.
2009; 4(2): e4372.
Identification of Lympho-Epithelial Kazal-Type Inhibitor 2 in Human Skin as a Kallikrein-Related Peptidase 5-Specific Protease Inhibitor
Ulf Meyer-Hoffert, Zhihong Wu, and Jens-Michael Schroder
Department of Dermatology, University Hospital Schleswig-Holstein, Campus Kiel, Kiel, Germany
... Subsequent sequence manipulations utilized the online BLAST 2 Sequences [37]
(http://www.ncbi.nlm.nih.gov/ blast/bl2seq/bl2.html). Splice site analysis was performed using
the FSPLICE program implemented at the SoftBerry server (http://www.softberry.com/berry.phtml). ...
Fungal Genetics and Biology
Volume 46, Issue 1, Supplement 1, March 2009, Pages S14-S18
Analysis and prediction of gene splice sites in four Aspergillus genomes
Kai Wang, David Wayne Ussery and Soren Brunak
aCenter for Biological Sequence Analysis, Department of Systems Biology, Building 208, Technical University of Denmark, DK-2800 Lyngby, Denmark
... 1407 donor sites), and most of them are likely to be false positives (Table 3). On
the other hand, FSPLICE predicts splice sites based on weight matrices model on
many organisms including Aspergillus (www.softberry.com). ...
PLoS ONE.
2009; 4(4): e5227.
Molecular Identification and Expression Analysis of Filaggrin-2, a Member of the S100 Fused-Type Protein Family
Zhihong Wu, Britta Hansmann, Ulf Meyer-Hoffert, Regine Glaser, and Jens-Michael Schroder
Department of Dermatology, University Hospital of Schleswig-Holstein, Kiel, Germany
... Subsequent sequence manipulations utilized the online BLAST 2 Sequences [62]
(http://www.ncbi.nlm.nih.gov/ blast/bl2seq/bl2.html). Splice site analysis was performed using
the FSPLICE program implemented at the SoftBerry server (http://www.softberry.com/berry.phtml). ...
European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21
Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut
site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda
Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China
2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China
...to search for cDNA and genomic DNA of SEDL-related splice variants.7 The FSPLICE 1.0 and SPL platforms (http://www.softberry.com/) were used to predict potential splice sites in genomic DNA. SPLM was implemented to substitute for SPL..
Genetics
Vol. 176, 749-761, June 2007
The Centromeric Retrotransposons of Rice Are Transcribed and Differentially Processed by RNA Interference
Pavel Neumann, Huihuang Yan and Jiming Jiang
Department of Horticulture, University of Wisconsin, Madison, Wisconsin 53706
... Splice site analysis was performed using the FSPLICE program implemented at
the SoftBerry server (http://www.softberry.com/berry.phtml). ...
Journal of Biochemistry and Molecular Biology
Vol. 40, No. 2, March 2007, pp. 172-179
PCR-mediated Recombination of the Amplification Products of the Hibiscus
tiliaceus Cytosolic Glyceraldehyde-3-phosphate Dehydrogenase Gene
Linghui Wu, Tian Tang, Renchao Zhou and Suhua Shi*
State Key Laboratory of Biocontrol and Key Laboratory of Gene Engineering of the Ministry of Education,
School of Life Sciences, Sun Yat-Sen University, 510275 Guangzhou, China
...The boundaries of exons/introns
in the obtained sequences were determined using FSPLICE
(Softberry Inc.) combined with BLAST (blastn, tblastx and bl2seq)
(Altschul et al., 1997; Tatusova and Madden, 1999).
...
The American Journal of Human Genetics
2005, Volume 76, Issue 5, Pages 729-749
Diversity and Function of Mutations in P450 Oxidoreductase in Patients with Antley-Bixler Syndrome and Disordered Steroidogenesis
Huang et al.,
... and "Frame 7" (table 4), disrupted the canonical splice-acceptor or -donor sites;
the splice-site recognition programs FSPLICE (see the Softberry Web site ...
Genome Explorer
Nature
425, 209-215 (11 September 2003) | doi:10.1038/425209a
Bioinformatics: Programmed for success
Steve Buckingham
... Three-way synteny from Softberry. Fast searching is also a
feature of Genome Explorer
from Softberry in Mount Kisco, New York, which uses the FMAP algorithm. ...
...... Softberry, for example, offers a number of gene-prediction programs that can be accessed over
the web, including FGENESH, which ... The fully automated FGENESH++C will automatically
annotate any genome (other than human) to a standard claimed to be indistinguishable ...
SPLICEDB
International Journal of Evolutionary Biology
Volume 2013 (2013), Article ID 818954, 10 pages
http://dx.doi.org/10.1155/2013/818954
Conservation/Mutation in the Splice Sites of Cytokine Receptor Genes of Mouse and Human
Rosa Calvello, Antonia Cianciulli, and Maria Antonietta Panaro
Department of Biosciences, Biotechnologies and Biopharmaceutics, University of Bari, Via Orabona 4, 70126 Bari, Italy
... invertebrates, fungi, protozoa, and plants [25–30]. Comprehensive databases have
also been generated, for example, http://www.softberry.com/spldb/SpliceDB.html
[29–31], and [26]. Cumulatively, the above-quoted papers report ...
European Journal of Human Genetics
12 Nov 2008, doi: 10.1038/ejhg.2008.21
Noncanonical and canonical splice sites: a novel mutation at the rare noncanonical splice-donor cut
site (IVS4+1A>G) of SEDL causes variable splicing isoforms in X-linked spondyloepiphyseal dysplasia tarda
Feng Xiong et al.,
1 Children's Hospital of Chongqing Medical University, Central District, Chongqing, PR China
2 Bio-X Center, Shanghai Jiao Tong University, Shanghai, China
... 9 Exons 3, 4, 5 and 6 (containing the ... canonical and noncanonical mammalian splice
sites (SpliceDB) was used ... and SPL platforms (http://www.softberry.com/) were ...
JOURNAL OF COMPUTATIONAL BIOLOGY
Volume 12, Number 6, 2005 Pp. 894-906
Finding short DNA motifs using permuted markov models
X Zhao, H Huang, TP Speed
... The data are human donor sequences from SpliceDB[9], a recently developed database
of known mammalian splice site sequences (http://www.softberry.com/spldb ...
Current Opinion in Structural Biology 2004, 14:273-282
The evolving roles of alternative splicing
Liana F Lareau1, Richard E Green1, Rajiv S Bhatnagar2,3 and Steven E Brenner1,2_
Departments of 1Molecular and Cell Biology, and 2Plant and Microbial
Biology, University of California, Berkeley, California 94720, USA
3Department of Dermatology, University of California, San Francisco,
California 94143, USA
... [79] SpliceDBhttp://www.softberry.com/berry.phtml?topic?SpliceDBDatabase and
composition statistics for mammalian splice sites inferred from ESTs [80] ...
Yearbook of Medical Informatics. Review Paper. 2004 121-136
Curated databases and their role in clinical bioinformatics
CC Englbrecht, M Han, MT Mader, A Osanger KFX Mayer
MIPS, Institute for Bioinformatics
...SpliceDB
http://www.softberry.com/spldb/SpliceDB.html
Canonical and non-canonical mammalian splice sites [122]
122.Burset M, Seledtsov IA, Solovyev VV. SpliceDB: database of canonical and non-canonical mammalian splice sites. Nucleic Acids Res 2001;29:255-9
Nucleic Acids Research, 2001, Vol. 29, No. 1 255-259
SpliceDB: database of canonical and non-canonical mammalian splice sites
M. Burset, I. A. Seledtsov1 and V. V. Solovyev*
The Sanger Centre, Hinxton, Cambridge CB10 1SA, UK and 1Softberry Inc., 108 Corporate Park Drive, Suite 120, White Plains, NY 10604, USA
FGENESH+
Theoretical and Applied Genetics
2016 DOI 10.1007/s00122-016-2708-0
Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes
Y.-M. Jeong et al.,
1 Department of Life Science, The Catholic University of Korea, Bucheon 420?743, Korea 2 Epigenomics Research Center of Genome Institute, Korea Research Institute of Bioscience and Biotechnology, Daejeon 34141, Korea
... For gene prediction, the genome assembly was premasked for class I and class II transposons
using RepeatMasker (http://www.repeatmasker.org) and protein- coding genes were predicted
ab initio using Fgenesh+ (http://www.softberry.com), AUGUSTUS (Stanke and ...
Theoretical and Applied Genetics
2016 129: 1357. DOI: 10.1007/s00122-016-2708-0
Elucidating the triplicated ancestral genome structure of radish based on chromosome-level comparison with the Brassica genomes
Jeong, Y. M. et al.,
Department of Life ScienceThe Catholic University of Korea; Epigenomics Research Center of Genome InstituteKorea Research Institute of Bioscience and Biotechnology
... II transposons using RepeatMasker (http://www.repeatmasker.org) and protein- coding genes
were predicted ab initio using Fgenesh+ (http://www.softberry.com), AUGUSTUS ...
BMC Genomics
2016,17:657 DOI: 10.1186/s12864-016-3017-3
Transcriptome analysis of smooth cordgrass (Spartina alterniflora Loisel), a monocot halophyte, reveals candidate genes involved in its adaptation to salinity
Bedre, R., Mangu, V. R., Srivastava, S., Sanchez, L. E., & Baisakh, N.
School of Plant, Environmental and Soil Sciences, Louisiana State University Agricultural Center; Department of Genetics and Biochemistry, Clemson University
... The positions
of the SSRs on open reading frames of the genes were determined by using gene finding
software MolQuest (FGENESH+; http://linux1.softberry.com/berry.phtml). ...
Molecular plant pathology
2016 DOI: 10.1111/mpp.12444
Fungal phytopathogens encode functional homologues of plant rapid alkalinisation factor (RALF) peptides
Thynne, E. et al.,
Plant Sciences Division, The Australian National University, Canberra, Australia Evolution, Ecology and Genetics Division, Research School of Biology, The Australian National University, Canberra, Australia
Computational Evolution Group, The University of Auckland, Auckland, New Zealand
... 2013; Nemri et al. 2014). Where annotations were not present or were different, the online
Softberry server (http://linux1.softberry.com/berry.phtml) was used to predict mRNA and protein
sequences using the FGNESH+ prediction algorithm (Solovyev et al., 2006). ...
New Phytologist
2016 DOI: 10.1111/nph.14089
The Argonaute-binding platform of NRPE1 evolves through modulation of intrinsically disordered repeats
Trujillo, J. T., Beilstein, M. A., Mosher, R. A.
The School of Plant Sciences, The University of Arizona, Tucson, AZ, USA
... NRPE1 coding sequence was predicted using Fgenesh+
with A. thaliana or O. sativa protein sequences at http://www.softberry.com (Softberry ...
Biologia Plantarum
2016, 60(2), 279-284. DOI: 10.1007/s10535-016-0595-5
The B-, G-and S-genomic Chi genes in family Triticeae
Shoeva, O. Y., Dobrovolskaya, O. B., Leonova, I. N., Salina, E. A., Khlestkina, E. K.
1. Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk, 630090, Russia
2. Food Security Research Center, Novosibirsk State University, Novosibirsk, 630090, Russia
... The gene structure was determined with the FGENESH + program (http://linux1.softberry.com/
berry.phtml, Solovyev 2007). Sequence clustering was performed using the MEGA Page 3. B-,
G- AND S-GENOMIC CHI GENES IN TRITICEAE 281 v. 5.1 software (Tamura et al. ...
Theoretical and Applied Genetics
2016, 1-16. DOI 10.1007/s00122-016-2723-1
Fine mapping and identification of candidate genes for the sy-2 locus in a temperature-sensitive chili pepper (Capsicum chinense)
Liu, L. et al.,
1. Department of Plant Science and Plant Genomics and Breeding Institute, Seoul National University, Seoul, 151-921, Korea
2. Department of Agronomy and Horticultural Science, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan
... Gene coding regions of the tomato scaffold were predicted by FGENESH+ (http://linux1.softberry.
com). ... repeatmasker.org) and JDotter (http://athena.bioc.uvic.ca). The gene coding regions were
predicted with FGENESH (http://linux1.softberry.com) and BLASTX (https://blast. ...
Insect science
2016, 23(3), 366-376. DOI: 10.1111/1744-7917.12333
Genome?wide identification and characterization of odorant?binding protein (OBP) genes in the malaria vector Anopheles sinensis (Diptera: Culicidae)
He, X. et al.,
Institute of Entomology and Molecular Biology, College of Life Sciences, Chongqing Normal University, Chongqing, China
... sinensis genome by TBLASTN with an E-value cut-off at 1E-5. Thereafter, putative OBP
sequences were predicted by Fgenesh+ (http://www.softberry.com/). ... sinensis OBP genes
were predicted by Fgenesh+ (http://linux1.softberry.com/). ...
BMC plant biology
2015, 15(1), 198. DOI: 10.1186/s12870-015-0550-1
Transcriptionally active LTR retrotransposons in Eucalyptus genus are differentially expressed and insertionally polymorphic
Marcon, H. S et al.,
Departamento de Genetica, Instituto de Biociencias, Universidade Estadual Paulista – UNESP
Programa de Pos-graduacao em Ciencias Biologicas (Genetica), Universidade Estadual Paulista – UNESP
... website. Putative ORFs were retrieved using FGENESH + tool [23] on Softberry
platform (http://linux1.softberry.com/berry.phtml) and manually inspected. Conserved
domains were annotated using Pfam (http://pfam.xfam.org/). ...
Journal of Molecular Catalysis B: Enzymatic.
Volume 118, August 2015, Pages 79–88. doi:10.1016/j.molcatb.2015.04.010
An unusual feruloyl esterase belonging to family VIII esterases and displaying a broad substrate range
Ohlhoff et al.,
a Institute for Microbial Biotechnology and Metagenomics, University of the Western Cape, Bellville, Cape Town, South Africa
b Centre for Microbial Ecology and Genomics, University of Pretoria, Pretoria, South Africa
... BLASTx and BLASTn. The assembled sequences were submitted to FGENESH+
in Softberry (Softberry, Inc., Mount Kisco, NY) for gene prediction and to determine
the location of the coding/noncoding regions. The nucleotide ...
Plant Science
2015, Volume 234, May 2015, Pages 50–59, doi:10.1016/j.plantsci.2015.02.005
Modification of plasma membrane NADPH oxidase activity in cucumber seedling roots in response to cadmium stress
Jakubowska, D., Janicka-Russak, M., Kabala, K., Migocka, M., Reda, M.
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Kanonia Street 6/8, 50-328 Wroclaw, Poland
... homologs of genes encoding NADPH oxidase. Identified sequences were then
analyzed using FGENESH and FGENESH+ tools (Softberry, Inc., Mount Kisco, New
York; www.softberry.com). ClustalW was used to perform the ...
Eukaryotic cell
2015, 14(2), 158-169 doi: 10.1128/EC.00153-14
Asexual propagation of a virulent clone complex in a human and feline outbreak of sporotrichosis
de Melo Teixeira, M. et al.,
aInstituto de Ciencias Biologicas, Universidade de Brasilia, Brasilia, DF, Brazil
bDepartamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de Sao Paulo, Sao Paulo, SP, Brazil
... BLASTx and BLASTn. The assembled sequences were submitted to FGENESH+
in Softberry (Softberry, Inc., Mount Kisco, NY) for gene prediction and to determine
the location of the coding/noncoding regions. The nucleotide ...
Fungal Genetics and Biology
2014, 62, 55-61. DOI:10.1016/j.fgb.2013.10.013
MAT gene idiomorphs suggest a heterothallic sexual cycle in a predominantly asexual and important pine pathogen
Bihon, W., Wingfield, M. J., Slippers, B., Duong, T. A., Wingfield, B. D.
a Department of Genetics, Forestry and Agricultural Biotechnology Institute, University of Pretoria, Private Bag X20, Hatfield, Pretoria 0028, South Africa
b Crop Protection Division, Vegetable and Ornamental Plant Institute, Agricultural Research Council, Private Bag X293, Pretoria 0001, South Africa
... Workbench. Contigs with sequences having high similarity to the M. graminicola
MAT1-2-1 sequence were analysed using FGENESH+(http://linux1.softberry.com) and
AUGUSTUS (http://augustus.gobics.de) gene prediction programs. ...
Apidologie
2014, 1-15 DOI:10.1007/s13592-014-0292-3
Putative orthologues of genetically identified Drosophila melanogaster chitin producing and organising genes in Apis mellifera
Wang, Y., Odemer, R., Rosenkranz, P., Moussian, B.
1. Animal Genetics, Interfaculty Institute for Cell Biology, Eberhard-Karls University of Tubingen, Auf der Morgenstelle 8, 72076, Tubingen, Germany
2. Apicultural State Institute, University of Hohenheim, August-von-Hartmannstr. 13, 70599, Stuttgart, Germany
... To search for possible exons in the 5? region of GB46725 (coding for the putative grainyhead
orthologue), the respective region was scanned manually and by using the software Fgenesh+
(www.?softberry.?com) and Genscan (genes.mit.edu/GENSCAN.html). ...
Plant Pathology
2014 Volume DOI: 10.1111/ppa.12184
Sequence variation in the putative effector gene SIX8 facilitates molecular differentiation of Fusarium oxysporum f. sp. cubense.
Fraser-Smith S. et al.,
1 The University of Queensland, St. Lucia, Qld, Australia
2 Plant Biosecurity Cooperative Research Centre, LPO Box 5012, Bruce, ACT 2617, Australia
... Gene structure was predicted using homology to the Fol-Six8 protein with the program fgenesh+
(Softberry.). ... The amino acid sequence of the Foc-Six8 homologues was predicted using the program
fgenesh+ (Softberry) using homology to the Fol-Six8 protein (Fig. ...
Journal of virology
2014, JVI-00209 DOI:
Functional annotation of Cotesia congregata bracovirus: identification of the viral genes expressed in parasitized host immune tissues
Chevignon G. et al.,
1 Institut de Recherche sur la Biologie de l'Insecte, UMR CNRS 7261, UFR Sciences et Techniques, universite Francois-Rabelais, Tours, France.
2 Commissariat a l'Energie Atomique et aux energies alternatives, Genoscope (Centre National de Sequencage) Evry, France.
... Whenever overlapping 242 consensus sequences encompassed an entire CDS predicted by
FGENESH+ 243 software detection (SoftBerry platform, http://linux1.softberry.com/all.html) on
the 244 CcBV integrated genome (14), the corresponding gene was considered to 245 ...
Physiologia plantarum
, 150(1), 32-45. DOI: 10.1111/ppl.12064
Transcriptional regulation of the V?ATPase subunit c and V?PPase isoforms in Cucumis sativus under heavy metal stress
Kabala K. et al.,
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland
... cucumber sequences were then analyzed using gene finding programs identifying full-length
cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/
eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...
Physiologia Plantarum
Volume 150, Issue 1, pages 32–45, January 2014 DOI:10.1111/ppl.12064
Transcriptional regulation of the V-ATPase subunit c and V-PPase isoforms in Cucumis sativus under heavy metal stress
Katarzyna Kabala*, Malgorzata Janicka-Russak, Malgorzata Reda, Magdalena Migocka
Department of Plant Molecular Physiology, Institute of Experimental Biology, University of Wroclaw, Wroclaw, Poland
.. cucumber sequences were then analyzed using gene finding programs identifying full-length
cDNA sequences (comprising the 5? and 3? ends): GeneMark (http://exon.biology.gatech.edu/
eukhmm.cgi) and FGENESH as well as FGENESH+ on the SoftBerry server (http ...
Molecular Biology Reports
Volume 40, Issue 4 , pp 2809-2820 DOI:10.1007/s11033-012-2296-2
Isolation and characterization of a Laccase gene potentially involved in proanthocyanidin polymerization in oriental persimmon (Diospyros kaki Thunb.) fruit
Qianni Hu, Chun Luo, Qinglin Zhang, Zhengrong Luo
1. Key Laboratory of Horticultural Plant Biology (MOE), Huazhong Agricultural University, Shizishan, Wuhan, 430070, China
... Co., Ltd. Bioinformatics analyses. The similar protein-based gene prediction was
performed on the DkLAC1 by the SoftBerry tool (http://linux1.softberry.com/berry.phtml?
topic=fgenes_plus&group=programs&subgroup=gfs). The ...
Phil. Trans. R. Soc. B
19 September 2013 vol. 368 no. 1626 20130047 DOI:10.1098/rstb.2013.0047
Functional endogenous viral elements in the genome of the parasitoid wasp Cotesia congregata: insights into the evolutionary dynamics of bracoviruses
Bezier et al.,
1Institut de Recherche sur la Biologie de l'Insecte, CNRS UMR 7261, Universite Francois Rabelais, Parc de Grandmont, 37200 Tours, France
2Commissariat a l'Energie Atomique, Genoscope (Centre National de Sequencage), 2 rue Gaston Cremieux, CP 5706, 91057 Evry Cedex, France
... For both Cotesia spp., gene predictions were performed using a combination of FGENESH and
FGENESH+ software from the SoftBerry platform with the Apis mellifera training set
(http://linux1.softberry.com/all.htm) and from the EMBL-EBI platform using Wise2 algorithms (http ...
G3
March 1, 2013 vol. 3 no. 3 465-480 DOI:10.1534/g3.112.004986
Unequal Recombination and Evolution of the Mating-Type (MAT) Loci in the Pathogenic Fungus Grosmannia clavigera and Relatives
Tsui et al.,
*Department of Forest and Conservation Sciences, The University of British Columbia, Vancouver, BC, Canada V6T 1Z4
†Department of Wood Science, The University of British Columbia, Vancouver, BC, Canada V6T 1Z4
... The assembled sequences were submitted to FGENESH+ within Softberry (http://www.softberry.
ru/berry.phtml?topic=fgenes_plus&group=programs&subgroup=gfs) for gene prediction and
to determine the location of the coding/non coding regions, and manually annotated with ...
Plant and Soil
Volume 364, Issue 1-2 , pp 245-260 DOI:10.1007/s11104-012-1345-x
The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber
M. Migocka, A. Warzybok, G. Klobus
1. Institute of Experimental Biology, Department of Plant Physiology, Wroclaw University, Kanonia 6/8, 50-328, Wroclaw, Poland
... AtNRT1 cDNAs were retrieved from the database and further analyzed using FGENESH and
FGENESH+ tools (Softberry, Inc., Mount Kisco, New York; www. ... The structure of each gene was
determined using FGENESH or FGENESH+ programs available on softberry.com ...
Plant Pathology
DOI:10.1111/ppa.12184
Sequence variation in the putative effector gene SIX8 facilitates molecular differentiation of Fusarium oxysporum f. sp. cubense
Fraser-Smith et al.,
1The University of Queensland, St. Lucia, Queensland, Australia
2Cooperative Research Centre for National Plant Biosecurity, Australia
... Gene structure was predicted using homology to the Fol-Six8 protein with the software program
FGENESH+ (Softberry, Mount Kisco, NY, USA). Nucleotide and amino acid ... program FGENESH+
(Softberry, Mount Kisco, NY, USA) using homology to the Fol-Six8 protein. ...
The FASEB Journal
January 2013 vol. 27 no. 1 86-97 DOI:10.1096/fj.12-219444
Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female
Dottorini et al.,
*Department of Experimental Medicine and
†Department of Industrial Engineering, University of Perugia, Perugia, Italy;
‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK; and
§Department of Genetics, University of Cambridge, Cambridge, UK
... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted
using FGENESH-C, FGENESH+ (http://linux1.softberry.com/), Wise2 (http://www.ebi.ac.uk/), and
Genescan (http://genes.mit.edu/GENSCAN.html). Mosquito rearing and mating analysis. ...
Science China Life Sciences
Volume 56, Issue 7 , pp 628-637 DOI:10.1007/s11427-013-4505-1
Cloning and characterization of the gene cluster required for beauvericin biosynthesis in Fusarium proliferatum
Zhang et al.,
14505. CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China
24505. University of Chinese Academy of Sciences, Beijing, 100049, China
... analysis. Gene products of the individual ORFs were deduced and analyzed using
the programs AUGUSTUS [18,19] and FGENESH (http://linux1.softberry.com/berry.
phtml?topic =fgenes_plus&group=programs&subgroup=gfs). ...
J Phylogen Evolution Biol
Volume 1 • Issue 1 • 1000107 DOI:10.4172/jpgeb.1000107
Ancient Origin of Chaperonin Gene Paralogs Involved in Ciliopathies
Krishanu Mukherjee 1 and Luciano Brocchieri 2*
1Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32610-3610, USA
2Department of Molecular Genetics and Microbiology and Genetics Institute, University of Florida, Gainesville, FL 32610-3610, USA
from the genome and the
corresponding query protein was used to guide the prediction of the
complete structure of the newly-identified gene, based on homology
and on intron-exon junction signals, using the gene-prediction
software FGENESH+ [39] at the Softberry web-site (linux1.softberry.
com). Reverse
G3
January 1, 2013 vol. 3 no. 1 41-63 doi: 10.1534/g3.112.004044
Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Manning et al.,
*Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon 97331
†Department of Forest Sciences, University of British Columbia, Vancouver, British Columbia, Canada, V6T 1Z4
‡Carbone/Ferguson Laboratories, Division of Neuroscience, Oregon National Primate Research Center (ONPRC), Beaverton, Oregon 97006
...Protein-encoding genes were annotated using a combination of manual curation, EST alignments, and ab initio gene predictions made by
FGENESH, FGENESH+ (http://linux1.softberry.com) and GENEID (http://genome.crg.es/software/geneid). ...
Fungal Biology
Volume 117, Issue 6, June 2013, Pages 411–421 DOI:10.1016/j.funbio.2013.04.005
Characterization of the mating-type genes in Leptographium procerum and Leptographium profanum
Tuan A. Duong a, Z. Wilhelm de Beer b, Brenda D. Wingfield a, Michael J. Wingfield a
a Department of Genetics, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa
b Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria 0002, South Africa
... Plasmids from the positive clones were extracted and inserts were sequenced by primer walking
(sequencing primers are available on request). Genes present in the inserts were predicted using
FGENESH+ (Salamov and Solovyev 2000) (http://linux1.softberry.com). ...
Gene
Volume 519, Issue 1, 25 April 2013, Pages 18–25 DOI:10.1016/j.gene.2013.01.058
Genome-wide identification and divergent transcriptional expression of StAR-related lipid transfer (START) genes in teleosts
Teng et al.,
a Beijing Institutes of Life Science, Chinese Academy of Sciences, Beijing 100101, China
b Graduate University of the Chinese Academy of Sciences, Beijing 100049, China
c Institute of Genomic Medicine, Wenzhou Medical College, Wenzhou 325035, China
... Gene predicted using FGENESH+ software (http://linux1.softberry.com/berry.phtml). ...
a–?Distinct expression pattern of STARTs suggests divergent functions in development.
FGENESH+ software (http://linux1.softberry.com/berry.phtml). ...
PloS one
February 01, 2013DOI: 10.1371/journal.pone.0055185
Genomic and Secretomic Analyses Reveal Unique Features of the Lignocellulolytic Enzyme System of Penicillium decumbens
Liu et al.,
State Key Laboratory of Microbial Technology, Shandong University, Jinan, Shandong, China
Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China
... Gene Finding and Annotation. Gene models were predicted independently with a set
of gene finders including Augustus [58], GeneMark-ES [59], GeneId [60] and SoftBerry
eukaryotic gene finding suite (Fgenesh and Fgenesh+) [61]. ...
PLoS biology
(2013). 11(6), e1001585. DOI:10.1371/journal.pbio.1001585
Co-Expression of VAL-and TMT-Opsins Uncovers Ancient Photosensory Interneurons and Motorneurons in the Vertebrate Brain
Fischer et al.,
Max F. Perutz Laboratories, University of Vienna, Vienna, Austria, Research Platform “Marine Rhythms of Life,” University of Vienna, Vienna, Austria
...Full-length coding sequences were predicted with FGENESH+ (softberry.com) using Takifugu rubripes TMT-Opsin as input protein sequence. ...
PLoS genetics
(2013). 9(1), e1003233. DOI:10.1371/journal.pgen.1003233
Comparative Genome Structure, Secondary Metabolite, and Effector Coding Capacity across Cochliobolus Pathogens
Condon et al.,
Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca, New York, United States of America
Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon, United States of America
... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome; homology-based predictions
with Fgenesh+ [103] and Genewise ....
PLoS Pathog
8(12): e1003037. doi:10.1371/journal.ppat.1003037
Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi
Ohm et al.,
United States Department of Energy (DOE) Joint Genome Institute (JGI), Walnut Creek, California, United States of America
... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome;
homology-based predictions with Fgenesh+ [87] and Genewise...
BMC Plant Biology
2012, 12:235
http://www.biomedcentral.com/1471-2229/12/235
Endo-(1,4)-b?-Glucanase gene families in the
grasses: temporal and spatial Co-transcription of
orthologous genes
Buchanan et al.,
1 Australian Research Council Centre of Excellence in Plant Cell Walls, and the
Australian Centre for Plant Functional Genomics, School of Agriculture, Food
and Wine, University of Adelaide, South Australia 5064, Australia.
2 Genetic
Discovery Group, Crop Genetics Research and Development, Pioneer Hi-Bred
International Inc, 7300 NW 62nd Avenue, Johnston, IA 50131-1004, USA
...and were extracted using the FGENESH + program
(Softberry, Inc. 116 Radio Circle, Suite 400Mount Kisco,
NY 10549, USA)....
Molecular Reproduction and Development
Volume 79, Issue 6, pages 380–391, June 2012 DOI: 10.1002/mrd.22040
An oocyte-preferential histone mRNA stem-loop-binding protein like is expressed in several mammalian species
Aurore Thelie et al.,
1INRA, UMR85 Physiologie de la Reproduction et des Comportements, Nouzilly, France
2CNRS, UMR7247, Nouzilly, France
... We extracted the syntenic regions in mammals, and then applied several prediction
gene methods, including FGENESH+ (http://linux1.softberry.com/berry.phtml), Genscan
(Burge and Karlin, 1997), and Genewise (Birney et al., 2004). ...
MPMI
DOI: Vol. 25, No. 2, 2012, pp. 180–190. DOI: 10.1094/ MPMI -08-11-0212
A Highly Conserved Effector in Fusarium oxysporum
Is Required for Full Virulence on Arabidopsis
Louise F. Thatcher, Donald M. Gardiner, Kemal Kazan, and John M. Manners
CSIRO Plant Industry, Queensland Bioscience Precinct, St. Lucia, Queensland, 4067, Australia
... gene structure was predicted using homology
to F. oxysporum f. sp. lycopersici SIX proteins with
FGENESH+ (Softberry, Mount Kisco, NY, U.S.A.), ...
Chemistry & Biology
Volume 19, Issue 12, 21 December 2012, Pages 1611–1619 DOI: 10.1016/j.chembiol.2012.10.010
Terpendole E, a Kinesin Eg5 Inhibitor, Is a Key Biosynthetic Intermediate of Indole-Diterpenes in the Producing Fungus Chaunopycnis alba
Takayuki Motoyama1, Toshiaki Hayashi1, Hiroshi Hirota1, Masashi Ueki1, Hiroyuki Osada1
1 Chemical Biology Core Facility, Chemical Biology Department, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198, Japan
... Nucleotide and amino acid sequence data were analyzed by DNASIS-Mac software (Hitachi
Software Engineering, Tokyo, Japan). Open reading frames were predicted by FGENESH and
FGENESH + software (Softberry, Mount Kiscko, NY). Construction of Recombinant Strains. ...
Fungal Genetics and Biology
Volume 49, Issue 9, September 2012, Pages 708–716 DOI: 10.1016/j.fgb.2012.06.010,
Protein phosphatase Z modulates oxidative stress response in fungi
Leiter et al.,
a Department of Microbial Biotechnology and Cell Biology, Faculty of Science and Technology, University of Debrecen, Egyetem ter 1, H-4032 Debrecen, Hungary
b Departament de Bioquimica i Biologia Molecular, Institut de Biotecnologia i Biomedicina, Universitat Autonoma de Barcelona, Cerdanyola del Valles 08193, Barcelona, Spain
.. 5 2.2. Sequence analysis of fungal PPZ phosphatases DNA sequences were analyzed with
FGENESH and FGENESH+ (http://www.softberry.com/berry.phtml; exon-intron analysis),
WEBGENE (http://www.itb.cnr.it/sun/webgene; gene structure analysis), pDRAW32 (http://www ...
New Phytologist
Volume 194, Issue 4, pages 1001–1013, June 2012 DOI: 10.1111/j.1469-8137.2012.04128.x
Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen
Olson et al.,
1 Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, Box 7026, Ullsvag 26, 750 05 Uppsala, Sweden
2 US DOE Joint Genome Institute, Walnut Creek, CA 94598, USA
... based – FGENESH+, Genewise (Birney & Durbin, 2000) seeded by BLASTx (Altschul et al., 1990)
alignments against GenBank's database of nonredundant proteins (NR: http://www.ncbi.nlm.nih.
gov/BLAST/); and EST-based – EST_map (http://www.softberry.com/) seeded by ...
International Journal of Food Microbiology
Volume 157, Issue 2, 2 July 2012, Pages 202–209 DOI: 10.1016/j.ijfoodmicro.2012.05.008,
The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties
Jure Piskur et al.,
a Wine Research Centre, University of Nova Gorica, Slovenia
b Department of Biology, Lund University, Sweden
... 2) homology-based — FGENESH+; Genewise (Birney and Durbin, 2000) seeded by BLASTx
alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm.
nih.gov/BLAST/), and 3) EST-based — EST_map (http://www.softberry.com/) seeded by ...
Fungal Genetics and Biology
Volume 49, Issue 3, March 2012, Pages 217–226 DOI: 10.1016/j.fgb.2012.01.007
The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction
Mahajabeen Padamsee et al.,
a Department of Plant Pathology and Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, United States
b Department of Plant Biology, University of Minnesota, Saint Paul, MN 55108, United States
... 2) homology-based – FGENESH +; Genewise (Birney and Durbin, 2000) seeded by BLASTx
alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm.
nih.gov/BLAST/), and (3) EST-based – EST_map (http://www.softberry.com/) seeded by ...
African Journal of Biotechnology
Vol. 11 (1), pp. 88-98, 3 January, 2012, DOI: 10.5897/AJB11.3474
Identification and characterization of the Bcl-2-associated athanogene (BAG) protein family in rice
Rashid Mehmood Rana 1, 2, Shinan Dong 1, Zulfiqar Ali 3, Azeem Iqbal Khan 4 and Hong Sheng Zhang 1
1 State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China.
2 Department of Plant Breeding and Genetics, PMAS-Arid Agriculture University Rawalpindi, Pakistan.
... The resultant six members of BAG family in rice were processed for further study. Genomic
and cDNA sequences of these proteins were retrieved from NCBI and gene structure was
predicted by FGENESH+ (http://linux1.softberry.com/berry.phtml). ...
J. Exp. Bot.
(2012)
doi: 10.1093/jxb/ers245
First published online: September 20, 2012
Functional analysis of OsHSBP1 and OsHSBP2 revealed their involvement in the heat shock response in rice (Oryza sativa L.)
Rashid Mehmood Rana 1,2, Shinan Dong 1, Haijuan Tang 1, Fiaz Ahmad 1 and Hongsheng Zhang 1
1 State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China
2 Department of Plant Breeding and Genetics, PMAS-Arid Agriculture University Rawalpindi, Pakistan
... by one. The HSBP domain was identified by Pfam (PF06825) to confirm the presence
of these proteins in rice. Gene structure was predicted by FGENESH+
(http://linux1.softberry.com/berry.phtml). The chromosomal location ...
Immunogenetics
September 2012 DOI
10.1007/s00251-012-0643-z
Identification of natural killer cell receptor genes in the genome of the marsupial Tasmanian devil (Sarcophilus harrisii)
Lauren E. van der Kraan (1)
Emily S. W. Wong (1)
Nathan Lo (2)
Beata Ujvari (1)
Katherine Belov (1)
1. Faculty of Veterinary Science, University of Sydney, B19 RMC Gunn, Sydney, NSW, 2006, Australia
2. School of Biological Sciences, University of Sydney, Sydney, NSW, 2006, Australia
... incomplete, a different gene prediction software, Softberry FGENESH+
(http://linux1.softberry.com/all.htm), was used to re-predict the sequences,
incorporating protein homology informa- tion (the BLAST best hit). Functional ...
Gene.
2012 Apr 15;497(2):249-55. Epub 2012 Jan 31.
A novel Acetyl-CoA synthetase short-chain subfamily member 1 (Acss1) gene indicates a dynamic history of paralogue retention and loss in vertebrates.
Castro LF et al.,
University of Porto, Portugal.
... Intron/exon predictions were made with FGENESH+ (http://linux1.softberry.com/berry.138 phtml).
2.2. Phylogenetic analysis. The ACSS1 amino acid sequences retrieved from the genome search
were aligned using MAFFT with the L-INS-i method (Katoh and Toh, 2008). ...
Genet. Mol. Res.
11 (4): 3676-3687 (2012) DOI http://dx.doi.org/10.4238/2012.August.17.3
Regulation of ATG6/Beclin-1 homologs by abiotic stresses and hormones in rice
(Oryza sativa L.)
R.M. Rana1,2, S. Dong1, Z. Ali3,4, J. Huang1 and H.S. Zhang1
1State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, China
2Department of Plant Breeding and Genetics,
Pir Mehr Ali Shah Arid Agriculture University Rawalpindi,
Rawalpindi, Pakistan
... Genomic and cDNA sequences of these proteins were retrieved
from NCBI, and gene structure was predicted by FGENESH+ (http://linux1.softberry.com/
berry.phtml). The chromosomal location of each ATG6 gene in rice was determined from the
rice physical map constructed by the International Rice Genome Sequencing Project (IRGSP)
(http://rgp.dna.affrc.go.jp). Subcellular localization of the OsATG6 family was predicted by
WoLF PSORT (Horton et al., 2006) and ProtComp (http://linux1.softberry.com/berry.phtml). ...
Plant Physiology October
2011 vol. 157 no. 2 757-769 DOI: 10.1104/pp.111.181990
Genome-Wide Comparison of Nucleotide-Binding Site-Leucine-Rich Repeat-Encoding Genes in Arabidopsis
Guo et al.,
Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tuebingen, Germany
... Gordon et al., 1998). Primer walking and PCR were used to fill or polish gaps and
ambiguous regions. Annotation was performed using FGENESH and FGENESH+
(http://linux1.softberry.com/berry.phtml). Spidey (http://www.ncbi ...
Parasitology Research
Volume 108, Issue 3 , pp 611-620 DOI: 10.1007/s00436-010-2104-7
Eimeria maxima phosphatidylinositol 4-phosphate 5-kinase: locus sequencing, characterization, and cross-phylum comparison
Mei-Yen Goh, Mei-Zhen Pan, Damer P. Blake, Kiew-Lian Wan, Beng-Kah Song
1. School of Science, Monash University Sunway Campus, Jalan Lagoon Selatan, 46150 Bandar Sunway, Selangor DE, Malaysia
2. Parasitology, Institute for Animal Health, Compton, Berkshire, RG20 7NN, UK
... Structural annotation of the putative EmPIP5K gene Open reading frame identification was
performed by submitting consensus contig sequence to the ab initio gene-prediction programs
AUGUSTUS version 2.0.3 (Stanke et al. 2008), FGENESH+ (http://www.softberry. ...
The Journal of Biological Chemistry
March 25, 2011 286, 10419-10428. doi: 10.1074/jbc.M110.179853
Two Novel Classes of Enzymes Are Required for the Biosynthesis of Aurofusarin in Fusarium graminearum
Frandsen et al.,
From the ‡Department of Agriculture and Ecology, Faculty of Life Sciences, University of Copenhagen, DK-1870 Frederiksberg,
the §Center for Microbial Biotechnology, Department of Systems Biology, Technical University of Denmark, DK-2800 Kongens Lyngby
... default settings (12). Ad hoc ab initio gene modeling was performed using FGENESH
and FGENESH+ (SoftBerry). Motifs in unaligned sequences were identified using
Meta-MEME version 4.1.1 and MAST (13, 14). Primer design ...
Peptides
Volume 34, Issue 1, March 2012, Pages 193–200
An evolutionary comparison of leucine-rich repeat containing G protein-coupled receptors reveals a novel LGR subtype
Matthias B. Van Hiel a, b, 1, , Hans Peter Vandersmissen a, 1, , Tom Van Loy a, , Jozef Vanden Broeck a
a Animal Physiology and Neurobiology, Zoological Institute of the Katholieke Universiteit Leuven, Naamsestraat 59, P.O. Box 02465, B-3000 Leuven, Belgium
b Department of Genetics, Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, 30 Flemington Road, Parkville, Melbourne, Victoria 3010, Australia
... 39, 60]. Possible incorrectly in silico predicted sequences were manually checked
at the genomic DNA level and, where possible, repredicted using softberry
(http://linux1.softberry.com/berry.phtml) FGENESH+. Sequences were ...
PLoS ONE
6(8): e24111. doi:10.1371/journal.pone.0024111
Topological and Functional Characterization of an Insect Gustatory Receptor
Zhang et al.,
The Key Sericultural Laboratory of Agricultural Ministry, Southwest University, Chongqing, China
CSIRO Food Futures Flagship, Canberra, Australian Capital Territory, Australia
...The genomic scaffold sequences containing candidate genes were predicted using FGENESH+ (http://www.softberry.com/berry.phtml), BGF...
Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184–194 DOI: 10.1016/j.exppara.2010.07.012
Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases
Tiago M. Martins a, b, , , Virgilio E. do Rosario b, Ana Domingos a, b
a Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal
b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal
... A threshold of E ? 1e-04 was adopted for the tblastn search (Wu et al., 2003). The gene
structure of the identified CP genes with multiple exons was predicted using the
FGENESH and FGENESH+ software (http://www.softberry.com). ...
J. Exp. Bot.
(2011) 62 (15): 5641-5658. doi: 10.1093/jxb/err249
Flowering time variation in oilseed rape (Brassica napus L.) is associated with allelic variation in the FRIGIDA homologue BnaA.FRI.a
Wang et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany
2Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China
... online). The genes were annotated using pairwise sequence alignments (BLAST2;
http://www.ncbi.nlm.nih.gov) with FRI and the FGENESH+ and FGENESH_C gene
prediction programs (http://linux1.softberry.com/berry.phtml). ...
J. Exp. Bot.
(2011) 62 (10): 3359-3374. doi: 10.1093/jxb/erq321
Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris
Abou-Elwafa et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany
2Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK
... Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2;
http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and
FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...
Plant Physiology
February 2011 vol. 155 no. 2 1013-1022 DOI: 10.1104/pp.110.169870
Allelic Variation in the Perennial Ryegrass FLOWERING LOCUS T Gene Is Associated with Changes in Flowering Time across a Range of Populations
Skot et al.,
Institute of Biological, Environmental, and Rural Sciences, Aberystwyth University, Aberystwyth, Ceredigion SY23 3EB, United Kingdom (L.S., R.S., A.T., K.S., D.T., G.L., I.A.); Department of Genetics and Biotechnology, Faculty of Agricultural Sciences, Research Centre Flakkebjerg, Aarhus University, 4200 Slagelse, Denmark (T.A.)
... The identity of LpFT3 was confirmed by direct sequencing of the Hd3a.1f/3r-positive BACs with
coding sequence and protein prediction generated using FGENESH+ (http://www.softberry.com/
berry.phtml) and by direct comparison with other monocot FT sequences obtained ...
PLoS Pathog
(2011), 7(7): e1002137. doi:10.1371/journal.ppat.1002137
Comparative Genomics Yields Insights into Niche Adaptation of Plant Vascular Wilt Pathogens.
Klosterman et al.,
USDA-ARS, Salinas, California, United States of America
University of California, Davis, California, United States of America
...Protein-encoding genes were annotated using a combination of manually curated genes, in addition to EST BLAST alignments, and ab initio gene predictions
made by FGENESH, FGENESH+ (http://linux1.softberry.com), and ...
PLoS ONE
(2011) 6(8): e22046. doi:10.1371/journal.pone.0022046
Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs.
Zhang et al.,
Department of Biology, University of Padua, Padova, Italy, Abteilung fur Botanische Genetik und Molekularbiologie, Botanisches Institut und Botanischer Garten, Christian-Albrechts-Universitat zu Kiel, Kiel, Germany
...To ensure correct gene structures of all putative GPCR genes, we predicted gene structures using
GENSCAN [97], [98] and predictions were repeated using GENOMESCAN [97], [98], GENEWISE [99] and
FGENESH/FGENESH+ [31]. Intron-exon structures were determined with the aid of GENEWISE [99]
and/or PROT_MAP module of the Softberry software suite (website: www.softberry.org). ...
Nature Biotechnology
29, 922–927 (2011) doi:10.1038/nbt.1976
Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris.
Berka et al.,
Novozymes, Inc., Davis, California, USA.
US Department of Energy Joint Genome Institute, Walnut Creek, California, USA.
Centre for Structural and Functional Genomics, Concordia University, Montreal, Quebec, Canada.
... was performed using ab initio Fgenesh 32 and Genemark-ES 33 ; homology-based Fgenesh+ 32 and
Genewise 34 seeded by BLASTx alignments of NCBI's nr (nonredundant) protein database against the assembly;
cDNA-based EST_map (http://www.softberry.com/) seeded ...
Insect Molecular Biology
Special Issue: The Aphid Genome
Volume 19, Issue Supplement s2, pages 141–153, March 2010 DOI: 10.1111/j.1365-2583.2009.00975.x
Identification of ion channel genes in the Acyrthosiphon pisum genome
Dale et al.,
1 Syngenta, Jealotts Hill Research Centre, Bracknell, Berkshire, UK;
2 MRC Functional Genomics Unit, Department of Physiology Anatomy and Genetics, University of Oxford, South Parks Road, Oxford, UK;
... eugenes.org/aphid/), was also queried. Softberry protein-based gene predictions
software FGENESH+ (http://linux1.softberry.com/berry.phtml) was used to refine gene
sequence data. Previously identified members of the Glutamate ...
Plant Physiology Preview
Published on November 29, 2010; 10.1104/pp.110.169870
Allelic variation in the Lolium perenne L. (perennial ryegrass ) FLOWERING LOCUS T (LpFT3) gene is associated with changes in flowering time across a range of populations
Skot et al.,
1 Aberystwyth University; 2 Aarhus University
... was confirmed by direct sequencing of the Hd3a.1f/3r positive BACs with coding sequence and
protein prediction generated using FGENESH+ (http://www.softberry.com/berry.phtml) ...
(http://linux1.softberry.com/berry.phtml). Predicted secondary structures for the proteins ...
J. Exp. Bot.
2010 doi: 10.1093/jxb/erq321
Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris
Abou-Elwafa et al.,
1 Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany
2 Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK
.. Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2;
http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and
FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...
Experimental Parasitology
Volume 127, Issue 1, January 2011, Pages 184-194 doi:10.1016/j.exppara.2010.07.012
Identification of papain-like cysteine proteases from the bovine piroplasm Babesia bigemina and evolutionary relationship of piroplasms C1 family of cysteine proteases
ATiago M. Martins a, b, Virgilio E. do Rosario b and Ana Domingos a, b
Unidade de Tecnologias de Proteinas e Anticorpos Monoclonais, Instituto de Higiene e Medicina Tropical, Estrada do Paco do Lumiar 22, 1649-038 Lisboa, Portugal
b Centro de Malaria e Doencas Tropicais, Instituto de Higiene e Medicina Tropical, Rua da Junqueira 96, 1349-008 Lisboa, Portugal
... A threshold of E 1e-04 was adopted for 93 the tblastn search (Wu et al., 2003). The gene
structure of the identified CP genes with 94 multiple exons was predicted using the
FGENESH and FGENESH+ software 95 (http://www.softberry.com). ...
Developmental & Comparative Immunology
Volume 34, Issue 1, January 2010, Pages 1-13 doi:10.1016/j.dci.2009.08.002
Structure and expression pattern of teleost caspase recruitment domain (CARD) containing proteins that are potentially involved in NF-?B signalling
M.X. Chang a, W.Q. Chen a, b and P. Nie a
aState Key Laboratory of Freshwater Ecology and Biotechnology, and Laboratory of Fish Diseases, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei Province 430072, PR China
bCollege of Animal Science and Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei Province 430070, China
... Manual annotation of the orthologous genes was also performed using FGENESH+ to predict
structures based on homology with human genes: “fish” specific parameters were applied in this
program (http://linux1.softberry.com/berry.phtml). 2.2. Fish and cell line. ...
Cytokine & Growth Factor Reviews
Volume 20, Issue 2, Pages 115-124
Structural conservation of interferon gamma among vertebrates
R. Savan, S. Ravichandran, J. Collins, M. Sakai, H. Young
... Initially, DYRK2, MDM, RAP1B, NUP107, SLC35E3, CNTN1B, OPN1SW1, CALU harboring
scaffolds or contigs were identified. These contigs were then searched for IFN-? gene using
FGENESH+ software and curated manually (http://www.softberry.com/berry.phtml). ...
Mol Biol Evol.
2009 May;26(5):1143-53. Epub 2009 Feb 19.
Evolution of mutation rates: phylogenomic analysis of the photolyase/cryptochrome family
Lucas-Lledo JI, Lynch M.
Department of Biology, Indiana University, Bloomington, Indiana, USA.
... The FGENESH+ gene predictor (http://linux1.softberry.com/berry.phtml) was occasionally used
to improve the translation of some unannotated eukaryotic genes. Results from different searches
were merged and aligned using ClustalX 1.83 (Thompson et al. ...
Mol Biol Evol.
2009 Jul;26(7):1557-69. Epub 2009 Apr 6.
The Fruitless gene in Nasonia displays complex sex-specific splicing and contains new zinc finger domains
Bertossa RC, van de Zande L, Beukeboom LW.
Evolutionary Genetics, Centre for Ecological and Evolutionary Studies, The Netherlands.
... 1990 Go ). In cases in which no or partial sequences were annotated, missing domains
were predicted using FGENESH+ at http://linux1.softberry.com/berry.phtml (Solovyev et
al. 2006 Go ) using already known protein sequences as template. ...
Genetics.
2009 May;182(1):145-59. Epub 2009 Mar 16.
The multi-AT-hook chromosomal protein of Drosophila melanogaster, D1, is dispensable for viability
Weiler KS.
Department of Biology, West Virginia University, Morgantown, West Virginia 26506, USA
... was identified by tBLASTn of D. simulans genomic sequence using the D. melanogaster
protein as a query (http://insects.eugenes.org/species/blast/). FGENESH+
(http://www.softberry.com) was used to predict the partial protein sequence. ...
Science.
2009 May 1;324(5927):626-31.
Biomolecular characterization and protein sequences of the Campanian hadrosaur B. canadensis
Schweitzer et al.,
1 North Carolina State University, Raleigh, NC 27695, USA.
2 North Carolina Museum of Natural Sciences, Raleigh, NC 27601, USA.
... two extinct organisms: Mammut americanum (MOR 605) and T. rex (MOR 1125) (see table S1
and SOM appendix) (6). The Anolis carolinensis amino acid sequence was inferred with the use
of FGENESH+ (gene prediction on the basis of protein homology; www.softberry.com). ...
BMC Genomics
2009, 10:553 doi:10.1186/1471-2164-10-553
Annotation and expression of carboxylesterases in the silkworm,
Bombyx mori
Quan-You Yu 1,2, Cheng Lu *2, Wen-Le Li 2, Zhong-Huai Xiang 2 and
Ze Zhang *1,2
1The Institute of Agricultural and Life Sciences, Chongqing University, Chongqing 400044, China and 2The Key Sericultural Laboratory
of the Agricultural Ministry of China, Southwest University, Chongqing, 400716, China
... weak sequence similarity to any query sequence and its flanking regions (1 kb or more long)
were extracted. Putative COE genes within the extracted sequences were predicted using BGF
software [55] and Fgenesh+ (http://www.softberry.com/). Phylogenetic analysis ...
Nature Biotechnology
26, 553 - 560 (2008)
Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina)
Diego Martinez et al.,
Los Alamos National Laboratory/Joint Genome Institute, PO Box 1663, Los Alamos, New Mexico 87545, USA.
Novozymes, Inc., 1445 Drew Ave., Davis, California 95618, USA.
... an ab initio gene predictor, Fgenesh 37 , specifically trained for this genome,
and two homology-based gene predictors, Fgenesh+ (http://www.softberry.com) and ...
Genes & Dev.
2008. 22: 2869-2885 10.1101/gad.1691208
LAB-1 antagonizes the Aurora B kinase in C. elegans
De Carvalho, C. E. et al.,
1Department of Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA;
2 Department of Molecular Genetics, University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030, USA
... Prediction of the coding sequence in the respective region in 1003.1 and conceptual
translation were performed using FGENESH+ (http://www.softberry.com/berry ...
Nature
Volume 453 Number 7198 pp1064 - 1071 (19 Jun 2008), doi: 10.1038/nature06967
The amphioxus genome and the evolution of the chordate karyotype.
Bowler et al.
# Department of Energy Joint Genome Institute, Walnut Creek California 94598, USA
# Center for Integrative Genomics, Department of Molecular and Cell Biology, University of
California, Berkeley, California 94720, USA
... A\Supplementary Note 3. Annotation of protein coding genes
3.1 Expressed sequence tag sequencing.
cDNA libraries for amphioxus were prepared from gastrula and neurula
stage embryos, and from
larvae as described by 6, and a single library was created for
Petromyzon marinus (sea lamprey).
Approximately 32,000 expressed sequence tags (ESTs) were attempted
from each library.
(Supplementary Table S6).
3.2 Gene prediction, functional annotation and quality control.
The JGI Annotation Pipeline was used for annotation of the amphioxus
v1.0 assembly described
here. The pipeline includes the following steps: (1) repeat masking,
(2) mapping ESTs, full length
cDNAs, and putative full length known genes, (3) gene structure
prediction using several methods,
(4) protein functional annotation using several methods, and (5)
combining gene predictions into a
non redundant representative set of gene models, which are subject to
genome-scale analysis. The
genomic sequence, predicted genes and annotations of amphioxus,
together with available
evidence, are available at the JGI Genome Portal
(www.jgi.doe.gov/Amphioxus) and from GenBank
under accession number ABEP01000000.
Transposons were masked using RepeatMasker 7 tools and a custom
library of manually curated
repeats (see above Supplementary Note 2.4). 480,070 ESTs were
clustered into 77,402 consensus
sequences and both individual ESTs and consensus sequences were mapped
onto genome assembly
using BLAT4.
Gene predictors used for annotation of amphioxus v1.0 included ab
initio FGENESH 8, homology-
based FGENESH+ 8, homology-based GENEWISE 9, and EST-based ESTEXT (Grigoriev,
unpublished, available upon request). ...
PLoS ONE.
2008; 3(3): e1889.
Genome-Wide Detection of Serpentine Receptor-Like Proteins in Malaria Parasites
Luciana Madeira et al.,
1Departamento de Parasitologia, Instituto de Ciencias Biome'dicas, Universidade de Sa~o Paulo, Sa~o Paulo, Brasil
2Departamento de Bioqui'mica, Instituto de Qui'mica, Universidade de Sa~o Paulo, Sa~o Paulo, Brasil
... These sequences were submitted to a HMM plus similar protein-based gene prediction
using the FGENESH+ program [22] (http://www.softberry.com), setting the ...
Nature
2008, 4doi:10.1038/nature07410
The Phaeodactylum genome reveals the evolutionary history of diatom genomes.
Bowler et al.
1. CNRS UMR8186, Department of Biology, Ecole Normale Supe'rieure, 46 rue d'Ulm, 75005 Paris, France
2. Stazione Zoologica 'Anton Dohrn', Villa Comunale, I-80121 Naples, Italy
... Gene predictors used for these annotations included ab initio Fgenesh 12 trained on sets of known
genes and reliable homology-based gene models from P. tricornutum and T.pseudonana, and homology-based Fgenesh+ 12
and Genewise 13 seeded by BLASTX alignments against sequences in the NCBI non-redundant protein set. ...
Nucleic Acids Research
(2007), doi:10.1093/nar/gkm768
ChromDB: The Chromatin Database
Karla Gendler, Tara Paulsen and Carolyn Napoli
BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA
... In many cases, we have derived our own transcript models from genomic sequences
using FGNESH or FGENESH+ licensed from Softberry (http://www.softberry.com). ...
BMC Genetics
2008, 9:78 doi:10.1186/1471-2156-9-78
Genomic Complexity of the Variable Region-Containing Chitin-Binding Proteins
in Amphioxus
Dishaw et al.,
All Children’s Hospital,Department of Molecular Genetics,801SixthStreet South,St. Petersburg,FL
33701,USA
... html),FGENESH and FGENESH+ (http://linux1.softberry.com/all.htm) or
genomescan[63,66] (http://genes.mit.edu/genomescan. html).Details ...
Fish & Shellfish Immunology
Volume 22, Issue 4, April 2007, Pages 351-362
Characterization of an interleukin-15 like (IL-15L) gene from zebrafish (Danio rerio)
I. Gunimaladevi, Ram Savan, Kenji Sato, Ryoji Yamaguchi and Masahiro Sakai
he United Graduate School of Agricultural Sciences, Kagoshima University, Korimoto 1-21-24, Kagoshima, Japan
... 15 gene sequences. The intron-exon structure was determined by FGENESH+
(http://www.softberry.com/berry.phtml). Gene-specific ...
Fungal Genetics and Biology
Volume 44, Issue 2, February 2007, Pages 77-87
Extracellular oxidative systems of the lignin-degrading Basidiomycete Phanerochaete chrysosporium
Phil Kersten and Dan Cullen
Forest Products Laboratory, USDA, One Gifford Pinchot Drive, Madison, WI 53705, USA
... Predictions were based on ab initio methods Fgenesh (Salamov and Solovyev, 2000),
homology-based methods, Fgenesh+ (www.softberry.com) and Genewise (Birney and ...
J. Biol. Chem.
Vol. 282, Issue 19, 13984-13993, May 11, 2007
Molecular and Functional Characterization of
Inositol Trisphosphate Receptors during Early Zebrafish Development
Rachel Ashworth et al.,
School of Biological and Chemical Sciences, Queen Mary University of London, London E1 4NS, United Kingdom
... sequences using the FGENESH+ program, a hidden-Markov model-based algorithm for
finding genes with protein similarity, accessible at the Softberry web site. ...
PLoS Biol
(2007) 5(10): e275 doi:10.1371/journal.pbio.0050275
A Novel Snf2 Protein Maintains trans-Generational Regulatory States Established by Paramutation in Maize
Hale CJ, Stonaker JL, Gross SM, Hollick JB
Department of Plant and Microbial Biology, University of California Berkeley, Berkeley, California, United States of America
... for CHR156 was identified from BAC CH201-3L17 (GenBank accession AC194602), and
gene model prediction was performed using FGENESH+ (Softberry, http: / /www ...
Journal of Molecular Evolution
2007 Volume 65, Number 2 pp. 137-153
Comprehensive Analysis of Animal TALE Homeobox Genes: New Conserved Motifs and Cases of Accelerated Evolution
Krishanu Mukherjee and Thomas R. Burglin
Department of Biosciences and Nutrition, Karolinska Institutet, and School of Life Sciences, Sodertorns Hogskola, Huddinge, Sweden
... carried out with the genomic sequence using the MIT GENSCAN server (http://genes.mit.edu/GENSCAN.html),
as well as the FGENESH+ server at Softberry (http://www ...
Genetics
Vol. 176, 599-609, May 2007
The FLOWERING LOCUS T-Like Gene Family in Barley (Hordeum vulgare)
Sebastien Faure, Janet Higgins, Adrian Turner and David A. Laurie
John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom
... New gene predictions were made using FGENESH+ and PROT_MAP (http://sun1.softberry.
com) for FT-like genes showing incorrect alignment within the PEBP domain and ...
PNAS
| May 1, 2007 | vol. 104 | no. 18 | 7705-7710
The tiny eukaryote Ostreococcus provides genomic insights into the paradox of plankton speciation
Brian Palenik et al.,
aScripps Institution of Oceanography, University of California at San Diego, La Jolla, CA 92093-0202; cJoint Genome Institute and Stanford Human Genome Center, Stanford University School of Medicine, 975 California Avenue, Palo Alto, CA 94304;
... Gene prediction methods used for annotation of two Ostreococcus genomes included
ab initio Fgenesh (40), homology-based Fgenesh+ (SoftBerry), Genewise (41 ...
Nature Biotechnology
25, 319 - 326 (2007)
Published online: 4 March 2007 | doi:10.1038/nbt1290
Genome sequence of the lignocellulose-bioconverting and
xylose-fermenting yeast Pichia stipitis
Thomas W Jeffries et al.,
US Department of Agriculture, Forest Service, Forest Products Laboratory, One Gifford Pinchot Drive, Madison, Wisconsin 53705, USA.
Department of Bacteriology, University of Wisconsin-Madison, 420 Henry Mall, Madison, Wisconsin 53706, USA.
... Gene prediction methods used for analysis of the P. stipitis genome include ab initio
Fgenesh 44 , homology-based Fgenesh+ (http://www.softberry.com/) and ...
Molecular Plant Pathology
Volume 8 Issue 1 Page 111-120, January 2007
Isolation and characterization of the mating type
locus of Mycosphaerella fijiensis, the causal agent of
black leaf streak disease of banana
LAURA CONDE-FERRAEZ et al.,
Centro de Investigacion Cientifica de Yucatan (CICY), Calle 43 no. 130, Chuburna
de Hidalgo, C.P. 97200, Merida, Yucatan, Mexico
... Identification of open reading frames (ORFs) and gene predictions were performed
using FGENESH and FGENESH+ software (Softberry™, http:/ / www.softberry.com ...
Insect Molecular Biology
15 (5), 541 - 549.
doi:10.1111/j.1365-2583.2006.00674.x
Proteomic analyses of male contributions to honey bee sperm storage and mating
A. M. Collins, T. J. Caperna, V. Williams, W. M. Garrett, J. D. Evans
Bee Research Laboratory, ARS, USDA, Beltsville, MD, USA; *Growth Biology Laboratory, ARS, USDA, Beltsville, MD, USA; and Biotechnology and Germplasm Laboratory, ARS, USDA, Beltsville, MD, USA
... 2006) combined with a partially redundant database of ab initio proteins predicted
by Genscan (Burge & Karlin, 1997) and FGENESH+ ( http:/ / www.softberry.com ...
J. Biol. Chem.,
Vol. 281, Issue 51, 39388-39395, December 22, 2006
A Toll Receptor and a Cytokine, Toll5A and Spz1C, Are Involved
in Toll Antifungal Immune Signaling in the Mosquito Aedes aegypti*
Sang Woon Shin1, Guowu Bian1, and Alexander S. Raikhel2
From the Department of Entomology and the Institute for Integrative Genome Biology, University of California, Riverside, California 92521
... possible orthologues of Drosophila Toll and Toll-5. The open reading frames from
these two loci were predicted using FGENESH+ (27) (sun1.softberry.com) by ...
Nature
434, 980-986 (21 April 2005)
The genome sequence of the rice blast fungus Magnaporthe grisea
Dean et al.,
Center for Integrated Fungal Research, North Carolina State University, Raleigh, North Carolina 27695, USA
School of Biological and Chemical Sciences, University of Exeter, Washington Singer Laboratories, Exeter EX4 4QG, UK
...Gene predictions were performed using FGENESH/FGENESH1 + trained on M. grisea sequences (SoftBerry) and GENEWISE (Sanger Center) and validated against 65 characterized M. grisea genes. Additional information and gene identification...
Genome Research
14:685-692, 2004
Automated Whole-Genome Multiple Alignment of Rat, Mouse, and Human
Michael Brudno1 et al
1 Department of Computer Science, Stanford University, Stanford, California 94305, USA
... Fgenesh+ gene prediction is conducted on sequences with protein homology ...
Genome Research
13:313-322 2003
Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.313703.
A Complexity Reduction Algorithm for Analysis and Annotation of Large Genomic Sequences
Trees-Juen Chuang,1 et al
1Bioinformatics Research Center, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan;
...Numerous ab initio prediction programs have been used extensively in genome annotation, including FGENESH (Solovyev et al. 1995; Salamov and Solovyev 2000),
...Successful implementation of this method includes AAT (Huang et al. 1997), FGENESH+ and FGENESH++ (Salamov and Solovyev 2000),...
. Among these programs FGENESH+ (and FGENESH++), GenomeScan, GeneWise, and Procrustes are combined tools of sequence homology and ab initio annotation.
Annual Review of Genomics and Human Genetics
Vol. 3: 293-310 (Volume publication date September 2002)
DATABASES AND TOOLS FOR BROWSING GENOMES
Ewan Birney,1 Michele Clamp,2 and Tim Hubbard2
1European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, United Kingdom; e-mail: birney@ebi.ac.uk
2Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, United Kingdom; michele@sanger.ac.uk th@sanger.ac.uk
... Another predicted gene track on the UCSC browser comes from Softberry ( http:/ /
www.softberry.com ) and uses a program Fgenesh+, which is based on HMMs and ...
FGENESH++
BMC Genomics
2016 17:540 DOI: 10.1186/s12864-016-2843-7
Evolutionary and functional analysis of mulberry type III polyketide synthases
Li, H. et al.,
State Key Laboratory of Silkworm Genome Biology, Southwest University
... All hits were analyzed using the Fgenesh++ program (http://www.softberry.com) [21, 48]. ...
Biotechnology and Bioengineering
2015 DOI 10.1002/bit.25864
Engineering Rhodosporidium toruloides for increased lipid production
Zhang et al.,
1: Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America.
2: Department of Bioengineering, University of California, Berkeley, California, United States of America.
... Genome annotation was performed using an automated software pipeline FGENESH++
(http://www.softberry.com) version 3.1.1. Genes were first predicted ab initio using FGENESH... Gene prediction
parameters were obtained from Softberry and were based on Puccinia spp. ...
Nature Genetics
45, 456–461 (2013) doi:10.1038/ng.2569
The draft genome of the fast-growing non-timber forest species moso bamboo (Phyllostachys heterocycla)
Peng et al.,
Research Institute of Forestry, Chinese Academy of Forestry, Key Laboratory of Tree Breeding and Cultivation, State Forestry Administration, Beijing, China.
National Center for Gene Research, Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China.
... as used in genomic sequencing. Annotation of protein-coding genes. Protein-coding
gene models were derived from evidence-based FgeneSH++(Softberry)
pseudomolecules (Supplementary Fig. 7). To facilitate gene models ...
Nature Genetics
43, 913–918 (2011) doi:10.1038/ng.889
The genome of the extremophile crucifer Thellungiella parvula
Dassanayake et al.,
Department of Plant Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois, USA.
Office of Networked Information Technology, School of Integrative Biology, University of Illinois at Urbana-Champaign, Urbana, Illinois, USA.
...Random shotgun genomic libraries were constructed according to the manufacturer's recommendations for each of the two pyrosequencing platforms, GS FLX Titanium (454 Life Sciences) and Illumina GA2 (Illumina). Newbler (454-Roche), ABySS29 and minimus2 (ref. 30) were used as the main assembly programs to generate the draft genome, and FGENESH++ (SoftBerry), GENSCAN, BLAST (see URLs) and Blast2GO12 were used to predict and annotate gene models. ...
...FGENESH++ (SoftBerry) was used to predict protein coding ORFs in the T. parvula draft genome masked for repetitive sequences, with parameters optimized for dicot plants and protein sequences from the NCBI non-redundant (NR) database as reference....
Insect Molecular Biology
Volume 19, Issue Supplement s2, pages 5–12, March 2010
AphidBase: a centralized bioinformatic resource for annotation of the pea aphid genome
Legeai et al.,
1 INRA UMR, Le Rheu cedex, France;
2 INRIA Centre Rennes – Bretagne Atlantique, GenOuest, Campus de Beaulieu, Rennes, France;
... Evidence-based prediction programs such as Augustus (Stanke et al., 2006), Fgenesh++ (unpubl.,
http://www.softberry.com) or the NCBI RefSeq pipeline are generally considered most reliable
because they are better able to characterize untranslated regions (UTRs) and ...
J. Proteome Res.
2010, 9 (2), pp 990–996
DOI: 10.1021/pr900885k
A Hybrid, de Novo Based, Genome-Wide Database Search Approach Applied to the Sea Urchin Neuropeptidome
Menschaert et al.,
Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Laboratory for Bioinformatics and Computational Genomics, Ghent University, B-9000 Ghent, Belgium
... The gene prediction program, Fgenesh++ (www.softberry.com), was applied to the
genomic sequences corresponding to the newly identified peptides. The softberry
gene finding software has a model trained for the sea urchin. ...
Nature
2008, 452, 949 - 955.
The genome of the model beetle and pest Tribolium castaneum.
Richards et al.
1. Human Genome Sequencing Cente
2. Department of Molecular and Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA.
... Work at the BCM-HGSC was funded by grants from the NHGRI and USDA. FgenesH and FgenesH++ analysis
was donated by Softberry Inc. This research was additionally supported in part by the Intramural...
Genome Biology
2006, 7(Suppl 1):S10 doi:10.1186/gb-2006-7-s1-s10
Automatic annotation of eukaryotic genes, pseudogenes and promoters
Victor Solovyev, Peter Kosarev, Igor Seledsov and Denis Vorobyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Softberry Inc., Radio Circle, Mount Kisco, NY10549, USA
... The Fgenesh++ gene prediction pipeline can identify 91% of coding nucleotides with a
specificity of 90%. ...
Am. J. Hum. Genet.,
76:652-662, 2005
Position Effects Due to Chromosome Breakpoints that Map 900 Kb Upstream and 1.3 Mb Downstream of SOX9 in Two Patients with Campomelic Dysplasia
Gopalrao V. N. Velagaleti,1,2,* et al,.
Departments of 1Pathology and 2Pediatrics, University of Texas Medical Branch, Galveston; Departments of 3Molecular and Human Genetics and 4Pediatrics, Baylor College of Medicine, and 5Texas Children's Hospital, Houston; and 6Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN
...In an effort to identify possible transcripts that may be responsible for the CD phenotype, we used several gene-prediction programs and identified seven hypothetical transcripts in the region that spans 100 kb in either direction from the breakpoint on chromosome 17 Ecgenes H17C12306.1 and H17C12308.1, SGP genes Chr17_1538.1 and Ch17_1539.1, Fgenesh++ gene C17001650, and Genscan genes NT_010641.44 and NT_010641.45....
Genome Research
15:566-576, 2005
ECgene: Genome-based EST clustering and gene modeling for alternative splicing
Namshin Kim1,2, Seokmin Shin2 and Sanghyuk Lee1,3
1 Division of Molecular Life Sciences, Ewha Womans University, Seoul 120-750, Korea; 2 School of Chemistry, Seoul National University, Seoul 151-747, Korea
...the structure of full-length mRNA can be inferred by examining the flanking genomic region, especially with the aid of ab initio gene predicting programs such as Genscan (Burge and Karlin 1997 ) and Fgenesh++ (Salamov and Solovyev 2000 )...
Plant Physiology
139:1612-1624 (2005)
Structure and Architecture of the Maize Genome
Haberer et al.,
Munich Information Center for Protein Sequences, Institute for Bioinformatics, Gesellschaft fur Strahlenforschung Research Center for Environment and Health, D–85764 Neuherberg, Germany (G.H., H.G., K.F.X.M.); Broad Institute of the Massachusetts Institute of Technology and Harvard, Cambridge, Massachusetts 02141 (S.Y., C.R., S.R., B.B., C.N.);
... Genes were detected by applying FGeneSH++ (Salamov and Solovyev, 2000 Go ;
Genome Research
14:685-692, 2004
Automated Whole-Genome Multiple Alignment of Rat, Mouse, and Human
Michael Brudno1 et al.
1 Department of Computer Science, Stanford University, Stanford, California 94305, USA;
... we built a three-way synteny map based on chains of Fgenesh++-predicted (Solovyev 2002 ) exons, rather than whole genes. ...
Genome Research
14:539-548, 2004
Characterization of Evolutionary Rates and Constraints in Three Mammalian Genomes
Gregory M. Cooper1 et al
1 Department of Genetics, Stanford University, Stanford, California 94305, USA;
....The gene annotations used to classify the constrained elements contain nearly 40,000 genes, including RefSeq genes and gene predictions; they are based on annotations for the human, mouse, and rat genomes made by Fgenesh++ software developed by Softberry Inc. (Solovyev 2002; http://www.softberry.com )....
Nucleic Acids Research,
2003, Vol. 31, No. 1 207-211
The PEDANT genome database
Dmitrij Frishman*,1 et al
1 Institute for Bioinformatics, GSF - National Research Center for Environment and Health, Ingolstadter Landstra?e 1, 85764 Neueherberg, Germany
... The mouse database contains 20 chromosome contigs with 37 793 genes predicted using the Fgenesh++ software (www.softberry.com). ...
Genome Research
13:1765-1774, 2003
Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assay
Shirin Khambata-Ford1,5 et al
1 Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA;
...Of 858 sequences, 9% of GFP+ low clones and 8% of GFP+ high clones aligned to the 2-kb segment upstream of the transcription start site of a predicted gene in at least two of four data sets of predicted genes from Genscan, Ensembl, Softberry (Fgenesh++), and Acembly (category B in Table 1).
Genome Research
13:313-322 ©2003
Received March 27, 2002; accepted in revised form December 3, 2002.
Article and publication are at http://www.genome.org/cgi/doi/10.1101/gr.313703.
A Complexity Reduction Algorithm for Analysis and Annotation of Large Genomic Sequences
Trees-Juen Chuang,1 et al
1Bioinformatics Research Center, Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan;
...Numerous ab initio prediction programs have been used extensively in genome annotation, including FGENESH (Solovyev et al. 1995; Salamov and Solovyev 2000),
...Successful implementation of this method includes AAT (Huang et al. 1997), FGENESH+and FGENESH++ (Salamov and Solovyev 2000),...
. Among these programs FGENESH+ (and FGENESH++), GenomeScan, GeneWise, and Procrustes are combined tools of sequence homology and ab initio annotation.
Archives of Biochemistry and Biophysics
Volume 409, Issue 2, 15 January 2003, Pages 287-297
Mitochondrial and nucleocytoplasmic isoforms of O-linked GlcNAc transferase encoded by a single mammalian gene
Hanover et al.,
Laboratory of Cell Biochemistry and Biology, NIDDK, National Institutes of Health, Building 8, Room 402, 8 Center Drive, MSC 0850, NIH, Bethesda, MD 20892-0850, USA
... Ensembl, Fgenesh ++, and the TSSW Promoter Prediction algorithms
(http://www.softberry.com/berry.phtml) were initially employed. ...
Cell,
Vol. 110, 521-529, August 23, 2002, Copyright .2002 by Cell Press
HIV-1 Integration in the Human Genome Favors Active Genes and Local Hotspots
Astrid R.W. Schroder,1 et al
1Infectious Disease Laboratory
...An integration target sequence was scored as a part of a transcrip-tion unit if it was (1) a member of the Refseq set of well-studied genes (http://www.ncbi.nlm.nih.gov/LocusLink/refseq.html) or (2) if , it was predicted to be a transcription unit by the ENSEMBLE (http://www.ensembl.org) or Fgenesh++ (http://www.softberry.com/Help/fgeneshplus2.htm) programs and if that assignment was supported by mRNA or spliced EST sequence evidence.
Genome Res.
2002. 12: 1549-1555
Mosaic Organization of Orthologous Sequences in Grass Genomes
Rentao Song,
Victor Llaca 1, and
Joachim Messing 2
Waksman Institute, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854-8020, USA
... Gene prediction was based on both GeneScan (http://genes.mit.edu/Genscan.html) and
FGENESH++ (http://www.softberry.com./berry.phtml?topic=gfind). ...
Reprint from
Daily Biotech Updates . . . www .genengnews.com
Vol. 22, No. 17 , October 1, 2002
DrugDiscovery
Tech Note:An Enhanced Human-Genome Database Transforming Raw Human Sequence Data Into Useful Information
Christine Schuller, Ph.D., and
Andreas Fritz, Ph.D
The Softberry analysis results, for which Biomax has the exclusive world-wide commercial license, contain approximately 40,000 genes, which agrees well with predictions of the total number of human genes (according to the International Human Genome Sequencing Consortium, or IHGSC).
... For example, 50% of the genes in the Biomax Human Genome Database are not found in the Ensembl database. ..
These genes (identified by FGENESH++ and Biomax, and not found in Ensembl database) comprise the following: 6% of genes classified as known genes, 50% classified as having some similarity to known genes, and 90% of the genes not having similarity to known genes
For human genome applications, the FGENESH++ software was first used to map known human genes using sequences available from the Reference Sequence (RefSeq) Project at the Nation al Center for Biotechnology Information (NCBI; Bethesda, MD; www.ncbi.nlm. nih.gov/LocusLink/refseq.html).
REFERENCES
1. Salamov AA and Solovyev VV,Ab initio gene finding in Drosophila genomic DNA. Genome Res 10: 391-7 (2000).
FGENESH-C
The FASEB Journal
January 2013 vol. 27 no. 1 86-97 DOI:10.1096/fj.12-219444
Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female
Dottorini et al.,
*Department of Experimental Medicine and
†Department of Industrial Engineering, University of Perugia, Perugia, Italy;
‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK; and
§Department of Genetics, University of Cambridge, Cambridge, UK
... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted
using FGENESH-C, FGENESH+ (http://linux1.softberry.com/), Wise2 (http://www.ebi.ac.uk/), and
Genescan (http://genes.mit.edu/GENSCAN.html). Mosquito rearing and mating analysis. ...
Gene
Volume 528, Issue 2, 10 October 2013, Pages 267–276 DOI:10.1016/j.gene.2013.06.062
The metacaspase gene family of Vitis vinifera L.: Characterization and differential expression during ovule abortion in stenospermocarpic seedless grapes
Zhang et al.,
a College of Horticulture, Northwest A&F University, Yangling, Shaanxi 712100, China
b Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Northwest Region), Ministry of Agriculture, Yangling, Shaanxi 712100, China
... Intron and exon organizations of metacaspases were analyzed by using FGENESH-C
(http://linux1.softberry.com/berryphtml?topic=fgenes_c&group=programs&subgroup=gfs); to
determine the locations of metacaspases on chromosomes, the metacaspases were further used ...
The FASEB Journal
Published online before print September 20, 2012 DOI: 10.1096/fj.12-219444
Regulation of Anopheles gambiae male accessory gland genes influences postmating response in female
Dottorini et al.,
*Department of Experimental Medicine and
†Department of Industrial Engineering, University of Perugia, Perugia, Italy;
‡Department of Biological Sciences, Imperial College London, South Kensington Campus, London, UK;
... The full-length sequence, structure, and the multiple variants of the HSF gene were predicted
using FGENESH-C, FGENESH (http://linux1.softberry.com/), Wise2 (http:// www.ebi.ac.uk/), and
Genescan (http://genes.mit.edu/ GENSCAN.html). Mosquito rearing and mating analysis ...
J. Exp. Bot.
(2011) 62 (15): 5641-5658. doi: 10.1093/jxb/err249
Flowering time variation in oilseed rape (Brassica napus L.) is associated with allelic variation in the FRIGIDA homologue BnaA.FRI.a
Wang et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany
2Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China
... online). The genes were annotated using pairwise sequence alignments (BLAST2;
http://www.ncbi.nlm.nih.gov) with FRI and the FGENESH+ and FGENESH_C gene
prediction programs (http://linux1.softberry.com/berry.phtml). ...
J. Exp. Bot.
(2011) 62 (10): 3359-3374. doi: 10.1093/jxb/erq321
Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris
Abou-Elwafa et al.,
1Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany
2Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK
... Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2;
http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and
FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...
J. Exp. Bot.
2010 doi: 10.1093/jxb/erq321
Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris
Abou-Elwafa et al.,
1 Plant Breeding Institute, Christian-Albrechts-University of Kiel, Olshausenstr. 40, D-24098 Kiel, Germany
2 Broom's Barn Research Centre, Higham, Bury St. Edmunds, Suffolk IP28 6NP, UK
.. Beta vulgaris sequences were annotated using pairwise sequence alignments (BLAST2;
http://www.ncbi.nlm.nih.gov) against putative A. thaliana orthologues and the FGENESH+ and
FGENESH_C gene prediction programs (http://linux1.softberry.com/berry.phtml) for ...
FGENESH-2
PLoS ONE
(2013), 8(1): e53525. doi:10.1371/journal.pone.0053525
A Genome-Wide Association Study Identifies Genomic Regions for Virulence in the Non-Model Organism Heterobasidion annosum s.s.
Dalman et al.,
Uppsala BioCenter, Department of Forest Mycology and Plant Pathology, Swedish University of Agricultural Sciences, Uppsala, Sweden
...he gene annotations found in TC32-1 were transferred to the reference sequence using PROT_MAP, FGENESH-2 (SoftBerry, Mount Kisco, NY) and Artemis ...
Eukaryotic Cell
August 2010, p. 1225-1235, Vol. 9, No. 8 doi:10.1128/EC.00031-10
Methylenetetrahydrofolate Reductase Activity Is Involved in the Plasma Membrane Redox System Required for Pigment Biosynthesis in Filamentous Fungi
Frandsen et al.,
Division
... MTHFR homologs in complete Ascomycota genomes were identified in the listed databases using
the blastp and tblastn algorithms with default settings (1). All Pezizomycotina tblastn hits were
annotated using FGENEH-2 from Softberry (Mount Kisco, NJ) with FgMET13p as a ...
J Immunol.
2010 Feb 1;184(3):1379-91. Epub 2009 Dec 21
A small, variable, and irregular killer cell Ig-like receptor locus accompanies the absence of MHC-C and MHC-G in gibbons
Abi-Rached et al.,
Department of Structural Biology, Stanford University, Stanford, CA 94305, USA.
... Foster City, CA). Exons and introns of genes were either identified manually or by
using the BLAST (www.ncbi.nlm.nih.gov/BLAST) and FGENESH-2 (www.softberry.
com/all.htm) algorithms. Phylogenetic analysis of KIR. KIR gene ...
The Journal of Immunology
2009, doi:10.4049/jimmunol.0903016
A Small, Variable, and Irregular Killer Cell Ig-Like Receptor Locus Accompanies the Absence of MHC-C and MHC-G in Gibbons
Abi-Rached et al.,
Department of Structural Biology, Stanford University, Stanford, CA 94305; Max Planck Institute for Molecular Genetics, Berlin-Dahlem
... Biosystems, Foster City, CA). Exons and introns of genes were either identified manually
or by using the BLAST (www.ncbi.nlm.nih.gov/ BLAST) and FGENESH-2
(www.softberry.com/all.htm) algorithms. Phylogenetic analysis of KIR ...
PLoS Genet.
2009 Oct;5(10):e1000688. Epub 2009 Oct 16.
A novel system of polymorphic and diverse NK cell receptors in primates
Averdam et al.,
Department of Primate Genetics, German Primate Centre, Gottingen, Germany.
... Both programs are available from Phil Green, University of Washington. Exons and introns of
genes were identified in finished BAC clone sequences manually or by BLAST and
FGENESH-2 algorithms (http://www.ncbi.nlm.nih.gov/BLAST/; http://www.softberry.com/all.htm). ...
The Journal of Immunology
2007, 178: 7151-7161.
Genomics and Diversity of the Common Marmoset Monkey NK Complex
Anne Averdam et al.,
Department of Primate Genetics and Primate Husbandry,
German Primate Center, Gottingen, Germany; Max Planck Institute
for Molecular Genetics, Berlin, Germany; and Department of
Biological Sciences, University of South Carolina, Columbia, SC 29208
... BLAST and FGENESH-2 algorithms (http://www.ncbi.nlm.nih.gov/BLAST/;
http://www.softberry.com/all.htm) identified exons and introns
of genes in finished BAC ...
FGENESH++C
Nucleic Acids Research,
2006, Vol. 34, Database issue D568-D571
The Mouse Functional Genome Database (MfunGD): functional annotation of proteins in the light of their cellular context
Andreas Ruepp1,* et al.,
1Institute for Bioinformatics (MIPS), GSF National Research Center for Environment and Health Ingolstaedter Landstrasse 1, D-85764 Neuherberg, Germany
... The basis of the MfunGD dataset is a complement of gene products that was obtained
by Softberry Inc., which used the FGENESH++C software as gene predictor. ...
Nature
425, 209-215 (11 September 2003) | doi:10.1038/425209a
Bioinformatics: Programmed for success
Steve Buckingham
... Three-way synteny from Softberry. Fast searching is also a
feature of Genome Explorer
from Softberry in Mount Kisco, New York, which uses the FMAP algorithm. ...
...... Softberry, for example, offers a number of gene-prediction programs that can be accessed over
the web, including FGENESH, which ... The fully automated FGENESH++C will automatically
annotate any genome (other than human) to a standard claimed to be indistinguishable ...
FGENESB
BMC Genomics
2016, 17:326 DOI: 10.1186/s12864-016-2680-8
Xylan degradation by the human gut Bacteroides xylanisolvens XB1A T involves two distinct gene clusters that are linked at the transcriptional level
Despres, J. et al.,
Institut National de la recherche Agronomique (INRA), UR454 Microbiologie; INRA, Plate-forme d’Exploration du Metabolisme
... Putative promoters and terminators were searched within intergenic sequences (>100 bp) using different tools
(BPROM, PPP, Arnold) available at http://molbiol-tools.ca/Promoters.htm. Operon prediction was carried out using
FGENESB, which is based on distances between ORFs and frequencies of different genes neighboring each other in known bacterial genomes, as well as on promoter and terminator predictions (http://www.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...
PloS one
2016, 11(1), e0146832.
Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum"
Ullrich, S. R. et al.,
Institute of Biological Sciences, TU Bergakademie Freiberg, Leipziger Stra?e 29, Freiberg, Germany; Georg-August-University Gottingen, Genomic and Applied Microbiology & Gottingen Genomics Laboratory, Grisebachstra?e 8, Gottingen, Germany
... Regulatory sequences within the urease gene cluster were predicted using the software FGENESB with default settings (Softberry Inc., Mount Kisco, NY, USA). ...
Gene
Volume 593, Issue 1, 15 November 2016, Pages 154–161 http://dx.doi.org/10.1016/j.gene.2016.08.009
Identification and in silico characterization of two novel genes encoding peptidases S8 found by functional screening in a metagenomic library of Yucatan underground water
Apolinar–Hernandez, M. M. et al.,
a Unidad de Biotecnologia, Centro de Investigacion Cientifica de Yucatan A.C., Calle 43 No. 130, Chuburna de Hidalgo, Merida, Yucatan CP 97200, Mexico
b El Colegio de la Frontera Sur (ECOSUR) Unidad Campeche, Avenida Rancho Poligono 2A, Ciudad Industrial Lerma, Campeche, Campeche CP 24500, Mexico
... ORFs in the contigs were predicted by using the Glimmer3 system (with default parameters)
(Salzberg et al., 1998), and results were verified with fgenesB (Solovyev and Salamov,
2011) (http://www.softberry.com/berry.phtml?topic=fgenesb). ...
Curr Genet
2016 DOI 10.1007/s00294-016-0568-4
Genome-wide bioinformatics analysis of steroid metabolism-associated genes in Nocardioides simplex VKM Ac-2033D
Donova, V. et al.,
1 Department of Bioengineering and Bioinformatics, M.V. Lomonosov Moscow State University, Leninskie Gory, h. 1, b. 73, Moscow 119991, Russian Federation
2 Institute for Information Transmission Problems, Russian Academy of Sciences, Bolshoy Karetny per. 19, b. 1, Moscow 127051, Russian Federation
... The complete genome sequence in GenBank: CP009896. Operons with found genes
were calculated with internet-service FgenesB (http://linux1.softberry.com/
berry.phtml?topic=fgenesb&group=programs&subgroup =gfindb). ...
Applied and environmental microbiology
2016, 82(1), 192-201. doi: 10.1128/AEM.01827-15
A novel bacteriophage targeting Cronobacter sakazakii is a potential biocontrol agent in foods
Lee, J. H. et al.,
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute of Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul, South Korea
bDepartment of Food Science and Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin, South Korea
... All of the open reading frames (ORFs) were predicted with the bacterial genetic code parameter
using the Glimmer version 3.02 (29), GeneMarkS (30), and FgenesB software programs (Softberry,
Inc., Mount Kisco, NY, USA), and their ribosomal binding sites were confirmed by ...
PloS one
2016, 11(5), e0155537. http://dx.doi.org/10.1371/journal.pone.0155537
Falsirhodobacter sp. alg1 Harbors Single Homologs of Endo and Exo-Type Alginate Lyases Efficient for Alginate Depolymerization
Mori, T. et al.,
Faculty of Science and Engineering, Waseda University, Tokyo, Japan
Department of Life Sciences, Graduate School of Bioresources, Mie University, Mie, Japan
...Operon and standalone genes were predicted using the FGENESB online prediction tool (Softberry) [25]. ...
Frontiers in microbiology
2016, 7: 687. doi: 10.3389/fmicb.2016.00687
The rnc Gene Promotes Exopolysaccharide Synthesis and Represses the vicRKX Gene Expressions via MicroRNA-Size Small RNAs in Streptococcus mutans
Mao, M. Y. et al.,
1State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China
2Department of Dentistry, Yan'an Hospital Affiliated to Kunming Medical University, Kunming, China
... We first analyzed
these intergenic noncoding sequences by FGENESB and BPROM programs for operon and
promoter prediction, respectively (http://linux1.softberry.com/berry.phtml) (Solovyev and ...
Plasmid
2016, Volumes 84–85, March–May 2016, Pages 36–43. doi:10.1016/j.plasmid.2016.02.005
The ancient small mobilizable plasmid pALWED1. 8 harboring a new variant of the non-cassette streptomycin/spectinomycin resistance gene aadA27
Kurakov, A. et al.,
a Institute of Molecular Genetics, Russian Academy of Sciences, Kurchatov sq. 2, 123182 Moscow, Russia
b Institute of Bioengineering, Research Center of Biotechnology of the Russian Academy of Sciences, Leninsky Ave. 33, bld. 2, 119071 Moscow, Russia
.. Putative ORFs and promoters were detected using
BPROM, FGENESB (http://www.softberry.com/berry.html), and GeneMark.hmm for ...
Current genetics
2016, Volume 62, Issue 3, pp 643-656 DOI: 10.1007/s00294-016-0568-4
Genome-wide bioinformatics analysis of steroid metabolism-associated genes in Nocardioides simplex VKM Ac-2033D
Shtratnikova, V. Y., et al.,
Department of Bioengineering and Bioinformatics, M.V. Lomonosov Moscow State University
Institute for Information Transmission Problems, Russian Academy of Sciences
.. Operons with found genes were calculated with
internet-service FgenesB (http://linux1.softberry.com/ berry.phtml?topic=fgenesb&group ...
Standards in Genomic Sciences
2016, 11:36 DOI: 10.1186/s40793-016-0161-y
Draft genome sequence of Fusicladium effusum, cause of pecan scab
Bock, C. H., Chen, C., Yu, F., Stevenson, K. L., Wood, B. W.
Southeastern Fruit and Tree Nut Research Lab, USDA, Agricultural Research Service
... Ab initio gene prediction with the FGENESB package (Softberry Inc.) predicted...
Virus research
2016, 155(2), 433-439. doi:10.1016/j.virusres.2010.11.012
The genome sequence and proteome of bacteriophage ?CPV1 virulent for Clostridium perfringens
Volozhantsev, N. V. et al.,
a State Research Center for Applied Microbiology & Biotechnology, Obolensk, Moscow Region, Russian Federation
b Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA 30605, USA
... genes
(ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology.
gatech.edu/GeneMark; Lukashin and Borodovsky, 1998) and SoftBerry FGENESB (http ...
The ISME Journal
2016 doi:10.1038/ismej.2016.59
A mobile genetic element profoundly increases heat resistance of bacterial spores
Berendsen, E. M., Boekhorst, J., Kuipers, O. P., Wells-Bennik, M. H.
... et al., 2005). For B. subtilis strains, detailed gene and operon predictions within
the Tn1546 transposon were made using FGENESB (www.softberry.com) and
predictions were manually inspected. Specific insertion locations ...
FEMS microbiology letters
2016, 363(12), fnw092. DOI: http://dx.doi.org/10.1093/femsle/fnw092
Characterization of LysPBC4, a novel Bacillus cereus-specific endolysin of bacteriophage PBC4
Na, H., Kong, M., Ryu, S.
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute of Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul 151-921, South Korea
... 2007), GeneMark (Besemer, Lomsadze and Borodovsky 2001), FGENESB (Softberry, Inc., Mount
Kisco, NY) and ARAGORN (Laslett and Canback 2004) software. The function of each ORF was
predicted using NCBI BLASTP and InterProScan (Altschul et al. 1990) databases. ...
Frontiers in microbiology
2014, 5: 189. DOI: 10.3389/fmicb.2014.00189
Combined metagenomic and phenomic approaches identify a novel salt tolerance gene from the human gut microbiome.
Culligan, E. P., Marchesi, J. R., Hill, C., & Sleator, R. D.
1Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Cork, Ireland
2School of Microbiology, University College Cork, Cork, Ireland
3Cardiff School of Biosciences, Cardiff University, Cardiff, UK
... The retrieved sequence was analyzed using the FGENESB software program (Softberry) to identify
putative open reading frames and translated nucleotide sequences were subjected to BLASTP
analysis to assign putative functions to the encoded proteins and identify ...
Genome announcements
2014, 2(2), e00194-14. DOI: 10.1128/genomeA.00194-14
Draft genome sequence of Trueperella pyogenes, isolated from the infected uterus of a postpartum cow with metritis
Goldstone R. J. et al.,
aInstitute of Infection, Immunity and Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow, United Kingdom
bInstitute of Life Science, School of Medicine, Swansea University, Singleton Park, Swansea, United Kingdom
... The prediction of open reading frames (ORFs) was achieved using FgenesB (8) via the SoftBerry
web interface (http://linux1.softberry.com/berry.phtml), rRNA prediction was carried out via the
HMMER Web server (9), and tRNA prediction was done using tRNAscan-SE via the ...
BioMed Research International
2014, Article ID 489782, 7 pages DOI: 10.1155/2014/489782
Characterization of the Opp Peptide Transporter of Corynebacterium pseudotuberculosis and Its Role in Virulence and Pathogenicity
Moraes P. M. R. O. et al.,
1Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, 31270-901 Belo Horizonte, MG, Brazil
2Instituto de Ciencias da Saude, Universidade Federal da Bahia, 40210-340 Salvador, BA, Brazil
... bacteria was performed using the Artemis software. The operon analyses were
performed using SoftBerry (http://linux1.softberry.com/berry.phtml?topic=
fgenesb&group=help&subgroup=gfindb). A similarity analysis of the genes ...
PloS one
2014, 9(2), e90087. DOI: 10.1371/journal.pone.0090087
New Hydrocarbon Degradation Pathways in the Microbial Metagenome from Brazilian Petroleum Reservoirs
Sierra-Garcia I. N. et al.,
Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas - UNICAMP, Campinas, Brazil
Laboratory of Genomics and Expression, University of Campinas - UNICAMP, Campinas, Brazil
... several tools available for gene prediction in prokaryotes through heuristic approaches: Metagene
[14] http://metagene.cb.ku-tokyo.ac.jp/) and MetaGeneMark [15] designed for metagenomic
sequences, GLIMMER 3.02 [16], [17] and FGENESB (http://linux1.softberry.com/berry ...
...Putative ribosomal binding sites were identified using RBSFINDER [22], and the presence
of bacterial promoters and transfer RNA genes was predicted using the programs
BPROM (http://linux1.softberry.com/berry.phtml) and tRNAscan-SE [23], respectively.
...
Plasmid
2014, 71, 23-31. DOI: 10.1016/j.plasmid.2013.10.002
Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains
Kananaviciute, R., Butaite, E., Citavicius, D.
Department of Microbiology and Biotechnology, Faculty of Natural Sciences, Vilnius University, M. K. Ciurlionio 21/27, Vilnius LT-03101, Lithuania
... sequencing of remaining fragments. Open reading frames (ORFs) were predicted using
ORF Finder Program at NCBI website and FGENESB program at Softberry site
(http://linux1.softberry.com/berry.phtml). Potential protein-coding ...
Applied microbiology and biotechnology
2014, 98(5), 2145-2154. DOI: 10.1007/s00253-013-5126-0
Molecular cloning and characterization of a novel acetylalginate esterase gene in alg operon from Sphingomonas sp. MJ-3
Park Y. J. et al.,
1. Department of Food Science and Biotechnology, Kyungsung University, Busan, 608-736, Korea
2. College of Pharmacy, Kyungsung University, Busan, 608-736, Korea
... The PCR primers used for screening and sequencing are listed in Table 1. The positive fosmid
DNAs were sequenced, and then genes or operon were ana- lyzed by using fgenesb program
(http://linux1.softberry.com/ berry.phtml) and ORF finder (http://www.ncbi.nlm.nih.gov ...
Genome announcements
2014, 2(2), e00243-14. DOI: 10.1128/genomeA.00243-14
Genome sequence of a hyperthermophilic archaeon, Thermococcus nautili 30-1, that produces viral vesicles
Oberto J. et al.,
aUniversite Paris-Sud, CNRS, UMR8621, Institut de Genetique et Microbiologie, Orsay, France
bFidelity Systems, Inc., Gaithersburg, Maryland, USA
cInstitut Pasteur, Paris, France
... 16 ? 10 6 reads assembled with Velvet (3). Genome assembly was performed with Consed (4).
The remaining gaps were filled using bacterial artificial chromosome (BAC) sequencing with
Thermofidelase and Fimers (5). Genes were annotated using FGENESB (Softberry). ...
Journal of biotechnology
2014, 174, 14-15. DOI: 10.1016/j.jbiotec.2014.01.022
Complete genome sequence of hyperthermophilic archaeon Thermococcus sp. ES1
Jung J. H. et al.,
a Graduate School of Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea
b Department of Biotechnology, Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute (KAERI), Jeongeup 580-185, Republic of Korea
... polymerase chain reactions. GeneMarkS ( Besemer et al., 2001), Glimmer 3.02 (
Delcher et al., 2007), and FgenesB (Softberry, Inc., Mount Kisco, NY) were used to
predict open reading frames (ORFs). Their functions were verified ...
Journal of biotechnology
2014, 179, 15-16. DOI: 10.1016/j.jbiotec.2014.03.009
Draft genome sequence of Xanthomonas axonopodis pv. glycines 8ra possessing transcription activator-like effectors used for genetic engineering
Lee J. H. et al.,
a Department of Food Science and Biotechnology and Institute of Life Science and Resources, Kyung Hee University, Yongin 446-701, Republic of Korea
b Department of Food and Animal Biotechnology, and Department of Agricultural Biotechnology, Center for Food and Bioconvergence, and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Republic of Korea
... in Macrogen (Korea). ORF prediction was conducted using applications such as
Glimmer3 (Delcher et al., 2007), GeneMarkS (Besemer et al., 2001), and FgenesB
(Softberry, Inc., Mount Kisco, NY). Functional analysis of all ...
Archives of Virology
January 2014, Volume 159, Issue 1, pp 159-162 DOI: 10.1007/s00705-013-1776-6
Complete genome sequence of marine bacterium Pseudoalteromonas phenolica bacteriophage TW1
Hakdong Shin, Ju-Hoon Lee, Chi Sang Ahn, Sangryeol Ryu, Byung Cheol Cho
1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, 151-921, Korea
3. Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Korea
... using a GS-FLX pyrosequencer at Macrogen, Seoul, South Korea, and the qualified sequence
reads were assembled using Newbler v2.3. The open reading frames (ORFs) in the genome
were predicted using GeneMarkS [ 2 ], Glimmer3 [ 5 ], and FgenesB (Softberry, Inc., Mount ...
Archives of virology
2014, 1-4. DOI: 10.1007/s00705-014-2140-1
Complete genome sequence of enterobacteria phage 4MG, a new member of the subgroup "PVP-SE1-like phage" of the "rV5-like viruses"
Kim M., Heu S., Ryu S.
1. Department of Agricultural Biotechnology, Seoul National University, Seoul, 151-921, South Korea
3. Microbial Safety Division, National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, South Korea
... A single contig assembled with quality-filtered reads was analyzed using the tools GeneMarkS [
10 ], Glimmer 3.02 [ 11 ], and FgenesB (Softberry, Inc., NY, USA) for prediction of open reading
frames (ORFs), BlastP [ 12 ], InterProScan [ 13 ], and NCBI Conserved Domain ...
AMB Express
2014, 4(1), 23. http://www.amb-express.com/content/4/1/23
Cloning, expression and characterization of a versatile Baeyer-Villiger monooxygenase from Dietzia sp. D5.
Bisagni, S., Hatti-Kaul, R., Mamo, G.
Department of Biotechnology, Center for Chemistry and Chemical
Engineering, Lund University, P.O. Box 124, SE-22100 Lund, Sweden
... D5 (unpublished data). Identification of ORFs and ana- lysis of the BVMO4 gene and its
deduced protein se- quence was performed with CLCBio Main Workbench (Aarhus, Denmark)
FGENESB (Soft Berry Mount Nysco, USA) and BLASTp at NCBI. ...
Environmental microbiology
2014, 16(5), 1334-1345. DOI:10.1111/1462-2920.12440
Biosynthetic genes and activity spectrum of antifungal polyynes from Collimonas fungivorans Ter331
Fritsche K. et al.,
1 Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Wageningen, The Netherlands
2 BioDetection Systems b.v., Amsterdam, The Netherlands
... al., 2011). Gene colours indicate predicted function (see Supporting Information Table
S1). Arrowed lines above the genes indicate operonic organization, as predicted
by FgenesB (http://www.softberry.com). Black arrow heads ...
Functional & integrative genomics
2014, 1-10. DOI:10.1007/s10142-014-0375-2
Arsenic and cadmium are inhibitors of cyanobacterial dinitrogenase reductase (nifH1) gene
Singh, S., Shrivastava, A. K., Singh, V. K.
1. Molecular Biology Section, Laboratory of Algal Biology, Center of Advanced Study in Botany and Department of Bioinformatics, Banaras Hindu University and Shobhit University, Varanasi and Meerut, 221005, India
2. Centre for Bioinformatics, School of Biotechnology, Banaras Hindu University, Varanasi, 221005, India
... This was followed by FGeneSH B (Salamov and Solovyev 2000) (http://linux1.softberry.com/)
to find out the bacterial operon and to predict transcription regulation within nifH1. Promoter
analysis Virtual footprint 3.0 (Munch et al. 2005) (http://prodoric.tu-bs. ...
Microbial ecology
March 2014. DOI:10.1007/s00248-014-0388-3
Phylogenetic and Functional Analysis of Gut Microbiota of a Fungus-Growing Higher Termite: Bacteroidetes from Higher Termites Are a Rich Source of b-Glucosidase Genes
Zhang, M. et al.,
1. School of Life Sciences, East China Normal University, Shanghai, China
3. Key Laboratory of Insect Development and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China
... 27, 28]. If 50 % ORFs of a contig were all binned to the same phylum, this contigs
could be assigned to this phylum [21]. The ORFs of contigs were predicted by
FgenesB (Softberry, Goteborg, Sweden). ?-Glucosidases were ...
PLOS ONE
December 12, 2013 DOI: 10.1371/journal.pone.0082985
Functional Environmental Screening of a Metagenomic Library Identifies stlA; A Unique Salt Tolerance Locus from the Human Gut Microbiome
Eamonn P. Culligan, Roy D. Sleator, Julian R. Marchesi, Colin Hill
Alimentary Pharmabiotic Centre, University College Cork, Cork, Ireland, School of Microbiology, University College Cork, Cork, Ireland
Cardiff School of Biosciences, Cardiff University, Cardiff, United Kingdom, Department of Hepatology and Gastroenterology, Imperial College London, London, United Kingdom
... platform on a titanium mini-run. Putative open reading frames were predicted using
Softberry FGENESB bacterial operon and gene prediction software (available at
www.softberry.com). Retrieved nucleotide and translated amino ...
J. Virol. November
2013 vol. 87 no. 21 11775-11786 DOI:10.1128/JVI.02173-13
Antirepression System Associated with the Life Cycle Switch in the Temperate Podoviridae Phage SPC32H
Minsik Kim and Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul, South Korea
... were assembled using the GS de novo assembler (v. 2.60), and the open reading frames (ORFs)
that encode proteins of more than 35 amino acids in size were predicted using the software
programs GeneMarkS (17), Glimmer 3.02 (18), and FgenesB (Softberry, Inc., Mount ...
MicrobiologyOpen
Volume 2, Issue 5, pages 717–724, October 2013 DOI:10.1002/mbo3.110
Characterization of mineral phosphate solubilization traits from a barley rhizosphere soil functional metagenome
Chhabra et al.,
1 Department of Science and Health, Institute of Technology Carlow, Carlow, Ireland
2 Department of Microbiology, University College Cork, Cork, Ireland
... The gene calling of sequenced data was carried out using the Fgenesb annotator pipeline
(Softberry Inc., Mount Kisco, NY) (http://linux1.softberry.com), GeneMark.hmm prediction tool
(http://exon.gatech.edu/genemark/) (Besemer and Borodovsky 1999) and ORF Finder (open ...
MicrobiologyOpen
Volume 2, Issue 4, pages 674–683, August 2013 DOI:10.1002/mbo3.104
Identification of a metagenomic gene cluster containing a new class A beta-lactamase and toxin-antitoxin systems
Vercammen et al.,
1Department of Bioengineering Sciences, Research group Microbiology and VIB Department of Structural Biology, Vrije Universiteit Brussel, Brussels, Belgium
2Ecologie des Systemes Aquatiques, Universite Libre de Bruxelles, Campus de la Plaine, Brussels, Belgium
3Genetique et Physiologie Bacterienne, Universite Libre de Bruxelles, IBMM-DBM, Gosselies, Belgium
... The sequences were assembled using CAP3 version 3 (available at Mobyle Pasteur:
http://mobyle.pasteur.fr/cgi-bin/portal.py#forms::cap3) and annotated by the free online program
Softberry (http://linux1.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup ...
Applied Microbiology and Biotechnology
July 2013 DOI:10.1007/s00253-013-5126-0
Molecular cloning and characterization of a novel acetylalginate esterase gene in alg operon from Sphingomonas sp. MJ-3
Yoo Jung Park, Yu Jeong Chu, Young Hee Shin, Eun Yeol Lee, Hee Sook Kim
1. Department of Food Science and Biotechnology, Kyungsung University, Busan, 608-736, Korea
2. College of Pharmacy, Kyungsung University, Busan, 608-736, Korea
3. Department of Chemical Engineering, Kyung Hee University, Gyeonggi-do, 446-701, Korea
... The PCR primers used for screening and sequencing are listed in Table 1. The positive fosmid
DNAs were sequenced, and then genes or operon were ana- lyzed by using fgenesb program
(http://linux1.softberry.com/ berry.phtml) and ORF finder (http://www.ncbi.nlm.nih.gov ...
Genome Announc.
May/June 2013 vol. 1 no. 3 e00235-13 doi: 10.1128/genomeA.00235-13
Complete Genome Sequence of Xanthomonas citri subsp. citri Strain Aw12879, a Restricted-Host-Range Citrus Canker-Causing Bacterium
Jalan et al.,
Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, Lake Alfred, Florida, USAa;
Waksman Genomics Core Facility, Rutgers University, Busch Campus, Piscataway, New Jersey, USAb;
... between the 454 scaffolds. PCR amplification and Sanger sequencing were used
to close the remaining gaps, and Softberry's FgenesB pipeline was used for finding
protein coding sequences (CDS). The predicted CDS were ...
Genome Announc.
May/June 2013 vol. 1 no. 3 e00356-13 DOI:10.1128/genomeA.00356-13
Draft Genome Sequence of Methylobacterium mesophilicum Strain SR1.6/6, Isolated from Citrus sinensis
Almeida et al.,
Instituto de Ciencias Biologicas, Universidade Federal do Para, Belem, Para, Brazila
Departamento de Microbiologia, Instituto de Ciencias Biomedicas, Universidade de Sao Paulo, Biomedicas II, Cidade Universitaria, Sao Paulo, Sao Paulo, Brazilb
... The functional annotation was performed using FgenesB (SoftBerry), RNAmmer (10),
tRNAscan-SE (11), Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html), and InterProScan
(12). In addition, manual annotation was also performed using Artemis software (13). ...
Genome Announc.
March/April 2013 vol. 1 no. 2 e00141-13 DOI:10.1128/genomeA.00141-13
Genome Sequence of Thalassolituus oleivorans MIL-1 (DSM 14913T)
Golyshin et al.,
School of Biological Sciences, Bangor University, Bangor, Gwynedd, United Kingdoma;
Max Planck Institute for Marine Microbiology, Bremen, Germanyb;
... The final assembly contains 12,110,290 short-insert library reads and provides 294?
coverage of the genome. The automated genome annotation was performed at Fidelity
Systems Ltd., using FgenesB 2.0 (SoftBerry, Inc., NY). ...
Archives of Virology
Volume 159, Issue 1 , pp 159-162 DOI:10.1007/s00705-013-1776-6
Complete genome sequence of marine bacterium Pseudoalteromonas phenolica bacteriophage TW1
Hakdong Shin, Ju-Hoon Lee, Chi Sang Ahn, Sangryeol Ryu, Byung Cheol Cho
1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, 151-921, Korea
3. Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Korea
... using a GS-FLX pyrosequencer at Macrogen, Seoul, South Korea, and the qualified sequence
reads were assembled using Newbler v2.3. The open reading frames (ORFs) in the genome
were predicted using GeneMarkS [ 2 ], Glimmer3 [ 5 ], and FgenesB (Softberry, Inc., Mount ...
Archives of Virology
Volume 158, Issue 10 , pp 2179-2183 DOI:10.1007/s00705-013-1700-0
Complete genome sequence analysis of bacterial-flagellum-targeting bacteriophage chi
Ju-Hoon Lee, Hakdong Shin, Younho Choi, Sangryeol Ryu
2. Department of Food Science and Biotechnology, Kyung Hee University, Yongin, 446-701, Korea
1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Food and Bioconvergence, Seoul National University, Seoul, 151-921, Korea
... Roche) at Macrogen, Inc. (Seoul, South Korea). Open reading frames (ORFs) were
predicted using gene prediction programs such as Glimmer3 [ 13 ], GeneMarkS [
3 ], and FgenesB (Softberry, Inc. Mount Kisco, NY, USA) and ...
Plant Science
Volume 211, October 2013, Pages 8–16 DOI:10.1016/j.plantsci.2013.06.008
Alterations in lignin content and phenylpropanoids pathway in date palm (Phoenix dactylifera L.) tissues affected by brittle leaf disease
Saidi et al.,
a Laboratoire des Biotechnologies Vegetales Appliquees a l’Amelioration des Cultures, Ecole Nationale d’Ingenieurs de Sfax, Route Soukra Km 4, B.P 1173, 3038 Sfax, Tunisia
b Centre de Recherches Phoenicicoles, 2260 Degache, Tunisia
.. and motif searches were performed on the protein sequences using Pfam (http://www.sanger.
ac.uk/software/pfam), protein which did not exhibit the appropriate protein motif were re-predicted
and manually corrected by using Fgenesh software (http://linux1.softberry.com/berry ...
Plasmid
Volume 70, Issue 2, September 2013, Pages 284–287 DOI:10.1016/j.plasmid.2013.06.001
pDB2011, a 7.6 kb multidrug resistance plasmid from Listeria innocua replicating in Gram-positive and Gram-negative hosts
David Bertsch, Janine Anderegg, Christophe Lacroix, Leo Meile, Marc J.A. Stevens
Laboratory of Food Biotechnology, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 7, 8092 Zurich, Switzerland
... Microsynth AG). Open reading frames (ORFs) were identified using the bacterial
operon and gene prediction tool FGENESB (www.softberry.com). Annotation was
done using BLAST (http://ncbi.nlm.nih.gov/blast/Blast.cgi). The ...
Appl. Environ. Microbiol.
March 2013 vol. 79 no. 5 1428-1435 DOI:10.1128/AEM.03291-12
Use of a Novel Escherichia coli-Leuconostoc Shuttle Vector for Metabolic Engineering of Leuconostoc citreum To Overproduce D-Lactate
Han Seung Chae a, Seung Hwan Lee b, Ju-Hoon Lee c, Si Jae Park d and Pyung Cheon Lee a
aDepartment of Molecular Science and Technology, Ajou University, Woncheon-dong, Yeongtong-gu, Suwon, South Korea
bChemical Biotechnology Research Center, Korea Research Institute of Chemical Technology (KRICT), Yuseong-gu, Daejeon, South Korea
... DNA and amino acid sequences were analyzed using the DNASTAR and Artemis12 software
(20) programs. Prediction of open reading frames (ORFs) was conducted using the GeneMark
(21) and FgenesB (Softberry, Mount Kisco, NY) programs. ...
J Gen Virol
November 2013 vol. 94 no. Pt 11 2569-2576 DOI:10.1099/vir.0.053991-0
Characterization and genomic analysis of two Staphylococcus aureus bacteriophages isolated from poultry/livestock farms
Hyunjin Yoon et al.,
1Department of Food Technology and Services, College of Health Industry, Eulji university, Seongnam 461-713, Korea
2Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, Seoul National University, Seoul 151-921, Korea
... ORFs were predicted with Glimmer 3 (Delcher et al., 2007), GeneMarkS (Besemer et al., 2001) and FgenesB (http://linux1.softberry.com/berry.phtml). RBS finder (Suzek et al., 2001), which facilitates determination of the start codon of each ORF, ...
Appl. Environ. Microbiol.
June 2013 vol. 79 no. 12 3829-3838 DOI:10.1128/AEM.00581-13
Functional Screening of a Metagenomic Library Reveals Operons Responsible for Enhanced Intestinal Colonization by Gut Commensal Microbes
Yoon et al.,
Department of Microbiology,a
Brain Korea 21 Project for Medical Sciences,b
Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine,c Seoul, Republic of Korea
... Clustering of genes into an operon was performed using FGENESB, a program for the prediction
of bacterial operons (SoftBerry, Mount Kisco, NY). The ORF map shown in Fig. 3A and B was
constructed using CloneMap (ver. 2.11) software (CGC Scientific, Inc., Ballwin, MO). ...
Extremophiles
Volume 17, Issue 5 , pp 809-819 DOI:10.1007/s00792-013-0562-4
Characterization of a cold-adapted and salt-tolerant esterase from a psychrotrophic bacterium Psychrobacter pacificensis
Guojie Wu, Gaobing Wu, Tao Zhan, Zongze Shao, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
2. College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were
analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml), amino acid alignments
by BLASTP (http://www.ncbi.nlm.nih.gov/), and Signal peptide by the SignaIP 4.0 ...
Journal of Molecular Catalysis B: Enzymatic
Volume 98, 30 December 2013, Pages 119–126 DOI:10.1016/j.molcatb.2013.10.012
A novel esterase from a psychrotrophic bacterium Psychrobacter celer 3Pb1 showed cold-adaptation and salt-tolerance
Guojie Wu a, Shuo Zhang a, Houjin Zhang b, Shanshan Zhang a, Ziduo Liu a,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China
b School of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430070, PR China
... of the esterase-encoding gene, est12, was carried out by Basic Local Alignment Search Tool
(BLAST) program on the NCBI online database (http://www.ncbi.nlm.nih.gov), and the promoter
region was analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml ...
PloS one
March 01, 2013DOI: 10.1371/journal.pone.0057634
A Serratia marcescens PigP Homolog Controls Prodigiosin Biosynthesis, Swarming Motility and Hemolysis and Is Regulated by cAMP-CRP and HexS
Shanks et al.,
Charles T. Campbell Laboratory of Ophthalmic Microbiology, Department of Ophthalmology, University of Pittsburgh Eye Center, Pittsburgh, Pennsylvania, United States of America
Department of Chemistry, University of Pittsburgh, Pittsburgh, Pennsylvania, United States of America
.. As noted above, the pigP gene is in a predicted operon with SMA3565-SMA3566 based on the
alignment and proximity of open reading frames and Softberry FGENESB operon prediction
software (http://linux1.softberry.com) (Figure 1B), however, this has not been previously ...
Archives of Virology
Volume 158, Issue 10 , pp 2101-2108 DOI:10.1007/s00705-013-1719-2
Characterization and complete genome sequence of a virulent bacteriophage B4 infecting food-borne pathogenic Bacillus cereus
Ju-Hoon Lee, Hakdong Shin, Bokyung Son, Sunggi Heu, Sangryeol Ryu
2. Department of Food Science and Biotechnology, Kyung Hee University, Yongin, 446-701, Korea
1. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Food and Bioconvergence, Seoul National University, Seoul, 151-921, Korea
... Prediction of open reading frames (ORFs) was carried out using GeneMarkS [ 4 ],
Glimmer v3.02 [ 11 ] and FgenesB software (Softberry, Inc. Mount Kisco, NY) and
confirmed using RBSfinder (J. Craig Venter Institue, Rockville, MD). ...
Physiological and Molecular Plant Pathology
Volume 84, October 2013, Pages 61–69 DOI:10.1016/j.pmpp.2013.07.003
Modulated expression of ion transporters may be responsible for manganese deficiency in brittle leaf disease affected date palm (Phoenix dactylifera L.) trees
Saidi et al.,
a Laboratoire des Biotechnologies Vegetales Appliquees a l'Amelioration des Cultures, Ecole Nationale d'Ingenieurs de Sfax, Route Soukra Km 4, B.P 1173, 3038 Sfax, Tunisia
b Centre de Recherches Phoenicoles, 2260 Degache, Tunisia
c Faculte des Sciences de Sfax, Route de Soukra Km 4, BP 1171, 3018 Sfax, Tunisia
... and motif searches were performed on the protein sequences using Pfam (http://www.sanger.
ac.uk/software/pfam), protein which did not present the appropriate protein motif was re-predicted
and manually corrected by using Fgenesh software (http://linux1.softberry.com/berry ...
American Journal of Molecular Biology
2013, 3, 115-130 DOI:10.4236/ajmb.2013.32016
Genome sequencing and next-generation sequence data analysis: A comprehensive compilation of bioinformatics tools and databases
Jose C. Jimenez-Lopez 1, Emma W. Gachomo 2,3, Sweta Sharma 2,3, Simeon O. Kotchoni 2,3
1Department of Biochemistry, Cell and Molecular Biology of Plants, Estacion Experimental del Zaidin, High Council for Scientific Research (CSIC), Granada, Spain
2Department of Biology, Rutgers University, Camden, USA
3Center for Computational and Integrative Biology (CCIB), Rutgers University, Camden, USA
Example of tools used for gene prediction are: 1) Glimmer, a system for finding genes in microbial DNA, especially the genomes of bacteria,
archaea, and viruses (http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi),
2) FgenesB, a package developed by Soft- berry Inc. for automatic annotation of bacterial genomes
(http://www.molquest.com/help/2.3/programs/FgenesB/about.html),
IJSEM
February 2013 vol. 63 no. Pt 2 526-532 DOI:10.1099/ijs.0.036947-0
Listeria fleischmannii sp. nov., isolated from cheese
Bertsch et al.,
1Laboratory of Food Biotechnology, Institute of Food, Nutrition and Health, ETH Zurich, 8092 Zurich, Switzerland
2Chemisches und Veterinaruntersuchungsamt Stuttgart (CVUAS), 70736 Fellbach, Germany
... The prediction tool FGENESB (Softberry) indicated the presence of eight open
reading frames between prs and ldh, all showing the highest similarity (>50 %) with
protein sequences from members of the genus Listeria (Fig. ...
Molecular & amp;Cellular Proteomics (mcp)
November 1, 2013 , 12, 3388-3397. DOI:10.1074/mcp.M112.027169
Proteogenomic Analysis of Bradyrhizobium japonicum USDA110 Using Genosuite, an Automated Multi-algorithmic Pipeline
Kumar et al.,
From the ‡G.N. Ramachandran Knowledge Center for Genome Informatics, CSIR-Institute of Genomics and Integrative Biology, South Campus, Sukhdev Vihar, Mathura Road, Delhi 110025, India;
§Queensland Centre for Medical Genomics, Institute for Molecular Bioscience, The University of Queensland, St Lucia, QLD, 4072, Australia
... FGENESB gene predictions were downloaded from (http://linux1.softberry.com/data/
annotation/bact/NC_004463.fna.ann.gz). ORF comparison across algorithms was
performed using in-house scripts. Protein Functional Annotation. ...
Appl. Environ. Microbiol.
July 2013 vol. 79 no. 13 3967-3973 DOI:10.1128/AEM.00867-13
Biofilm Formation by Psychrobacter arcticus and the Role of a Large Adhesin in Attachment to Surfaces
Shannon M. Hinsa-Leasur a, Cassandra Koid a, James M. Tiedj b and Janna N. Schultzhaus a
Biology Department, Grinnell College, Grinnell, Iowa, USAa
Center for Microbial Ecology, Michigan State University, East Lansing, Michigan, USAb
... with 64 bp separating the two genes. Based on results of the sequence analysis
programs FGENESB and BPROM (SoftBerry), the Psyc_1602-encoding gene and
cat1 reside in an operon. Located 379 bp downstream of cat1 ...
mcp
doi: 10.1074/mcp.M113.027318 mcp.M113.027318.
Analysis of the secretome and identification of novel constituents from culture filtrate of bacillus Calmette-Guerin using high-resolution mass spectrometry
Zheng et al.,
1 Chinese Academy of Medical Sciences & Peking Union Medical College;
2 Chinese Academy of Medical Sc, China
... Gene prediction programs for prokaryotes were FgeneSB (http://linux1.softberry.com/berry.
phtml?topic=fgenesb&group=programs&subgroup=gfindb) and GeneMark
(http://exon.biology.gatech.edu/~genmark/gmhmm2_prok.cgi). Functional ...
J. Am. Chem. Soc.,
2013, 135 (47), pp 17906–17912 DOI: 10.1021/ja408683p
Discovery and Synthetic Refactoring of Tryptophan Dimer Gene Clusters from the Environment
Chang et al.,
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, 1230 York Avenue, New York, New York 10065, United States
... using 454 pyrosequencing technology (Roche). Clone assemblies were annotated
using FGENESB (Softberry) or CloVR(15) for gene prediction and BLASTP (NCBI)
for protein homology relationsips. The gene clusters reported ...
The Journal of Steroid Biochemistry and Molecular Biology
Volume 138, November 2013, Pages 41–53 DOI:10.1016/j.jsbmb.2013.02.016
Comparative analysis of genes encoding key steroid core oxidation enzymes in fast-growing Mycobacterium spp. strains
Bragin et al.,
a Center of Innovations and Technologies “Biological Active Compounds and Their Applications”, Russian Academy of Sciences, Moscow 119991, Russian Federation
b G.K.Skryabin Institute of Biochemistry & Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, Moscow Region, Russian Federation
... weight matrices (PWM) were calculated from the known binding sites of transcription factors KstR
[21] and KstR2 [39] and used for a search of similar sites in sequence 500 bp length upstream
of operons found with the program FgenesB (http://linux1.softberry.com/berry.phtml ...
PNAS
February 12, 2013 vol. 110 no. 7 2478–2483, doi: 10.1073/pnas.1218073110
Discovery of indolotryptoline antiproliferative agents by homology-guided metagenomic screening
Fang-Yuan Chang and Sean F. Brady
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, New York, NY 10065
... AB1091 was then annotated using FGENESB (Softberry) for gene prediction and BLASTP
(National Center for Biotechnology Information) for protein homology searches (Fig. S9).
Retrofitting and Conjugation of bor Gene Cluster-Containing Clone into S. albus. ...
BMC genomics
(2013). 14(1), 917. DOI:doi:10.1186/1471-2164-14-917
Comparative analysis of genome sequences from four strains of the Buchnera aphidicola Mp endosymbiont of the green peach aphid, Myzus persicae
Jiang et al.,
1 Center for Computational Science, Miller School of Medicine, University of Miami, Coral Gables 33146, FL, USA
2 Department of Biology, University of Miami, Coral Gables 33146, FL, USA
... Genome annotation Gene models in the assembled genomes and plasmid scaffolds were
predicted with FgenesB (www.softberry.com, utilizing the annotated genome of Buchnera
aphidicola Bp (NC_004545) as a training set), GeneMark [62], and GLIMMER [63]. ...
Journal of Biomolecular Structure and Dynamics
(2013). 31(3), 342-350. DOI:
Improved annotation of a plant pathogen genome Xanthomonas oryzae pv. oryzae PXO99A
Lei, Y., Kang, S. K., Gao, J., Jia, X. S., & Chen, L. L.
a National Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Center for Bioinformatics, Huazhong Agricultural University , No. 1 Shizishan Street, Hongshan District, Wuhan , 430070 , P.R. China
b College of Science, Huazhong Agricultural University , No. 1 Shizishan Street, Hongshan District, Wuhan , 430070 , P.R. China
... BMC Bioinformatics, 11: 119 [PubMed] View all references) and FgenesB,
(http://linux1.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=
gfindb), respectively. Method for recognizing noncoding 'hypothetical ORFs'. ...
Frontiers in microbiology
(2013).4. DOI:10.3389/fmicb.2013.00340
Metatranscriptomic and functional metagenomic analysis of methylphosphonate utilization by marine bacteria
Martinez, A., Ventouras, L. A., Wilson, S. T., Karl, D. M., & DeLong, E. F.
1Division of Biological Engineering, Department of Civil and Environmental Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA
2Center for Microbial Oceanography: Research and Education (C-MORE), University of Hawaii, Honolulu, HI, USA
...The complete DNA sequence was assembled using Sequencher v. 4.10 (Gene Codes Corporation, Ann Arbor, MI)
and annotated with FGENESB (Softberry) and BlastP (NCBI)....
Applied Microbiology and Biotechnology
Volume 97, Issue 18 , pp 8173-8182 DOI:10.1007/s00253-013-4927-5
Discovery of (hemi-) cellulase genes in a metagenomic library from a biogas digester using 454 pyrosequencing
Yan et al.,
1. Key Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Fenglin Rd 300, Shanghai, 200032, China
2. Biofuels institute, School of the Environment, Jiangsu University, Zhenjiang, 212013, Jiangsu, China
... whose GH activity was lost. ORFs were predicted by FgenesB (Softberry, Goteborg,
Sweden), and a BLASTX search was performed against the NR database to access
annotation information. Translated pro- tein sequences ...
AEM
Published ahead of print 14 December 2012, doi: 10.1128/AEM.03291-12
Metabolic Engineering to Overproduce D-Lactate by Leuconostoc citreum using a Novel E. coli-Leuconostoc Shuttle Vector
Han Seung Chae 1, Seung Hwan Lee 2, Ju-Hoon Lee 3, Si Jae Park 2 and Pyung Cheon Lee 1
1 Department of Molecular Science and Technology, Ajou University, Woncheon-dong, Yeongtong-gu, Suwon 443-749, South Korea
2 Chemical Biotechnology Research Center, Korea Research Institute of Chemical Technology (KRICT), Yuseong-gu, Daejeon 305-600, South Korea
... 99 Prediction of open reading frames (ORFs) was conducted using GeneMark (5) and FgenesB
100 (Softberry, Mount Kisco, NY) programs. Gene annotation and similarity analysis were 101
performed using BLAST programs (2) from the National Center for Biotechnology 102 ...
FEMS Microbiology Letters
Volume 337, Issue 1, pages 1?9, December 2012 DOI: 10.1111/j.1574-6968.2012.02665.x
Novel traits of Trichoderma predicted through the analysis of its secretome
Irina S. Druzhinina 1,2,
Ekaterina Shelest 3,
Christian P. Kubicek 1,2,*
1 Research Division Biotechnology and Microbiology, Institute of Chemical Engineering, Vienna University of Technology, Vienna, Austria
2 Austrian Center of Industrial Biotechnology (ACIB), GmBH c/o Institute of Chemical Engineering, Vienna University of Technology, Vienna, Austria
... Therefore, we applied the TMHMM Server v2.0 (http://www.cbs.dtu.dk/services/TMHMM/) to predict
transmembrane helices in proteins, ProtComp, v8.0 (http://linux1.softberry.com/) and WolfPsort
(http://wolfpsort.org/) both designed to predict the subcellular localization for animal ...
Journal of Biotechnology
Available online 28 November 2012
Genome sequence of Corynebacterium pseudotuberculosis biovar equi strain 258 and prediction of antigenic targets to improve biotechnological vaccine production
Soares et al.,
a CLIB Graduate Cluster Industrial Biotechnology, Centrum f?r Biotechnologie, Universit?t Bielefeld, 33615 Bielefeld, Germany
b Institut f?r Genomforschung und Systembiologie, Centrum f?r Biotechnologie, Universit?t Bielefeld, 33615 Bielefeld, Germany
.. The complete genome sequence of C. pseudotuberculosis 258 was functionally annotated using
the following softwares: FgenesB (http://linux1.softberry.com/); RNAmmer (Lagesen et al., 2007);
tRNAscan-SE (Lowe and Eddy, 1997); InterproScan (Zdobnov and Apweiler, 2001 ...
Front Microbiol.
2012; 3: 185. DOI: 10.3389/fmicb.2012.00185
Complete Genome of Ignavibacterium album, a Metabolically Versatile, Flagellated, Facultative Anaerobe from the Phylum Chlorobi
Liu et al.,
1Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA, USA
2Section for Marine Biology, Department of Biology, University of Copenhagen, Helsingor, Denmark
... assembly. The genome was annotated using a pipeline based on FGENESB software
(Softberry, Inc., USA), Artemis (Sanger Institution, UK), and custom-made Perl scripts
(ActivePerl; ActiveState Inc., Vancouver, BC, USA). ...
PLoS ONE
7(9): e43176. doi:10.1371/journal.pone.0043176
Theoretical Prediction and Experimental Verification of Protein-Coding Genes in Plant Pathogen Genome Agrobacterium tumefaciens Strain C58
Qian Wang, Yang Lei, Xiwen Xu, Gejiao Wang, Ling-Ling Chen
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, People's Republic of China, Center for Bioinformatics, Huazhong Agricultural University, Wuhan, People's Republic of China
... Furthermore, potential new protein-coding genes that were not found in the RefSeq annotation
were predicted by two ab initio gene finding programs, ie, Prokaryotic dynamic programming
gene-finding algorithm (Prodigal) [21] and FgenesB (http://linux1.softberry.com/berry ...
Journal of Biomolecular Structure and Dynamics
2012 Aug 1. [Epub ahead of print] DOI: 10.1080/07391102.2012.698218
Improved annotation of a plant pathogen genome Xanthomonas oryzae pv. oryzae PXO99A.
Yang Lei a, Shou-Kai Kanga , Junxiang Gao b, Xi-Shuai Jia a & Ling-Ling Chen a
a National Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Center for Bioinformatics, Huazhong Agricultural University, No. 1 Shizishan Street, Hongshan District, Wuhan, 430070, P.R. China
b College of Science, Huazhong Agricultural University, No. 1 Shizishan Street, Hongshan District, Wuhan, 430070, P.R. China
... BMC Bioinformatics , 11: 119 View all references) and FgenesB, (http://linux1.softberry.
com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb), respectively.
Method for recognizing noncoding 'hypothetical ORFs'. ...
PLoS Negl Trop Dis.
2012 January; 6(1): e1471. doi: 10.1371/journal.pntd.0001471
Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence
Cejkova et al.,
1Department of Biology, Faculty of Medicine, Masaryk University, Brno, Czech Republic
2Human Genome Sequencing Center, Baylor College of Medicine, Houston, Texas, United States of America
... bp. Gene identification and annotation. FgenesB (Softberry Inc., New York, USA),
GeneMark [34] and Glimmer [35] were used independently for prediction of open reading
frames (ORFs) in the Samoa D genome sequence. Visualization ...
PLoS One;
2011 May Journal Volume: 5; Journal Issue: 1;
Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community
Reddy et al.,
... the BLAST scores. After manual frameshift correction, genes were called using fgenesb
(http:// www.softberry.com). For phylogenetic ... to Iodobacteriophage. Genes were
predicted using fgenesV (www. softberry.com). Found at: doi ...
Food Microbiology
Volume 33, Issue 1, February 2013, Pages 124–130 DOI: 10.1016/j.fm.2012.09.008
Macedovicin, the second food-grade lantibiotic produced by Streptococcus macedonicus ACA-DC 198
Georgalaki et al.,
a Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece
b Institut Pasteur de Lille, Center for Infection and Immunity of Lille (CIIL), F-59019 Lille, France
... CAP3 (Huang and Madan, 1999). The region was annotated using heuristic GeneMark
TM (Besemer and Borodovsky, 1999), FgenesB (http://www.softberry.com) and
MetaGene annotator (Noguchi et al., 2006). At the same time ...
IJSEM
April 2012 DOI: 10.1099/ijs.0.036947-0
Listeria fleischmannii sp. nov., isolated from cheese
Bertsch et al.,
1 ETH Zurich;
2 CVUAS;
... JN118555). The 157 prediction tool FGENESB (Softberry, Inc.) indicated the presence
of eight ORFs between prs and ldh, all 158 showing the highest homology (>50%)
to protein sequences from Listeria species (Fig. 2). ORFB 159 ...
Journal of Molecular Evolution
Volume 74, Issue 3-4 , pp 187-205 DOI:10.1007/s00239-012-9498-z
Phylogenetic Classification of Diverse LysR-Type Transcriptional Regulators of a Model Prokaryote Geobacter sulfurreducens
Julia Krushkal, Yanhua Qu, Derek R. Lovley, Ronald M. Adkins
1. Department of Preventive Medicine, The University of Tennessee Health Science Center, 66 N. Pauline Blvd. Ste. 633, Memphis, TN, 38163, USA
2. Department of Microbiology, The University of Massachusetts, Amherst, MA, 01003, USA
... J Mol Evol 123 Page 5. predicted earlier and described previously (Krushkal et al. 2007;
Mahadevan et al. 2008; Tran et al. 2008) using the commercial version of the FGENESB software
(V. Solovyev and A. Salamov, unpublished; Softberry, Inc.; 2003–2009). ...
BMC Genomics
2012, 13:625 doi:10.1186/1471-2164-13-625
The large universal Pantoea plasmid LPP-1 plays a major role in biological and ecological diversification
Maayer et al.,
1 Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria, South Africa
2 Center for Microbial Ecology and Genomics, Department of Genetics, University of Pretoria, Pretoria, South Africa
... The CDS for complete LPP-1 sequences were downloaded from the National Center for Biotechnology
Information (NCBI) database [63] and those encoded on the draft plasmids were predicted using FgenesB [64]....
Journal of Proteomics
Volume 77, 21 December 2012, Pages 357–371 DOI: 10.1016/j.jprot.2012.09.010
A comprehensive proteomic analysis of Mycobacterium bovis bacillus Calmette–Guerin using high resolution Fourier transform mass spectrometry
Zheng et al.,
MOH Key Laboratory of Systems Biology of Pathogens, Institute of Pathogen Biology, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, PR China
... Two different gene prediction programs for prokaryotes, FgeneSB (http://linux1.softberry.com/
berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb) and GeneMark
(http://exon.biology.gatech.edu/~genmark/gmhmm2_prok.cgi), supported the presence of this ...
MPMI
July 2012, Volume 25, Number 7
Pages 954-963 DOI: 10.1094/MPMI-11-11-0304
Nonlegume Parasponia andersonii Deploys a Broad Rhizobium Host Range Strategy Resulting in Largely Variable Symbiotic Effectiveness
Rik H. M. Op den Camp et al.,
1Department of Plant Sciences, Laboratory of Molecular Biology, Wageningen University, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands; 2Department of Agricultural Biotechnologies, Universita di Padova, Viale dell'Universita 16, 35020 Legnaro (Padova), Italy;
... Genes were predicted using FGENESB (Softberry, Mount Kisco, NY, USA), BASys (Van Domselaar
et al. 2005), and manual annotation. Estimated full-length 16S rDNA and genes encoding proteins
involved in Nod-factor biosynthesis were identified by BLAST searches. ...
J. Bacteriol. April
2012 vol. 194 no. 8 2041-2049 DOI doi: 10.1128/?JB.06637-11
Novel, Highly Specific N-Demethylases Enable Bacteria To Live on Caffeine and Related Purine Alkaloids
Ryan M. Summers et al.,
aDepartment of Chemical and Biochemical Engineering, University of Iowa, Iowa City, Iowa, USA
bThe Center for Biocatalysis and Bioprocessing, University of Iowa, Coralville, Iowa, USA
... the supplemental material. Analyses of open reading frames (ORFs) were performed
manually with the help of GeneMark.hmm for prokaryotes (23), FGENESB (Softberry,
Inc., Mount Kisco, NY), and GLIMMER (9). Cloning and ...
J. Virol.
doi: 10.1128/?JVI.01987-12 October 2012 vol. 86 no. 20 11410-11411
Complete Genome Sequence of Pectobacterium carotovorum subsp. carotovorum Bacteriophage My1
Dong Hwan Lee et al.,
aDivision of Microbial Safety, National Academy of Agricultural Science, Rural Development Administration, Suwon, Republic of Korea
bDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, Republic of Korea
... Quality filtered reads were assembled using a 454 Newbler 2.3 assembler. The open reading
frames (ORFs) were predicted using the Glimmer v3.02 (3), GeneMarkS (2), and FgenesB
(Softberry, Inc., Mount Kisco, NY) and then confirmed by the RBSfinder (17). ...
J. Bacteriol.
doi: 10.1128/?JB.01373-12 October 2012 vol. 194 no. 20 5718-5719
Whole-Genome Sequence of Corynebacterium pseudotuberculosis Strain Cp162, Isolated from Camel
Syed Shah Hassan et al.,
aInstituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil
bInstituto de Ciencias Biologicas, Universidade Federal do Para, Belem, PA, Brazil
... short reads (3) and manual curation. The functional annotation of the genome for
open reading frame (ORF) prediction was performed using the software program
FgenesB (Softberry). The software program RNAmmer (6) was ...
Appl Environ Microbiol.
August 2012, doi: 10.1128/?AEM.02120-12
Genomic and transcriptomic studies of an RDX-degrading actinobacterium
Hao-Ping Chen et al.,
1Department of Microbiology & Immunology, Life Sciences Institute, University of British Columbia, Vancouver, British Columbia, Canada
3U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi
... 46 Biolabs). 47 Page 3. 3 Open reading frames (ORFs) were identified using the
FGENESB software (Softberry Inc., 48 Mount Kisco, NY) and the RAST server
(http://rast.nmpdr.org) (3). The genes that were 49 identified were ...
J. Virol.
doi: 10.1128/?JVI.01042-12 July 2012 vol. 86 no. 14 7713-7714
Complete Genome Sequence of Cronobacter sakazakii Temperate Bacteriophage phiES15
Ju-Hoon Lee b,
Younho Choi a,
Hakdong Shin a,
Junghyun Lee a and
Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
bDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, South Korea
... The predictions of open reading frames (ORFs) were conducted using three major gene prediction
programs, GeneMarkS (2), Glimmer3 (5), and FgenesB (Softberry, Inc., Mount Kisco, NY) and
confirmed by ribosomal binding site analyses performed using RBS finder (J. Craig ...
J. Virol.
doi: 10.1128/?JVI.01283-12 August 2012 vol. 86 no. 16 8899-8900
Complete Genome Sequence of Phytopathogenic Pectobacterium carotovorum subsp. carotovorum Bacteriophage PP1
Ju-Hoon Lee et al.,
aDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, South Korea
bDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
... Korea). The open reading frames (ORFs) were bioinformatically predicted using
Glimmer3 (4), GeneMarkS (2), and FgenesB (Softberry, Inc., Mount Kisco, NY) and
confirmed by RBS finder (J. Craig Venter Institute, Rockville, MD). ...
J. Virol.
doi: 10.1128/?JVI.00706-12 June 2012 vol. 86 no. 11 6379-6380
Complete Genome Sequence of Bacillus cereus Bacteriophage PBC1
Minsuk Kong,
Minsik Kim and
Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
... The assembly of quality filtered reads was performed using GS De Novo Assembler (v. 2.6),
and the open reading frames (ORFs) were predicted using the Glimmer 3.02 (4),
GeneMark.hmm (3), and FgenesB (Softberry, Inc., Mount Kisco, NY) software. ...
J. Bacteriol.
doi: 10.1128/?JB.00824-12 August 2012 vol. 194 no. 16 4434-4435
Complete Genome Sequence of the Hyperthermophilic Archaeon Pyrococcus sp. Strain ST04, Isolated from a Deep-Sea Hydrothermal Sulfide Chimney on the Juan de Fuca Ridge
Jong-Hyun Jung et al.,
aDepartment of Food Science and Biotechnology, Institute of Life Sciences and Resources, Kyung Hee University, Yongin, South Korea
bDepartment of Microbiology, University of Massachusetts, Amherst, Massachusetts, USA
... The open reading frames (ORFs) were predicted using GeneMarkS (2), Glimmer 3.02
(3), and FgenesB (Softberry, Inc., Mount Kisco, NY), and functional analyses of the predicted
ORFs were conducted using BLASTP (1) and InterProScan (12). ...
J. Bacteriol.
doi: 10.1128/?JB.00461-12 July 2012 vol. 194 no. 13 3567-3568
Complete Genome Sequence of Corynebacterium pseudotuberculosis Strain Cp267, Isolated from a Llama
Thiago Lopes et al.,
aInstituto de Ciencias Biologicas, Universidade Federal do Para, Belem, Para, Brazil
bInstituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil
... The following software programs were used in the automatic functional annotation of the genome:
FgenesB (gene prediction; http://linux1.softberry.com/), RNAmmer (rRNA prediction) (3),
tRNAscan-SE (tRNA prediction) (4), and Tandem Repeat Finder (repetitive DNA prediction ...
J. Bacteriol.
doi: 10.1128/?JB.01016-12 September 2012 vol. 194 no. 17 4769-4770
Complete Genome Sequence of the Hyperthermophilic Archaeon Thermococcus sp. Strain CL1, Isolated from a Paralvinella sp. Polychaete Worm Collected from a Hydrothermal Vent
Jong-Hyun Jung et al.,
aDepartment of Food Science and Biotechnology, Institute of Life Sciences and Resources, Kyung Hee University, Yongin, Republic of Korea
bDepartment of Microbiology, University of Massachusetts, Amherst, Massachusetts, USA
... Korea). GeneMarkS (2), Glimmer 3.02 (3), and FgenesB (Softberry, Inc., Mount Kisco,
NY) were used to predict the open reading frames (ORFs) present. Their functions
were verified using BLASTP (1) and InterProScan (15). ...
J. Bacteriol.
doi: 10.1128/?JB.00572-12 July 2012 vol. 194 no. 13 3561-3562
Genome Sequence of Bacillus licheniformis WX-02
Wuming Yangtse et al.,
State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan, People's Republic of China
... Open reading frames were identified using Fgenesb (http://linux1.softberry.com/berry.phtml?topic=
fgenesb&group=programs&subgroup=gfindb), Prodigal (http://compbio.ornl.gov/prodigal/), and
Glimmer (http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi) and ...
The ISME Journal
6, 1916-1925 (October 2012) | doi:10.1038/ismej.2012.38
Functional metagenomics reveals novel salt tolerance loci from the human gut microbiome
Eamonn P Culligan, Roy D Sleator, Julian R Marchesi and Colin Hill
... FLX (Roche Applied Science) platform. Putative open reading frames were predicted
using Softberry FGENESB bacterial operon and gene prediction software (Mavromatis
et al., 2007). Retrieved nucleotide and translated amino ...
Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002
IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes
Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany
2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile
... to GenBank sequences. Additional searches for genes, operons, promoters, and
terminators were done using FGENESB, BPROM, and FindTerm at www.softberry.
com (Softberry, Mount Kisco, NY, USA). The sequence data ...
Extremophiles
September 2012, Volume 16, Issue 5, pp 715-726 DOI
10.1007/s00792-012-0467-7
Genome sequence of temperate bacteriophage Psymv2 from Antarctic Dry Valley soil isolate Psychrobacter sp. MV2
Tracy L. Meiring (1)
I. Marla Tuffin (1)
Craig Cary (2)
Don A. Cowan (1)
1. Institute for Microbial Biotechnology and Metagenomics, University of the Western Cape, Office 2117, Level 2 Life Sciences Building, Modderdam Rd, Bellville, 7535, South Africa
2. Department of Biological Sciences, University of Waikato, Hamilton, New Zealand
... Ab initio gene predictions were performed using GeneMark.hmm 2.0 (http://www.exon.biology.
gatech.edu/heuristic_hmm2.cgi) (Besemer and Borodovsky 1999), fgenesv and fgenesb
(http://www.linux1.softberry.com/berry.phtml) (Softberry, Mount Kisco, NY, USA) using the ...
AQUATIC MICROBIAL ECOLOGY
AQUATIC MICROBIAL ECOLOGY
Virus genes in Arctic marine bacteria identified by
metagenomic analysis
Matthew T. Cottrell, David L. Kirchman
Matthew T. Cottrell, David L. Kirchman
... genomes EU795107, EU795222 to EU795255 and EU795278. Open reading frames
were identified using the FGENESB (Softberry) web site (www.softberry.com) and
then annotated using AutoFACT software (Koski et al. 2005 ...
Open Access Bioinformatics
2012:4 1–13 http://dx.doi.org/10.2147/OAB.S25500
reannotation of the Corynebacterium diphtheriae
ncTc13129 genome as a new approach
to studying gene targets connected to virulence
and pathogenicity in diphtheria
Vivian D’Afonseca et al.,
1Federal University of Minas gerais, Belo horizonte,
Minas gerais, Brazil; 2Federal University of Pelotas,
Pelotas, rio grande do sul, Brazil;
... Methods genome reannotation The reannotation procedures involved the use of several
algorithms, in a multi-step process. Structural annotation was performed using the following
software: FGENESB: bacterial operon and gene predictor (http://www.softberry. ...
World Journal of Microbiology and Biotechnology
August 2012
DOI
10.1007/s11274-012-1145-8
Cloning and biochemical characterization of a glucosidase from a marine bacterium Aeromonas sp. HC11e-3
Xiaoluo Huang et al.,
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
2. Key Laboratory of Marine Biogenetic Resources, Third Institute of Oceanography, State of Oceanic Administration, Xiamen, 361005, People’s Republic of China
... 1964). Sequence analysis Nucleotide sequencing was accomplished by the Gene- script
Company (Nanjing, China) and the open reading frame (ORF) in the obtained DNA fragments
was predicted by FGENESB in softberry database (http://linux1.soft berry.com/berry.phtml). ...
Virus Research
Volume 155, Issue 2, February 2011, Pages 433–439 DOI: 10.1016/j.virusres.2010.11.012
The genome sequence and proteome of bacteriophage ?CPV1 virulent for Clostridium perfringens
Volozhantsev et al.,
a State Research Center for Applied Microbiology & Biotechnology, Obolensk, Moscow Region, Russian Federation
b Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA DOI:605, USA
... Protein-encoding genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version
2.4 (http://opal.biology.gatech.edu/GeneMark; Lukashin and Borodovsky, 1998) and SoftBerry
FGENESB (http://linux1.softberry.com/berry.phtml; Mount Kisco, NY, USA) programs. ...
J. Bacteriol.
June 2011 vol. 193 no. 12 3158-3159 DOI: 10.1128/JB.00310-11
Genome Sequence of Rhizobium etli CNPAF512, a Nitrogen-Fixing Symbiont Isolated from Bean Root Nodules in Brazil
Maarten Fauvart †, Aminael Sanchez-Rodriguez †, Serge Beullens, Kathleen Marchal and Jan Michiels *
Centre of Microbial and Plant Genetics, Katholieke Universiteit Leuven, BE-3001 Heverlee, Belgium
... average length). Protein-coding genes were predicted using the Softberry FgenesB
algorithm (http://linux1.softberry.com/all.htm). Functional annotation was performed
by BLAST searches against the GenBank database. The ...
Appl. Environ. Microbiol
September 2011 vol. 77 no. 17 6189-6198 DOI: 10.1128/AEM.00377-11
Genetic and Biochemical Map for the Biosynthesis of Occidiofungin, an Antifungal Produced by Burkholderia contaminans Strain MS14
Ganyu Gu 1, Leif Smith 2,*, Aixin Liu 1,3 and Shi-En Lu 1,*
1Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, 32 Creelman St., Mississippi State, Mississippi 39762
2Department of Biological Sciences, Texas A&M University, College Station, Texas 77843
... Open reading frames (ORFs) and genes were subsequently predicted by the Softberry
FGENESB program (Softberry, Inc., Mount Kisco, NY), and the identified ORFs and
genes were analyzed using Blastx in the NCBI database. ...
FEMS Microbiology Letters
Volume 318, Issue 1, pages 18–26, May 2011 DOI: 10.1111/j.1574-6968.2011.02232.x
Comparative and evolutionary analysis of plasmid pREN isolated from Lactobacillus rennini, a novel member of the theta-replicating pUCL287 family
Asteri, I.-A., Papadimitriou, K., Boutou, E., Pot, B., Vorgias, C. E. and Tsakalidou, E.
1 Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Athens, Greece
2 Department of Biochemistry and Molecular Biology, Faculty of Biology, National and Kapodistrian University of Athens, Athens, Greece
... In order to identify potential protein encoding segments, three open reading frames (orfs)
prediction programs were used: heuristic genemark™ (Besemer & Borodovsky, 1999), fgenesb
(http:www.softberry.com) and metageneannotator (Noguchi et al., 2006). ...
J. Bacteriol.
October 2011 vol. 193 no. 20 5707-5715 DOI: 10.1128/JB.05426-11
Long-Chain N-Acyl Amino Acid Synthases Are Linked to the Putative PEP-CTERM/Exosortase Protein-Sorting System in Gram-Negative Bacteria
Jeffrey W. Craig, Marisa A. Cherry and Sean F. Brady
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, 1230 York Avenue, New York, New York 10065
... GS FLX Titanium XLR70; Roche Diagnostics Corp.) and standard Sanger-type sequencing (Table
1). Sequences from each respective eDNA insert were analyzed for putative open reading frames
(ORFs) using GLIMMER, version 3.02 (14), and SoftBerry FGENESB (bacterial ...
FEMS Microbiology Letters
317: 83–92. doi: 10.1111/j.1574-6968.2011.02218.x
Characterization of a functional toxin–antitoxin module in the genome of the fish pathogen Piscirickettsia salmonis.
Gomez, F. A., Cardenas, C., Henriquez, V. and Marshall, S. H.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile
2 Nucleo Biotecnologia Curauma (NBC), PUCV, Curauma, Valparaiso, Chile
... Sequence analysis. The DNA sequenced data were analysed with the softberry server software
(http://linux1.softberry.com/berry.phtml) using the algorithms, FgenesB (to find possible ORFs in
the sequences), and Bprom (to search for putative bacterial promoters). ...
Antonie van Leeuwenhoek
Volume 99, Issue 2 , pp 409-416 DOI: 10.1007/s10482-010-9476-7
Characterization of transcription within sdr region of Staphylococcus aureus
Izabela Sitkiewicz, Ireneusz Babiak, Waleria Hryniewicz
1. Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland
2. Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland
... The presence of putative promoters and transcrip- tional organization of the sdr region was
detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region
611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...
FEMS Microbiology Letters
314: 18–24. doi: 10.1111/j.1574-6968.2010.02132.x
ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis.
Marshall, S. H., Henriquez, V., Gomez, F. A. and Cardenas, C.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Facultad de Ciencias, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile
2 NBC, Nucleo de Biotecnologia Curauma, Curauma, Valparaiso, Chile
... sequencing by Macrogen Inc. (Korea). Sequence analysis. The DNA sequence data
were analyzed with softberry server software (http://linux1.softberry.com/berry.phtml)
using the FgenesB and Bprom algorithms. FgenesB is a suite ...
J. Bacteriol.
January 2011 vol. 193 no. 1 323-324 DOI: 10.1128/JB.01211-10
Complete Genome Sequence of Corynebacterium pseudotuberculosis I19, a Strain Isolated from a Cow in Israel with Bovine Mastitis
Silva et al.,
1Instituto de Ciencias Biologicas, Universidade Federal do Para, Belem, PA, Brazil
2Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil
... For structural annotation, the following software programs were employed: FgenesB, a gene
predictor (http://www.softberry.com); RNAmmer, an rRNA predictor (4); tRNAscan-SE, a tRNA
predictor (5); and Tandem Repeats Finder, a repetitive-DNA predictor (http://tandem.bu.edu ...
Microbiology
March 2011 vol. 157 no. 3 636-647 DOI: 10.1099/mic.0.046045-0
cAMP receptor protein (CRP) positively regulates the yihU–yshA operon in Salmonella enterica serovar Typhi
Villarreal et al.,
1Laboratorio de Microbiologia Molecular, Departamento de Ciencias Biologicas, Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, Chile
2Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Mexico
... In silico analyses to evaluate the transcriptional organization of the yihU–yshA cluster were
performed using the fgenesb program (http://www.softberry.com), the ORF program
(http://bioinformatics.biol.rug.nl/), and the EcoCyc (Keseler et al., 2009) and Prodoric databases ...
J. Bacteriol.
December 2011 vol. 193 no. 24 7025-7026 doi: 10.1128/JB.06293-11
Complete Genome Sequence of Corynebacterium pseudotuberculosis Strain CIP 52.97, Isolated from a Horse in Kenya
Cerdeira et al.,
1Instituto de Ciencias Biologicas, Universidade Federal do Para, Belem, Brazil
2Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil
... The structural annotation was done automatically by a multipronged approach using the following
programs: for gene prediction, FgenesB (http: //www.softberry.com); for rRNA prediction, RNAmmer
(5); for tRNA prediction, tRNA-scan-SE (6); and for repetitive DNA prediction ...
J. Bacteriol.
doi: 10.1128/JB.05854-11 October 2011 vol. 193 no. 20 5871-5872
Complete Genome Sequence of Type Strain Campylobacter fetus subsp. venerealis NCTC 10354T
Stynen et al.,
1Laboratorio de Bacteriologia Aplicada, Departamento de Medicina Veterinaria Preventiva, Escola de Veterinaria, Universidade Federal de Minas Gerais, Belo Horizonte, MG, Brazil
2CSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, VIC, Australia
... fetus 82-40 (NC_008599) as the scaffold. Structural annotation was performed by the following
predictors: for genes, FgenesB (SoftBerry); for rRNA, RNAmmer (10); for tRNA, tRNAscan-SE
(12); and for repetitive DNA, Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html). ...
International Journal of Food Microbiology
Volume 144, Issue 3, 5 January 2011, Pages 400–405 DOI: 10.1016/j.ijfoodmicro.2010.10.026
Genome analysis of Lactobacillus fermentum temperate bacteriophage ÔPYB5
Xiuhong Zhang a, b, Shaohua Wang a, Tingting Guo a, Jian Kong a
a State Key Laboratory of Microbial Technology, Shandong University, Jinan, China 250100
b College of Life Science, Shanxi Normal University, Linfen, China 041000
... Sequence analysis was performed using BlastX, BlastN, BlastP and FastA programs. Putative
ORFs were also identified using GenMark (http://opal.biology.gatech.edu/GeneMark/
gmhmm2_prok.cgi) and fgenesb software (http://www.softberry.com/). ...
Journal of Genetics and Genomics
Volume 38, Issue 6, 20 June 2011, Pages 243–252 DOI: 10.1016/j.jgg.2011.04.006
Genome
Xiao-Yan You et al.,
a State Key Laboratory of Microbial Resource, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
b Shanghai MOST Key Laboratory of Health and Disease Genomics, Chinese National Human Genome Center, Shanghai 201203, China
... http://www.phrap.org). 2.4. Sequence analysis. The Glimmer 3.02 (Delcher et al.,
2007) and FgeneSB programs (http://www.softberry.com/) were used to predict the
positions of open reading frames (ORFs). Protein function was ...
Environmental Microbiology Reports
3: 203–210. doi: 10.1111/j.1758-2229.2010.00209.x
Pseudomonas fluorescens BBc6R8 type III secretion mutants no longer promote ectomycorrhizal symbiosis.
Cusano et al.,
1 INRA, UMR1136 INRA-Nancy Universite, «Interactions Arbres/Micro-organismes», Centre de Nancy, IFR110, 54280 Champenoux, France.
2 Department of Plant Sciences, University of Oxford, Oxford OX1 3RB, UK.
... partially conserved. Figure 2. Alignment by tblastx of the P. fluorescens BBc6R8
and SBW25 T3SSs, generated using WebACT (Carver et al., 2005). BBc6R8 genes
were predicted using FgenesB (Softberry). Regions of high ...
Appl. Environ. Microbiol.
July 2011 vol. 77 no. 13 4293-4302 doi: 10.1128/AEM.00195-11
Regulation of the Edwardsiella ictaluri Type III Secretion System by pH and Phosphate Concentration through EsrA, EsrB, and EsrC
Matthew L. Rogge 1 and Ronald L. Thune 1,2
1Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, Louisiana 70803
2Department of Veterinary Science, Louisiana State University Agricultural Center, Louisiana State University, Baton Rouge, Louisiana 70803
... Target amplicons, their operons, and their gene-specific primers are listed in Table 2. Putative
operons were identified by using FGENESB (SoftBerry, Inc., Mount Kisco, NY), and transcriptional
linkages were subsequently confirmed by reverse transcription-PCR (RT-PCR) using ...
The ISME Journal
(2012) 6, 146–157; doi:10.1038/ismej.2011.88; published online 21 July 2011
Genome-scale analysis of anaerobic benzoate and phenol metabolism in the hyperthermophilic archaeon Ferroglobus placidus
Dawn E Holmes 1,2,3, Carla Risso 1,3, Jessica A Smith 1 and Derek R Lovley 1
1Department of Microbiology, University of Massachusetts Amherst, Amherst, MA, USA
2Department of Physical and Biological Sciences, Western New England College, Springfield, MA, USA
... Operon organization of the F. placidus genome was predicted using the commercial version of
the FGENESB software (V Solovyev and A Salamov, unpublished data; Softberry Inc., Mount
Kisco, NY, USA; 2003–2009), as previously described for the genomes of various ...
J. Bacteriol.
November 2011 vol. 193 no. 22 6342-6357 doi: 10.1128/JB.05777-11
Comparative Genomic Analysis of Xanthomonas axonopodis pv. citrumelo F1, Which Causes Citrus Bacterial Spot Disease, and Related Strains Provides Insights into Virulence and Host Specificity
Jalan et al.,
1Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, 700 Experiment Station Road, Lake Alfred, Florida 33850
2Interdisciplinary Center for Biotechnology Research, 2033 Mowry Road, University of Florida, Gainesville, Florida 32611
... validation. Annotation and curation.Coding genes were identified using Softberry's
FgenesB suite of bacterial operon- and gene-finding programs, based on the Markov
chain model prediction algorithm at ICBR, UF (108). Predicted ...
Molecular Microbiology
(2011), 80: 951–965. doi: 10.1111/j.1365-2958.2011.07622.x
Anti-activator QslA defines the quorum sensing threshold and response in Pseudomonas aeruginosa.
Seet, Q. and Zhang, L.-H.
Institute of Molecular and Cell Biology, 61 Biopolis Drive, Proteos, Singapore 138673.
... aa in the Pseudomonas Genome Database (http://www.pseudomonas.com), but our in silico
analysis predicted a translational start site at 27 bp downstream of the original annotated start
site and the open reading frame would generate a 104 aa protein (FGENESB, Softberry). ...
PLoS ONE
(2011) 6(2): e16626. doi:10.1371/journal.pone.0016626
Genome of a Low-Salinity Ammonia-Oxidizing Archaeon Determined by Single-Cell and Metagenomic Analysis.
Blainey PC, Mosier AC, Potanina A, Francis CA, Quake SR
Howard Hughes Medical Institute, Department of Bioengineering, Stanford University, Stanford, California, United States of America
Department of Environmental Earth System Science, Stanford University, Stanford, California, United States of America
... Gene prediction was carried out on the N. limnia assembly using the FgenesB platform (Softberry,
Inc.), which called 2171 genes, including 2047 protein-coding ORFs, 74 pseudogenes, and 50
RNA genes [Table 2]. In total, 83.4% of the assembled bases were predicted to ...
Appl. Environ. Microbiol.
September 2011 vol. 77 no. 18 6663-6673 doi: 10.1128/AEM.05111-11
Diversity and Plasticity of the Intracellular Plant Pathogen and Insect Symbiont "Candidatus Liberibacter asiaticus" as Revealed by Hypervariable Prophage Genes with Intragenic Tandem Repeats
Zhou et al.,
1University of Florida, IFAS-IRREC, Ft. Pierce, Florida 34945
2USDA-ARS-USHRL, Ft. Pierce, Florida 34945
... Bioinformatics and phylogenetic analysis.Tandem repeats finder version 4.04 (4) was
used to find repeats in hyv I and hyv II sequences. Bacterial gene predictions were carried
out using FGENESB software (SoftBerry Inc., Mount Kisco, NY). ...
The ISME Journal
(2011) 5, 1253–1261; doi:10.1038/ismej.2011.15; published online 3 March 2011
Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment
Gaze et al.,
1School of Life Sciences, University of Warwick, Coventry, Warwickshire, UK
2University of Birmingham, School of Immunity and Infection, Edgebaston, Birmingham, UK
... first nucleotide BLAST (basic local alignment search tool; National Center for Biotechnology
Information (NCBI)) was used to check for homology with previously reported attC regions, then
the NCBI ORF finder (open reading frame finder) and FGENESB (Softberry, Mount Kisco ...
Microbiology
April 2011 vol. 157 no. 4 1229-1239 DOI: 10.1099/mic.0.044669-0
Sulfur globule oxidation in green sulfur bacteria is dependent on the dissimilatory sulfite reductase system
Carina Holkenbrink, Santiago Ocon Barbas, Anders Mellerup, Hiroyo Otaki† and Niels-Ulrik Frigaard
Department of Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen N, Denmark
... Black arrows indicate binding of primers for PCR and sequencing. Prediction of
promoters and terminators was done using fgenesb software (http://linux1.softberry.
com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...
OMICS: A Journal of Integrative Biology.
July/August 2011, 15(7-8): 495-506. doi:10.1089/omi.2010.0117.
Genome Diversity of the TetR Family of Transcriptional Regulators in a Metal-Reducing Bacterial Family Geobacteraceae and Other Microbial Species
Krushkal et al.,
1Department of Preventive Medicine, the University of Tennessee Health Science Center, Memphis, Tennessee.
2Bioinformatics Program, the University of Memphis, Memphis, Tennessee.
... Operon organization of the Geobacteraceae genomes was predicted using the commercial version
of the FGENESB software (V. Solovyev and A. Salamov, unpublished; Softberry, Inc., 2003–2009),
as described earlier (Krushkal et al., 2007; Mahadevan et al., 2008; Tran et al ...
Front Microbiol.
2011; 2: 116. DOI: 10.3389/fmicb.2011.00116
Mechanisms and Evolution of Oxidative Sulfur Metabolism in Green Sulfur Bacteria
Lea H. Gregersen, 1,† Donald A. Bryant, 2 and Niels-Ulrik Frigaard 1,*
1Department of Biology, University of Copenhagen, Helsingor, Denmark
2Department of Biochemistry and Molecular Biology, The Pennsylvania State University, University Park, PA, USA
... the following software: MEGA 4 (sequence alignment and phylogenetics 6 ; Tamura et al., 2007),
Artemis 12.0 (sequence viewing and manipulation; Wellcome Trust Sanger Institute, Hinxton,
UK 7 ; Carver et al., 2008), FGENESB (sequence annotation; Softberry, Mount Kisco ...
PLoS ONE 6
2011, (5): e20095. doi:10.1371/journal.pone.0020095
Phage Encoded H-NS: A Potential Achilles Heel in the Bacterial Defence System.
Skennerton et al.,
Advanced Water Management Centre, The University of Queensland, St. Lucia, Queensland, Australia, Australian Centre for Ecogenomics, School of Chemistry and Molecular Biosciences and Institute for Molecular Bioscience, The University of Queensland, St. Lucia, Queensland, Australia
... Annotation of phage contigs. Open Reading Frames (ORFs) were predicted using FGENESB
(www.softberry.com) to call the position of the ORFs. Each ORF was extracted and compared
against the NCBI non-redundant protein database (nr) using BLASTp. ...
BMC Genomics
2011, 12:576 doi:10.1186/1471-2164-12-576
Comparative genomics of the type VI secretion systems of Pantoea and Erwinia species reveals the presence of putative effector islands that may be translocated by the VgrG and Hcp proteins
Maayer et al.,
1 Forestry and Agricultural Biotechnology Institute, University of Pretoria, South Africa
2 Agroscope Changins-Wadenswil ACW, Division of Plant Protection, Wadenswil, Switzerland
...Proteins encoded in the vgrG and hcp islands were identified using the FgenesB [56] and Orf finder...
International Journal of Food Microbiology
Volume 146, Issue 1, 15 March 2011, Pages 23–30 DOI: 10.1016/j.ijfoodmicro.2011.01.033,
cspB encodes a major cold shock protein in Clostridium botulinum ATCC 3502
Soderholm et al.,
a Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland
b Centre for Biomolecular Sciences, School of Molecular Medical Sciences, University of Nottingham, Nottingham, UK
... 2007). Based on the prediction made with FGENESB bacterial operon and gene
prediction tool (http://www.softberry.com), none of the genes is located in an operon.
The genes next to the three csp genes are presented in Fig. 3. ...
BMC Microbiology
2011, 11:25 doi:10.1186/1471-2180-11-25
Complete genome sequence of a serotype 11A, ST62 Streptococcus pneumoniae invasive isolate
Camilli et al.,
1 Department of Infectious, Parasitic and Immune-mediated Diseases, Istituto Superiore di Sanita, Rome, Italy
2 Italian National Research Council, Institute for Biomedical Technologies, Milan, Italy
...The generated sequences were annotated identifying coding genes by cross prediction from the
FGENESB package http://www.softberry.com/ webcite, th...
Molecular & Cellular Proteomics
December 1, 2011 , 10, M111.011627. doi: 10.1074/mcp.M111.011627
Proteogenomic Analysis of Mycobacterium tuberculosis By High Resolution Mass Spectrometry
Kelkar et al.,
From the ‡Institute of Bioinformatics, International Technology Park, Bangalore, 560 066, India,
§Amrita School of Biotechnology, Amrita University, Kollam 690 525, India
...Two gene prediction programs, FgeneSB and GeneMark as well as the Orfind tool from NCBI were used to find ORFs in the region to which these GSSPs were mapped (18, 19)....
PLoS ONE
2011, 6(4): e18551. doi:10.1371/journal.pone.0018551
Evidence for Reductive Genome Evolution and Lateral Acquisition of Virulence Functions in Two Corynebacterium pseudotuberculosis Strains
Ruiz et al.,
1Research Center Rene? Rachou, Oswaldo Cruz Foundation, Belo Horizonte, Minas Gerais, Brazil, 2Department of General Biology, Federal University of Minas Gerais, Belo
Horizonte, Minas Gerais, Brazil
...Structural annotation was performed using the following software: FgenesB: gene predictor (www.softberry.com); R...
PNAS
September 28, 2010 vol. 107 no. 39 16828-16833 doi: 10.1073/pnas.1011557107
Identification of the biosynthetic gene cluster for the pacidamycin group of peptidyl nucleoside antibiotics
Wenjun Zhang a,b, Bohdan Ostash c,d, and Christopher T. Walsh a,1
a Department of Biological Chemistry and Molecular Pharmacology and
c Department of Microbiology and Moledular Genetics, Harvard Medical School, Boston, MA 02115;
b Department of Chemical and Biomolecular Engineering, University of California, Berkeley, CA 94720
... 2.2.18) downloaded from the National Center for Biotechnology Information Web site. ORFs were
detected and analyzed using online program FGENESB (Softberry), and the putative roles of
the proteins were assigned using protein–protein BLAST and Pfam analysis. ...
The ISME Journal
8 July 2010, doi:10.1038/ismej.2010.94
Ecogenomics and genome landscapes of marine Pseudoalteromonas phage H105/1
Melissa Beth Duhaime, Antje Wichels, Jost Waldmann, Hanno Teeling and Frank Oliver Glockner
... hmm (prokaryotic version using bacterial or archaeal genetic code, precomputed
Pseudoalteromonas haloplanktis chromosome 1 model and default settings) (Besemer et al.,
2001) and (ii) FGENESB (generic bacterial model, default settings; Softberry, Mount Kisco, NY, ...
Appl. Environ. Microbiol.
doi:10.1128/AEM.00928-10
Functionality of sortase A in Lactococcus lactis
Dieye et al.,
INRA, UMR1319 Micalis, Batiment 222, Domaine de Vilvert, F-78352 Jouy-en-Josas, France; Department of Molecular Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Kerklaan 30, 9751 NN Haren, The Netherlands
... SrtA is annotated 59 as a putative 287 amino acid protein. 60 In silico analysis of the srtA locus
using the gene prediction server FGENESB (Softberry) 61 (http://linux1.softberry.com/berry.phtml?
topic=fgenesb&group=programs&subgroup=gfindb) indicated a 62 ...
Applied and Environmental Microbiology
March 2010, p. 1633-1641, Vol. 76, No. 5, doi:10.1128/AEM.02169-09
Expanding Small-Molecule Functional Metagenomics through Parallel Screening of Broad-Host-Range Cosmid Environmental DNA Libraries in Diverse Proteobacteria
Jeffrey W. Craig, Fang-Yuan Chang, Jeffrey H. Kim, Steven C. Obiajulu, and Sean F. Brady
Howard Hughes Medical Institute, Laboratory of Genetically Encoded Small Molecules, The Rockefeller University, 1230 York Avenue, New York, New York 10065
... Each cosmid was sequenced by 454 pyrosequencing, and the sequences were analyzed for
putative open reading frames (ORFs) using GLIMMER3.02 (12) and SoftBerry FGENESB: Bacterial
Operon and Gene Prediction Program (http://linux1.softberry.com/berry.phtml?topic ...
Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10
doi:10.1128/JB.01526-09
The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry
Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany
... Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators
were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK
(21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...
Journal of Microbiology
doi:10.1007/s10482-010-9476-7
Characterization of transcription within sdr region of Staphylococcus aureus
Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)
Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland
(2)
Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland
... The presence of putative promoters and transcrip- tional organization of the sdr region was
detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region
611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...
International Journal of Food Microbiology
Volume 141, Issue 3, 15 July 2010, Pages 222-228
Characterization of pLAC1, a cryptic plasmid isolated from Lactobacillus acidipiscis and comparative analysis with its related plasmids
Asteri et al.,
a Laboratory of Dairy Research, Department of Food Science and Technology, Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece
b Department of Biochemistry and Molecular Biology, Faculty of Biology, National and Kapodistrian University of Athens, Panepistimioupolis-Zographou, 157 84 Athens, Greece
... 1999). Ab initio orf finding was performed using several bioinformatics tools, including
heuristic GeneMark (Besemer & Borodovsky, 1999),
FGENESB (www.softberry.com)
and MetaGeneAnnotator (Noguchi et al., 2006). Only ...
Journal of Bacteriology
July 2010, p. 3337-3344, Vol. 192, No. 13 doi:10.1128/JB.00274-10
Treponema denticola PrcB Is Required for Expression and Activity of the PrcA-PrtP (Dentilisin) Complex{triangledown}
Godovikova et al.,
Department of Biologic and Materials Sciences, School of Dentistry, University of Michigan, Ann Arbor, Michigan
... Annotation of the prcB open reading frame was done using the FGENESB algorithm trained to
the T. denticola genome sequence (Softberry, Inc., Mt. Kisco, NY). A predicted 70 class promoter
upstream of prcB was identified using BPROM software (Softberry, Inc., Mt. ...
Applied and Environmental Microbiology
October 2010, p. 6769-6777, Vol. 76, No. 20 doi:10.1128/AEM.00343-10
Comparative Analysis of Acidobacterial Genomic Fragments from Terrestrial and Aquatic Metagenomic Libraries, with Emphasis on Acidobacteria Subdivision 6
Anna M. Kielak, 1 Johannes A. van Veen, 1,2 and George A. Kowalchuk 1,3*
Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), P.O. Box 40, 6666 ZG Heteren, Netherlands,1 Institute of Biology Leiden University, P.O. Box 9516, 2300 RA Leiden, Netherland,2
...Annotation and sequence properties. Open reading frames (ORFs) were assigned using the
GLIMMER (12) and FGENESB (http://linux1.softberry.com) software tools. ... Searches for GC
islands were performed using CpGFinder (http://linux1.softberry.com). ... .
J Microbiol.
2010 Jun;48(3):318-24. Epub 2010 Jun 23.
Cel8H, a novel endoglucanase from the halophilic bacterium Halomonas sp. S66-4: molecular cloning, heterogonous expression, and biochemical characterization
Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, PR China.
... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were
predicted using FGENSB and BPROM (http://linux1.softberry.com/berry.phtml). ... Genes in the 3.3
kb DNA fragment were predicted using FGENSB in the softberry website. ...
PLoS ONE
2010, 5(9): e13092. doi:10.1371/journal.pone.0013092
Functional Metagenomics: A High Throughput Screening Method to Decipher Microbiota-Driven NF-?B Modulation in the Human Gut
Lakhdari et al.,
INRA, UMR 1319 Micalis, Jouy-en-Josas, France, 2 LibraGen S.A., Toulouse, France
... Evry, France). The sequence is available on GenBank (accession number HQ231916).
Potential transcription units were detected using SoftBerry's software FGENESB
(http://linux1.softberry.com/berry.phtml). Potential ORFs ...
Microbiology
2010, DOI 10.1099/mic.0.046045-0
The cAMP-Receptor Protein (CRP) positively regulates the yihU-yshA operon in Salmonella enterica serovar Typhi
Villarreal et al.,
1 Universidad Andres Bello;
2 Universidad Nacional Autonoma de Mexico
... In silico analyses, to evaluate the transcriptional organization of the yihU-yshA cluster, were
performed using the FGENESB program (http://www.softberry.com), the ... (http://www.softberry.
com), programs which recognize and identify DNA patterns to ...
Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10
Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9
Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2
... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc.,
234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator
236 sequences using BPROM and FindTerm programs (Softberry Inc.). ...
Microbiology
2010, DOI 10.1099/mic.0.041491-0
ccrABEnt serine recombinase genes are widely distributed in the Enterococcus faecium and Enterococcus casseliflavus species-groups and expressed in E. faecium
Bjorkeng et al.,
1 University of Tromso;
2 University Hospital of North-Norway;
3 CODA-CERVA-VAR;
4 UMCU
... 2010.02.08), Gene Mark (v2.4) (Besemer & Borodovsky, 1999), FGENESB 113 (www.softberry.
com 2010.02.08), and ARTEMIS (Wellcome Trust Genome Campus, 114 Hinxton, Cambridge,
UK). Pairwise comparison and multiple sequence alignments were 115 ...
International Journal of Food Microbiology
Volume 144, Issue 3, 5 January 2011, Pages 400-405 doi:10.1016/j.ijfoodmicro.2010.10.026
Genome analysis of Lactobacillus fermentum temperate bacteriophage FPYB5
Xiuhong Zhang a, b, Shaohua Wang a, Tingting Guo a and Jian Kong a
a State Key Laboratory of Microbial Technology, Shandong University, Jinan, China 250100
b College of Life Science, Shanxi Normal University, Linfen, China 041000
... Sequence analysis was performed using BlastX, BlastN, BlastP and FastA programs. Putative
ORFs were also identified using GenMark (http://opal.biology.gatech.edu/GeneMark/
gmhmm2_prok.cgi) and fgenesb software (http://www.softberry.com/). ...
PLoS ONE
5(1): e8812. doi:10.1371/journal.pone.0008812
Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community
Allgaier et al.,
1 Deconstruction Division, Joint BioEnergy Institute, Emeryville, California, United States of America, 2 Department of Biological and Agricultural Engineering, University of California Davis, Davis, California, United States of America
.. scores. After manual frameshift correction, genes were called using fgenesb
(http://www.softberry.com). For ... Iodobacteriophage. Genes were predicted using fgenesV
(www.softberry.com). (1.12 MB EPS). Figure S2. Correspondence ...
Applied and Environmental Microbiology
June 2010, p. 3715-3722, Vol. 76, No. 11, doi:10.1128/AEM.02753-09
Characterization of Genes Responsible for the CO-Linked Hydrogen Production Pathway in Rubrivivax gelatinosus
Vanzin et al.,
National Renewable Energy Laboratory, 1617 Cole Blvd., Golden, Colorado 80401
... as noted above. Sequence analysis. Open reading frames (ORFs) were predicted
with FGENESB (Softberry, Inc.) and SYCO (synonymous codon usage Gribskov
statistic plot) trained on the Rx. gelatinosus codon usage table ...
BMC Genomics
2010, 11:350doi:10.1186/1471-2164-11-350
Identification of novel non-coding small RNAs from Streptococcus pneumoniae TIGR4 using high-resolution genome tiling arrays
Kumar et al.,
1 Department of Basic sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State, MS 39762, USA
2 Institute for Digital Biology, Mississippi State University, Mississippi State, MS 39762, USA
... potential to code smaller proteins. Further analysis of the DNA sequence in these regions using
FGENESB gene prediction tool (www.softberry.com) identified the presence of smaller ORF
(open reading frame). We did not find any predicted promoter sequences in the ...
Journal of Proteomics
Volume 73, Issue 5, 10 March 2010, Pages 917-931 doi:10.1016/j.jprot.2009.12.005
Proteome of Gluconacetobacter diazotrophicus co-cultivated with sugarcane plantlets
dos Santos MF, Muniz de Padua VL, de Matos Nogueira E, Hemerly AS, Domont GB.
a Federal University of Parana, Campus Palotina, Brazil
b Federal University of Rio de Janeiro, Laboratory of Protein Chemistry/Rio de Janeiro Proteomics Network, Department of Biochemistry, Institute of Chemistry/Brazil
... To understand the biological roles of identified proteins, the web version of FGENESB Suite of
Bacterial Operon and Gene Finding Programs (http://www.softberry.com/) was used for the analysis
of the genetic organization around the ORFs of the differentially expressed proteins ...
BMC Genomics.
2010 Sep 8;11:489.
Markedly different genome arrangements between serotype a strains and serotypes b or c strains of Aggregatibacter actinomycetemcomitans
Kittichotirat W, Bumgarner R, Chen C.
Division of Periodontology, Diagnostic Sciences and Dental Hygiene, Herman Ostrow School of Dentistry of the University of Southern California, Los Angeles, CA, USA.
... fragments. Similar results were obtained using FGENESB (http://linux1.softberry.com/berry.
phtml?topic=fgenesb&group=programs&subgroup= gfindb) (data not shown). Features
of genome rearrangement breakpoints. Genome rearrangements ...
PLoS Pathog
2010 6(4): e1000845. doi:10.1371/journal.ppat.1000845
A Genomic Survey of Positive Selection in Burkholderia pseudomallei Provides Insights into the Evolution of Accidental Virulence
Nandi et al.,
1 Genome Institute of Singapore, Singapore, Republic of Singapore, 2 Defense Medical and Environmental Research Institute, DSO National Laboratories, Singapore, Republic of Singapore
... Procedures) Act 1986. Genome Annotations and Comparative Analysis. Bp genes
were predicted using FGENESB [http://linux1.softberry.com/berry.phtml??topic=
fgenesb&group=help&subgroup=gfindb (Softberry)]. tRNA genes ...
Gene.
2010 Dec 1;469(1-2):31-44. Epub 2010 Aug 12
Genome-wide survey for PilR recognition sites of the metal-reducing prokaryote Geobacter sulfurreducens
Krushkal et al.,
Department of Preventive Medicine, University of Tennessee Health Science Center, Memphis, TN 38163, USA
... Operon prediction The operon organization of the G. sulfurreducens genome (GenBank accession:
AE017180) was predicted using the commercial version of the FGENESB software (V. Solovyev
and A. Salamov, unpublished; Softberry, Inc; 2003-2008), as described earlier ...
Methods Mol Biol.
2010, Volume 666, Part 2, 197-218, DOI: 10.1007/978-1-60761-820-1_14
Oral bacterial genome sequencing using the high-throughput Roche Genome Sequencer FLX System
Nicholas C.K. Heng and Jo-Ann L. Stanton
Faculty of Dentistry, Sir John Walsh Research Institute, University of Otago, Dunedin, New Zealand.
... 14.1). 2. Gene prediction can be performed using Web-based tools such as
GeneMark.hmm (12) and FGENESB (http:// linux1.softberry.com/berry.phtml?topic=
fgenesb&group= programs&subgroup=gfindb) (see Note 27). Another ...
Appl. Environ. Microbiol.
doi:10.1128/AEM.00473-09 2009
Comparative metagenomic analysis of a microbial community from 4000 m at Station ALOHA in the North Pacific Subtropical Gyre
Konstantinos T. Konstantinidis, Jennifer Braff, David M. Karl, and Edward F. DeLong
10 FGENESB pipeline for automatic annotation of bacterial genomes from Softberry 11
(http://www.softberry.com/berry.phtml), using the following parameters and cutoffs: general 12 ...
Plasmid
Volume 61, Issue 1, January 2009, Pages 52-64
Bioinformatic and partial functional analysis of pEspA and pEspB, two plasmids from Exiguobacterium arabatum sp. nov. RFL1109
Jakubauskas et al.,
aInstitute of Biotechnology, Graiciuno g. 8, Vilnius LT-02241, Lithuania
bDepartment of Plant Physiology and Microbiology, Faculty of Natural Sciencies, Vilnius University, Ciurlionio g. 21/27, Vilnius LT-03101, Lithuania
... Additionally, the FgenesB program at SoftBerry (http://www.softberry.com) was employed
for gene prediction using bacterial generic model. The predicted ORFs and the putative
intergenic sequences were further examined by visual inspection. ...
Journal of Bacteriology
January 2009, p. 210-219, Vol. 191, No. 1
Interaction between Bacteriophage DMS3 and Host CRISPR Region Inhibits Group Behaviors of Pseudomonas aeruginosa
Zegans et al.,
Department of Microbiology and Immunology, Rm. 505 Vail Building, Dartmouth Medical School, Hanover, New Hampshire 03755,1 Department of Surgery, Dartmouth-Hitchcock Medical Center, Lebanon, New Hampshire 03756
... Transcriptional units were predicted with the help of FGENESB (SoftBerry, Mt. Kisco, NY) set to
the generic bacterial genome setting and utilizing default settings. ... Kisco, NY; http://www.softberry.
com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Microbiology
155 (2009), 95-105; DOI 10.1099/mic.0.021873-0
Involvement of the oscA gene in the sulphur starvation response and in Cr(VI) resistance in Pseudomonas corrugata 28
Carlo Viti, Francesca Decorosi, Annalisa Mini, Enrico Tatti and Luciana Giovannetti
Dipartimento di Biotecnologie Agrarie, Sez. Microbiologia, Universita` degli Studi di Firenze, Piazzale delle Cascine 24, 50144 Firenze, Italy
... nlm.nih.gov). Identification of operons was performed using the FGENESB
pattern/Markov chain-based prediction program from Softberry (http://softberry.com/
berry.phtml). RNA extraction and cDNA synthesis. For RNA extraction ...
Journal of Bacteriology
March 2009, p. 1910-1923, Vol. 191, No. 6
Regulation of Cyclic Lipopeptide Biosynthesis in Pseudomonas fluorescens by the ClpP Protease
I. de Bruijn and J. M. Raaijmakers
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands
... clpP was identified by sequencing the regions flanking the transposon insertions as described
by De Sousa et al. (17). The flanking regions of clpP were sequenced by primer walking, and
open reading frames (ORFs) were identified with the Softberry FGENESB program. ...
Applied and Environmental Microbiology
August 2009, p. 5345-5355, Vol. 75, No. 16
Comparative Metagenomic Analysis of a Microbial Community Residing at a Depth of 4,000 Meters at Station ALOHA in the North Pacific Subtropical Gyre
Konstantinos T. Konstantinidis,1, Jennifer Braff,1 David M. Karl,2 and Edward F. DeLong 1
Department of Civil and Environmental Engineering and Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts,1 University of Hawaii, Honolulu, Hawaii2
... Fosmid and untrimmed WGS sequences were annotated with the FGENESB pipeline for automatic
annotation of bacterial genomes from Softberry, using the following parameters and cutoffs:
general parameter file; open reading frame size, 90 nucleotide bases; expectation e ...
Appl Environ Microbiol.
2009 Jul;75(13):4599-615. Epub 2009 May 8.
Community genomic and proteomic analyses of chemoautotrophic iron-oxidizing "Leptospirillum rubarum" (Group II) and "Leptospirillum ferrodiazotrophum" (Group III) bacteria in acid mine drainage biofilms
Goltsman et al.,
University of California-Berkeley, 94720, USA.
... The numerous small contigs were manually curated into 10 scaffolds. Annotation.
Gene predictions for Leptospirillum groups II and III were made using a combination
of FgenesB (Softberry, Inc.), CRITICA (11), and Glimmer (21). ...
OMICS.
2009 Oct;13(5):439-49.
GSEL version 2, an online genome-wide query system of operon organization and regulatory sequence elements of Geobacter sulfurreducens
Qu Y et al.,
Department of Preventive Medicine, The University of Tennessee Health Science Center, Memphis, Tennessee 38163, USA
... Operon organization of the G. sulfur- reducens genome was predicted using a commercial version
of the FGENESB software (V. Solovyev and A. Salamov, Soft- berry, Inc, 2003-2008) (Tyson et
al., 2004), as described earlier (Krushkal et al., 2007; Mahadevan et al., 2008; Yan ...
BMC Genomics.
2009 Aug 24;10:395.
A draft genome sequence and functional screen reveals the repertoire of type III secreted proteins of Pseudomonas syringae pathovar tabaci 11528
Studholme et al.,
The Sainsbury Laboratory, Norwich, UK
... pseudomonads Using the FgenesB annotation pipeline (http://www.softberry.com), we
identified 6,057 potential Page 7. ... We used Softberry's FgenesB pipeline (http://www.
softberry.com) to predict genes encoding rRNAs, tDNAs and proteins. ...
Veterinary Microbiology
Volume 136, Issues 3-4, 12 May 2009, Pages 326-334
Characterisation of an extracellular vibriolysin of the fish pathogen Moritella viscosa
Bjornsdottir et al.,
aInstitute for Experimental Pathology, University of Iceland, Keldur, Vesturlandsvegi, 112 Reykjavik, Iceland
bMatis-Prokaria, Gylfaflot 5, 112 Reykjavik, Iceland
... The NCBI Basic Local Alignment Search Tool (BLAST) was used for comparing protein
sequences and CD search for detecting conserved domains. Putative open reading frames
(ORF) were identified by the SoftBerry FGENESB program. ...
Nucleic Acids Research
doi:10.1093/nar/gkp327
Orphelia: predicting genes in metagenomic sequencing reads
Katharina J. Hoff 1,*, Thomas Lingner 1,2, Peter Meinicke 1 and Maike Tech 1
1Abteilung Bioinformatik, Institut fur Mikrobiologie und Genetik, Georg-August-Universitat Gottingen, Goldschmidtstr. 1, 37077 Gottingen, Germany and 2Center for Genomic Regulation, Comparative Bioinformatics Research Group, Biomedical Research Park, c/Dr. Aiguader 88, 08003 Barcelona, Spain
... Negro (12). Each sample was Sanger sequenced and contains 13 000 reads. The
original gene annotation of those reads was created with the commercial program
FGENESB (http://www.softberry.com). Note that FGENESB ...
PLoS Genet.
2009 March; 5(3): e1000439.
A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element
Rachel A. F. Wozniak 1,2,3 and Matthew K. Waldor 1,2,3*
1Channing Laboratory, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, United States of America
2Howard Hughes Medical Institute, Chevy Chase, Maryland, United States of America
... 5? RACE experiments to identify the +1 nucleotide of the mosA transcript (Figure 5B) suggested
that the true mosA transcript begins upstream from the original annotation (Figure 5). Promoter
and ORF predictions (BProm, FGENESB; http://linux1.softberry.com/berry.phtml) for ...
BMC Microbiology
2009, 9:262 doi:10.1186/1471-2180-9-262
Molecular and biochemical characterization of urease and survival
of Yersinia enterocolitica biovar 1A in acidic pH in vitro
Neeru Bhagat and Jugsharan S Virdi
Address: Microbial Pathogenicity Laboratory, Department of Microbiology, University of Delhi South Campus, Benito Juarez Road, New Delhi -
110 021, India
... The open reading frames (ORFs) in the compiled ure gene
cluster were identified using GeneMark [26], Gene-
Mark.hmm [27], FGENESB [28] and the NCBI ORF finder
[29] programs... 28. FGENESB
[http://www.softberry.com/berry.phtml] ...
BMC Genomics
2009, 10:3doi:10.1186/1471-2164-10-3
Genome sequence analysis of Helicobacter pylori strains associated with gastric ulceration and gastric cancer
McClain et al.,
1 Department of Medicine, Vanderbilt University School of Medicine, Nashville, TN 37232-2605, USA
2 Department of Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232-2605, USA
... ORFs in the genomes of H. pylori strains 98-10 and B128 were predicted by FGENESB http:/ /
www.softberry.com/ berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb
webcite[56], an algorithm based on Markov chain models of coding regions and translation and ...
J. Bacteriol.
2008, doi:10.1128/JB.01558-08
Regulation of cyclic lipopeptide biosynthesis in Pseudomonas fluorescens by the ClpP protease
I. de Bruijn and J. M. Raaijmakers
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands
... 13 open reading frames (ORFs) were identified with the Softberry FGENESB
program 14 (http://www.softberry.com/berry.phtml). The ...
Microbiology
154 (2008), 2589-2599; DOI 10.1099/mic.0.2008/017244-0
Highly conserved genes in Geobacter species with expression patterns indicative of acetate limitation
Carla Risso, Barbara A. Methe, Hila Elifantz, Dawn E. Holmes and Derek R. Lovley
Department of Microbiology, 203N Morrill Science Center IVN, University of Massachusetts Amherst, Amherst, MA 01003, USA
J. Craig Venter Institute, 9712 Medical Center Drive, Rockville, MD 20850, USA
... Operons, promoters and terminators were predicted using the commercial version of
the FGENES-B software package (Softberry Inc.) as previously described (Yan ...
FEMS Microbiology Ecology
2008, Volume 66 Issue 1, Pages 45 - 62
Comparative genomics of the pIPO2/pSB102 family of environmental
plasmids: sequence, evolution, and ecology of pTer331 isolated from Collimonas fungivorans Ter331
Mela et al.
Centre for Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands
... The complete nucleotide sequence of pTer331 (40 457 bp) was searched for ORFs using
FGENESB (http://www.softberry.com) and by the automated genome ...
Applied and Environmental Microbiology,
December 2008, p. 7152-7162, Vol. 74, No. 23
Proteome-Based Comparative Analyses of Growth Stages Reveal New Cell Cycle-Dependent Functions in the Predatory Bacterium Bdellovibrio bacteriovorus
Mally Dori-Bachash, Bareket Dassa, Shmuel Pietrokovski, and Edouard Jurkevitch
Department of Plant Pathology and Microbiology, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew University of Jerusalem, Rehovot 76100, Israel,1 Department of Molecular Genetics, Weizmann Institute of Science, Rehovot 76100, Israel
... Operons were predicted with the Softberry fgenesb program using the B. bacteriovorus
100 T genome sequence (http://www.softberry.com/berry.phtml?topic ...
PNAS
November 11, 2008 vol. 105 no. 45 17516-17521
Metagenome analysis of an extreme microbial symbiosis reveals eurythermal adaptation and metabolic flexibility
Grzymski et al.
aDivision of Earth and Ecosystem Sciences, Desert Research Institute, 2215 Raggio Parkway, Reno, NV 89512;
bCollege of Marine and Earth Studies, University of Delaware, Lewes, DE 19958;
... We integrated several annotation tools, including BLAST (46), FgenesB (Softberry)
for gene calling and COG assignment, PRIAM (47), and a custom Pfam database ...
Microbiology and Molecular Biology Reviews,
December 2008, p. 557-578, Vol. 72, No. 4
A Bioinformatician's Guide to Metagenomics
Victor Kunin, Alex Copeland, Alla Lapidus, Konstantinos Mavromatis, and Philip Hugenholtz
Microbial Ecology Program,1 Quality Assurance Department,2 Microbial Genomics Department,3 Genome Biology Program, DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, California4
.. of the same or related organisms, can enhance the quality of the predicted genes
for some of those programs (eg, fgenesB [http://www.softberry.com]), while ...
Biochem. J.
(2008) Immediate Publication, doi:10.1042/BJ20081488
Characterization of the phenylurea hydrolases A and B:
founding members of a novel amidohydrolase subgroup
Khurana et al.
Division of Entomology, CSIRO, Canberra, ACT 2601, Australia.
... Genomic and phylogenetic analysis. FGENESB (http://www.softberry.com) was used to
detect open reading frames (ORFs), which were then manually confirmed. ...
J Bacteriol.
2008 May;190(9):3362-73. Epub 2008 Feb 29.
The sim operon facilitates the transport and metabolism of sucrose isomers in Lactobacillus casei ATCC 334
Thompson J, Jakubovics N, Abraham B, Hess S, Pikis A.
Microbial Biochemistry and Genetics Unit, NIDCR, National Institutes of Health, Bldg. 30, Rm. 325, Convent Dr. MSC-4350, Bethesda, MD 20892, USA
... The structure of operons was predicted by automated genome annotation using
the fgenesB module of the MolQuest software (Softberry Inc.). ...
BMC Genomics
2008, 9:471 doi:10.1186/1471-2164-9-471
Comparative genomics of Geobacter chemotaxis genes reveals
diverse signaling function
Hoa T Tran, Julia Krushka, Frances M Antommattei, Derek R Lovley and
Robert M Weis
1Department of Chemistry, University of Massachusetts, Amherst, MA 01003, USA, 2Department of Preventive Medicine, University of
Tennessee Health Science Center, Memphis, TN 38163, USA, 3Sharon Woods Technical Center, Procter and Gamble, Cincinnati, OH 45040, USA
and 4Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA
... The organization of che gene operons in the Geobacter sp.
was predicted with FGENESB (Softberry Inc., http://
www.softberry.com). FGENESB identifies protein-coding
genes with Markov chain models of coding regions and
translation start and termination sites, and annotates
them with information from public databases. The
sequence parameters (coding content, oligonucleotide
composition, and gene length distribution) were estimated
in FGENESB for each genome separately through
an iterative procedure with the minimum ORF length set
to 100 nt. ...
Expert Opinion on Drug Discovery
August 2008, Vol. 3, No. 8, Pages 903-929
(doi:10.1517/17460441.3.8.903)
Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery
Nishikant V Wase & Phillip C Wright
The University of Sheffield, Biological and Environmental Systems Group, Department of Chemical and Process Engineering, Mappin St., Sheffield, S1 3JD, UK +44 0 114 2227577; +44 0 114 2227501
... This can be done through software packages such as GLIMMER [61] and GENEMARK [62],
and a list of software packages found on Softberry [63], including fgenesB ...
Journal of Microbiological Methods
Volume 75, Issue 3, December 2008, Pages 515-522
A procedure for the metagenomics exploration of disease-suppressive soils
J.D. van Elsas, A.J. Speksnijder and L.S. van Overbeek
aDepartment of Microbial Ecology, Centre for Ecological and Evolutionary Studies University of Groningen, Kerklaan 30, 9750AA Haren, The Netherlands
bGGD Amsterdam, Nieuwe Amstergracht 100, 1018WT Amsterdam, The Netherlands
cPlant Research International BV, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands
... Sequence assemblies were screened with the FgenesB programme (Softberry Inc.) and
the PKS-NRPS search tool (http://www.nii.res.in/nrps-pks.html). ...
Trends in Genetics
Volume 24, Issue 3, March 2008, Pages 142-149
Bioinformatics challenges of new sequencing technology
Mihai Pop and Steven L. Salzberg
Center for Bioinformatics and Computational Biology, University of Maryland, MD 20742, USA
.. They compared fgenesb (www.softberry.com) with a pipeline combining CRITICA [43]
and Glimmer [44], using three datasets of varied complexity constructed by ..
Foodborne Pathogens and Disease.
August 1, 2008, 5(4): 387-398. doi:10.1089/fpd.2008.0113.
Genomic Evidence for Interspecies Acquisition of Chromosomal DNA from Campylobacter jejuni by Campylobacter coli Strains of a Turkey-Associated Clonal Group (Cluster II)
Kamfai Chan, Driss Elhanafi, Sophia KathariouBowler et al.
Department of Food Science, North Carolina State University, Raleigh, North Carolina.
... Assembled DNA sequences were submitted to the web-based FgenesB program (Softberry
Inc., http:==www.softberry.com) to identify open reading frames (ORFs). ...
Applied and Environmental Microbiology
July 2008, p. 4149-4163, Vol. 74, No. 13 doi:10.1128/AEM.02371-07
In Silico and In Vivo Evaluation of Bacteriophage fEF24C, a Candidate for Treatment of Enterococcus faecalis Infections
Jumpei Uchiyama, Mohammad Rashel, Iyo Takemura, Hiroshi Wakiguchi, and Shigenobu Matsuzaki
Departments of Pediatrics,1 Microbiology and Infection, Kochi Medical School, Oko-cho, Nankoku City, Kochi 783-8505, Japan2
... first predicted by the following gene predication tools: GeneMark VIORIN
(http://opal.biology.gatech.edu/GeneMark/) (3), FGENESB (http://www.softberry.com/ ...
Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10
Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii
Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504
... gordonii genome sequence were detected using the BProm and FindTerm modules of the
fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...
J. Bacteriol.
July 2008, p. 4859-4864, Vol. 190, No. 14 doi:10.1128/JB.02022-07
Genes and Enzymes of Azetidine-2-Carboxylate Metabolism: Detoxification and Assimilation of an Antibiotic
Carol Gross, Roderick Felsheim, and Lawrence P. Wackett
Department of Biochemistry, Molecular Biology and Biophysics and BioTechnology Institute, 140 Gortner Laboratory, University of Minnesota, St. Paul, MN 55108
... open reading frames were found in the seven kilobase fragment using BlastX
on the 21 NCBI server and the Softberry program FGENESB. ...
Environmental Microbiology
Volume 10 Issue 1 Page 200-207, January 2008
Rapidly evolving CRISPRs implicated in acquired resistance of microorganisms to viruses
Gene W. Tyson, Jillian F. Banfield
Departments of 1Environmental Science, Policy and Management and 2Earth and Planetary Sciences, University of California, Berkeley, Berkeley, CA 94720, USA.
... Annotations were performed using fgenesb (Softberry) and were subsequently
manually refined using artemis (Rutherford et al., 2000). ...
Antimicrob. Agents Chemother.
doi:10.1128/AAC.01643-07
Whole genome pyrosequencing of an epidemic multidrug resistant Acinetobacter baumannii of the European clone II
Iacono et al.,
National Research Council, Segrate, 20090 Milan; Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di Sanita`; Department of Biology, University Roma Tre, Rome, Italy; Center for Biological Sequence Analysis, Technical University of Denmark, Lyngby, Denmark
... Coding genes were identified by crossing predictions from FGENESB package (24)
19 (http://www.softberry.com/), GeneMark (7) and GLIMMER (14). ...
Applied and Environmental Microbiology,
February 2008, p. 774-782, Vol. 74, No. 3
Enzymic Approach to Eurythermalism of Alvinella pompejana and Its Episymbionts
Charles K. Lee, S. Craig Cary, Alison E. Murray, and Roy M. Daniel
Department of Biological Sciences, University of Waikato, Hamilton, New Zealand,
College of Marine and Earth Studies, University of Delaware, Lewes, Delaware,
Division of Earth and Ecosystem Sciences, Desert Research Institute, Reno, Nevada
... The metagenomic sequences were annotated with a custom annotation pipeline based
on the FGenesB package (SoftBerry Inc., Mount Kisco, NY), blastX, and PRIAM ...
OMICS: A Journal of Integrative Biology
March 1, 2008, 12(1): 33-59. doi:10.1089/omi.2007.0043.
Characterizing Regulation of Metabolism in Geobacter sulfurreducens through Genome-Wide Expression Data and Sequence Analysis
Radhakrishnan Mahadevan et al.,
Department of Microbiology, University of Massachusetts, Amherst, Massachusetts. Department of Preventive Medicine, University of Tennessee Health Science Center, 66 Memphis, Tennessee.
... Operons were predicted using the commercial version of the FGENESB software (V.
Solovyev and A. Salamov, unpublished; Softberry, Inc., 2003-2005) that ...
FEMS Microbiology Ecology
Volume 65 Issue 2, Pages 238 - 250 doi:10.1111/j.1574-6941.2008.00436.x
Discovery of a bacterial gene cluster for catabolism of the plant hormone indole 3-acetic acid
Johan H.J. Leveau, Saskia Gerards
Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands
... FGENESB (SoftBerry, Mount Kisco, NY) and GenDB (Meyer et al., 2003) were used
to annotate the consensus DNA of the largest contig. Results. ...
PLoS ONE
2008; 3(4): e1862.
The Airborne Metagenome in an Indoor Urban Environment
Susannah G. Tringe et al.,
1Department of Energy (DOE) Joint Genome Institute, Walnut Creek, California, United States of America
2Genomics Division, Lawrence Berkeley National Laboratory, Berkeley, California, United States of America
... Protein prediction. All assembled contigs as well as all singlet reads that failed
to assemble were annotated using Fgenesb (www.softberry.com). ...
Infection and Immunity
April 2008, p. 1485-1497, Vol. 76, No. 4
Further Characterization of Vibrio vulnificus Rugose Variants and Identification of a Capsular and Rugose Exopolysaccharide Gene Cluster
Brenda L. Grau et al.,
Department of Biological Sciences,1 Socolofsky Microscopy Center,2 Department of Pathobiological Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, Louisiana3
... Using the web-based FGENESB: Bacterial Operon and Gene Prediction algorithm
(http://www.softberry.com/cgi-bin/programs/gfindb/fgenesb.pl), two operons were ...
Molecular Systems Biology
4 Article number: 198 doi:10.1038/msb.2008.35
Millimeter-scale genetic gradients and community-level molecular convergence in a hypersaline microbial mat
Kunin et al.,
Microbial Ecology Program, DOE Joint Genome Institute, Walnut Creek, CA, USA
Structural and Computational Biology Unit, European Molecular Biology Laboratory, Heidelberg, Germany
... Genes were predicted on vector and quality-trimmed reads with fgenesb (http://www.
softberry.com/) using a generic bacterial model, resulting in an average of ...
Journal of Bacteriology,
April 2008, p. 2777-2789, Vol. 190, No. 8
Massetolide A Biosynthesis in Pseudomonas fluorescens
I. de Bruijn,1 M. J. D. de Kock,1 P. de Waard,2 T. A. van Beek,3 and J. M. Raaijmakers1*
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands,1 Wageningen NMR Centre, Wageningen University, Wageningen, The Netherlands,2 Natural Products Chemistry Group, Laboratory of Organic Chemistry, Wageningen University, Wageningen, The Netherlands3
... Bacterial operons and genes were subsequently predicted by the Softberry FGENESB
program (Softberry, Inc., Mount Kisco, NY), and the identified open reading ...
FEMS Microbiology Ecology
2008 doi:10.1111/j.1574-6941.2008.00472.x
Comparative genomics of the pIPO2/pSB102 family of environmental plasmids: sequence, evolution, and ecology of pTer331 isolated from Collimonas fungivorans Ter331
Francesca Mela et. al.,
1Centre for Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands; 2Department of Microbial Ecology, University of Groningen, Haren, The Netherlands; and 3Argonne National Laboratory, Mathematics and Computer Science Division, Argonne, IL, USA
... The complete nucleotide sequence of pTer331 (40 457 bp) was searched for ORFs using
FGENESB (http://www.softberry.com) and by the automated genome ...
Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0
Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes
Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA
... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry.
com), were used for operon and gene predictions. RESULTS. ...
Infection and Immunity,
September 2007, p. 4482-4489, Vol. 75, No. 9
Genetic Basis for the New Pneumococcal Serotype, 6C
In Ho Park, Saeyoung Park, Susan K. Hollingshead, and Moon H. Nahm
Departments of Pathology,1 Microbiology, University of Alabama at Birmingham, 845 19th Street South, BBRB 614, Birmingham, Alabama 35294
... and genes, promoters, and transcription terminators in the capsule gene locus were
identified using fgenesB, BPROM, and FindTerm (Softberry Inc.), which are ...
Microbiology
153 (2007), 3478-3498; DOI 10.1099/mic.0.2007/008250-0
Molecular analysis of the distribution and phylogeny of dissimilatory adenosine-5'-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes
Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany
... promoters, termination sites and gene arrangement in operons was performed using
the web versions FGENESB, BPROM and BTERM of the Softberry program package ...
Microbiology
153 (2007), 2026-2044; DOI 10.1099/mic.0.2006/003152-0
Phylogeny of the alpha and beta subunits of the dissimilatory adenosine-5'-phosphosulfate (APS) reductase from sulfate-reducing prokaryotes – origin and evolution of the dissimilatory sulfate-reduction pathway
Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany
... promoters, termination sites and operons in genome data were performed using the
web versions FGENESB, BPROM and BTERM of the Softberry program package ...
Journal of Biotechnology
Volume 131, Issue 4, 30 September 2007, Pages 371-378
Characterization of the unique organization and co-regulation of a gene cluster required for phenol and benzene catabolism in Pseudomonas sp. M1
Pedro M. Santos and Isabel Sa'-Correia
BB, Institute for Biotechnology and Bioengineering, Centre for Biological and Chemical Engineering, Instituto Superior Te'cnico, Av. Rovisco Pais, 1049-001 Lisboa, Portugal
... This 9 kb chromosomal DNA sequence was analyzed using the gene prediction program
FGENESB from the Softberry online package (http://www.softberry.com/), the ...
Applied and Environmental Microbiology
August 2007, p. 4984-4995, Vol. 73, No. 15
Transposon Insertion Reveals pRM, a Plasmid of Rickettsia monacensis
Gerald D. Baldridge, Nicole Y. Burkhardt, Roderick F. Felsheim, Timothy J. Kurtti, and Ulrike G. Munderloh
Department of Entomology, University of Minnesota, St. Paul, Minnesota 55108
... encoded by other bacteria (Table 2). Four pRM genes (pRM17 to pRM20) were identified
as members of an operon by the FGENESB program (SoftBerry, Inc.), while ...
European Journal of Plant Pathology
Volume 119, Number 3 / November 2007 p. 279-300
The magic and menace of metagenomics: prospects for the study of plant growth-promoting rhizobacteria
Johan H. J. Leveau
Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands
... al. 2003), Artemis (Rutherford et al. 2000), Glimmer (Delcher et al. 1999),
and FGenesB pipeline (www.softberry.com). These programmes ...
Functional & Integrative Genomics
Volume 7, Number 3 / July 2007 p. 229-255
Genome-wide expression profiling in Geobacter sulfurreducens : identification of Fur and RpoS transcription regulatory sites in a rel Gsu mutant
Julia Krushkal et.al.,
Department of Preventive Medicine, University of Tennessee Health Science Center, 66 N. Pauline Ste. 633, Memphis, TN 38163, USA
... 2003) using the commercial version of the FGENESB software (V. Solovyev
and A. Salamov, unpublished; Softberry, Inc; 2003-2006). ...
Applied and Environmental Microbiology
July 2007, p. 4417-4424, Vol. 73, No. 14
Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector
Ju-Hoon Lee, Jamie S. Halgerson, Jeong-Hwan Kim, and Daniel J. O'Sullivan
Department of Food Science and Nutrition and Center for Microbial and Plant Genomics, University of Minnesota, Cargill Building for Microbial and Plant Genomics, 1500 Gortner Ave., St. Paul, Minnesota 55108
... Prediction of open reading frames (ORFs) was conducted with GeneMark (4)
and the FgenesB (Softberry, Inc., Mount Kisco, NY) programs. ...
Plasmid
Volume 58, Issue 3, November 2007, Pages 240-248
The polyhydroxyalkanoate genes of a stress resistant Antarctic Pseudomonas are situated within a genomic island
Nicolas D. Ayub, M. Julia Pettinari, Beatriz S. Mendez and Nancy I. Lopez
Departamento de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, 1428 Buenos Aires, Argentina
... and bacterial operons were predicted by using GeneMark.hmm for Prokaryotes Version
2.4 (Lukashin and Borodovsky, 1998) and FGENESB (http://www.softberry.com). ...
Applied and Environmental Microbiology,
July 2007, p. 4226-4233, Vol. 73, No. 13
Possible Origins of CTnBST, a Conjugative Transposon Found Recently in a Human Colonic Bacteroides Strain
David J. Schlesinger, Nadja B. Shoemaker, and Abigail A. Salyers
Department of Microbiology, University of Illinois, Urbana, Illinois 61801
... reading frames (ORFs) were identified by using two Web-based ORF finding programs,
GeneMark (2) and FGENESB: Bacterial Operon and Gene Prediction (Softberry Inc ...
PROTEOMICS
Volume 7, Issue 12 , Pages 2047 - 2058, 2007
Qualitative and comparative proteomic analysis of Xanthomonas campestris pv. campestris 17
Wei-Jen Chung et al.,
Sequencing Core, Genome Research Center, National Yang-Ming University, Taipei, Taiwan
... Operon predic- tion was carried out using FGENESB from Softberry, which predicts
genes and operons as well as functional RNA (http://www.softberry.com/berry ...
Nature Biotechnology
25, 447 - 453 (01 Apr 2007)
Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338
Oliynyk et al.,
Department of Biochemistry, University of Cambridge, 80 Tennis Court Road, Cambridge CB2 1GA, UK.
...sequence. Genome analysis and annotation. CDSs were predicted and annotated using the program fgenesB (http://www.softberry.com/),
trained ab initio, and manually curated using Artemis (version 8) and a set of in-house PERL scripts....
Environmental Microbiology
Volume 9 Issue 4 Page 846-858, April 2007
Proteorhodopsin photosystem gene clusters exhibit co-evolutionary trends and shared ancestry among diverse marine microbial phyla
Jay McCarren and Edward F. DeLong**
Department of Civil and Environmental Engineering and Division of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA.
... Sequences were assembled with Sequencher v4.5 (Gene Codes, Ann Arbor, MI, USA) and
annotated with both FGENESB (Softberry, Mount Kisco, NY, USA) and Artemis ...
BMC Evolutionary Biology
2007, 7:79 (18 May 2007)
Evolution of rhodopsin ion pumps in haloarchaea
Sharma AK et al.,,
1Department of Biochemistry and Molecular Biology, Dalhousie University, 5850 College St., Halifax, Nova Scotia, B3H 1X5, Canada
2Unidad de Microbiologia, Centro de Biologia Molecular y Celular, Universidad Miguel Hernandez, Campus de San Juan, 03550 San Juan, Alicante, Spain
and open reading frames (ORFs) were identified using the fgenesB option
under operon and gene finding in bacteria at [66] with Halobacterium sp.
PNAS
| March 27, 2007 | vol. 104 | no. 13 | 5590-5595
Proteorhodopsin photosystem gene expression enables photophosphorylation in a heterologous host
A. Martinez*, A. S. Bradley, J. R. Waldbauer, R. E. Summons, and E. F. DeLong*,
*Department of Civil and Environmental Engineering, Division of Biological Engineering, and Department of Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; and Joint Program in Chemical Oceanography, Woods Hole Oceanographic Institution and Massachusetts Institute of Technology, Cambridge, MA 02139
... complete DNA sequence was assembled by using Sequencher version 4.5 (Gene Codes
Corporation, Ann Arbor, MI) and annotated with FGENESB (Softberry, Mount Kisco ...
Nature Methods
- 4, 495 - 500 (2007)
Use of simulated data sets to evaluate the fidelity of metagenomic processing methods
Konstantinos Mavromatis et al.,
Department of Energy Joint Genome Institute (DOE-JGI), 2800 Mitchell Drive, Walnut Creek, California 94598, USA.
...We assembled sampled reads using three commonly used genome assemblers
(Phrap, Arachne and JAZZ), and predicted genes using
two popular gene-finding pipelines (fgenesb and CRITICA/GLIMMER)....
... fgenesb: http://sun1.softberry.com/berry.phtml?topic=
fgenesb&group=programs&subgroup=gfindb; FAMeS: http://fames.jgi-psf.org...
Nature Biotechnology
24, 1263 - 1269 (2006)
Published online: 24 September 2006; | doi:10.1038/nbt1247
Metagenomic analysis of two enhanced biological phosphorus removal (EBPR) sludge communities
Hector Garcia Martin et al.,
DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, California 94598, USA.
... Over 30,000 coding sequences were predicted in each Phrap assembly using ab
initio gene predictions (fgenesb, http://www.softberry.com/). ...
BIOINFORMATICS
Vol. 22 no. 14 2006, pages e359 - e367
doi:10.1093/bioinformatics/btl217
An experimental metagenome data management
and analysis system
Victor M. Markowitz et al.,
1Biological Data Management and Technology Center, Lawrence Berkeley National Lab, USA,
2Genome Biology Program, Joint Genome Institute, USA and 3Microbial Ecology Program,
Joint Genome Institute, USA
... protein-coding genes (CDSs) are predicted
on scaffolds and/or so called shrapnel sequences (single reads
that are not incorporated into scaffolds) using microbial gene
finders, such as Glimmer (Delcher et al., 1999) or Fgenesb (Soft-
Berry, 2006)...
Journal of Bacteriology
December 2006, p. 8283-8293, Vol. 188, No. 23
Pip, a Novel Activator of Phenazine Biosynthesis in Pseudomonas chlororaphis PCL1391
Genevieve Girard et al.,
Leiden University, Institute of Biology, Clusius Laboratory, Wassenaarseweg 64, 2333 AL Leiden, The Netherlands,
Leiden University, Leiden Institute of Chemistry, Department of Molecular Genetics, P.O. Box 9502, 2300 RA Leiden, The Netherlands
... gov/BLAST). A search for bacterial promoters and terminators was done
using Softberry (http://www.softberry.com). Alignments of ...
Nature Biotechnology
,
24, 1263 - 1269 (01 Oct 2006) Research
Metagenomic analysis of two enhanced biological phosphorus removal (EBPR) sludge communities
Martin et al.,
DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, California 94598, USA
..coding sequences were predicted in each Phrap assembly using ab initio gene predictions
(fgenesb, http://www.softberry.com/). The genomic fragments were binned (classified) using a combination of read depth, % GC content,...
PNAS
,
August 22, 2006 vol. 103 no. 34 12897-12902
Deletion of TolC orthologs in Francisella tularensis identifies roles in multidrug resistance and virulence
Gil et al.,
Center for Infectious Diseases, Stony Brook University, Stony Brook, NY 11794-5120
... 42). The locations of promoters and operons were investigated by using the FGENESB
and BPROM programs available from Softberry (Mt. Kisco, NY). ...
Applied and Environmental Microbiology
,
May 2006, p. 3154-3160, Vol. 72, No. 5
Isolation and Sequencing of a Temperate Transducing Phage for Pasteurella multocida
Susana Campoy,1, Jesus Aranda,2, Gerard Alvarez,2 Jordi Barbe,1,2 and Montserrat Llagostera1,2*
Centre de Recerca en Sanitat Animal (CReSA),1 Departament de Genetica i Microbiologia, Universitat Autonoma de Barcelona,
Bellaterra, 08193 Barcelona, Spain2
... Open reading frames (ORFs) were identified using Glimmer 2.02 (http://nbc11.biologie.
uni-kl.de/glimmer2.02) (8) and FGENESB (http://softberry.com) (34) for ...
Journal of Bacteriology
,
July 2006, p. 5228-5239, Vol. 188, No. 14
Global Transcriptome Analysis of Tropheryma whipplei in Response to Temperature Stresses
Nicolas Crapoulet,1 Pascal Barbry,2 Didier Raoult,1 and Patricia Renesto1*
Unite des Rickettsies, UMR 6020 CNRS, IFR48, Faculte de Medecine, 27, Boulevard Jean Moulin,
Marseille, France,1 Institut de Pharmacologie Moleculaire et Cellulaire, UMR 6097 CNRS/UNSA, Sophia Antipolis, France2
... genome. Their coexpression thus confirms the bioinformatic dnaK operon prediction
(FGENESB software; Softberry Inc., Mount Kisco, NY). ...
Microbiology
,
152 (2006), 1951-1968
Two novel conjugative plasmids from a single strain of Sulfolobus
Gael Erauso1,2, Kenneth M. Stedman3,4, Harmen J. G. van de Werken1, Wolfram Zillig3, and John van der Oost1
1 Laboratory of Microbiology, Wageningen University, Wageningen, The Netherlands
.. Identification of putative genes and operons was performed using the FGENESB
pattern/Markov chain-based prediction program from Softberry (http://softberry.com ...
Molecular Microbiology
,
(2006) 61 (4), 960-977
Metagenomic DNA fragments that affect Escherichia coli mutational pathways
Yang, Hanjing, To, Kam H., Aguila, Sharon J. & Miller, Jeffrey H.
Department of Microbiology, Immunology and Molecular Genetics, and the Molecular
Biology Institute, 1602 Molecular Sciences Building, 405 Hilgard Avenue, University of California, Los Angeles, CA 90095, USA
.. The ORFs on each clone were annotated by a bacterial operon and gene prediction
program fgenesb ( http:/ / www.softberry.com ) and by comparison with known ...
Applied and Environmental Microbiology
,
May 2006, p. 3154-3160, Vol. 72, No. 5
Isolation and Sequencing of a Temperate Transducing Phage for Pasteurella multocida
Susana Campoy,1, Jesus Aranda,2, Gerard Alvarez,2 Jordi Barbe,1,2 and Montserrat Llagostera1,2*
Centre de Recerca en Sanitat Animal (CReSA),1 Departament de Genetica i Microbiologia, Universitat Autonoma de Barcelona, Bellaterra, 08193 Barcelona, Spain2
... Open reading frames (ORFs) were identified using Glimmer 2.02 (http://nbc11.biologie.
uni-kl.de/glimmer2.02) (8) and FGENESB (http://softberry.com) (34) for ...
Applied and Environmental Microbiology, February 2006, p. 1532-1541, Vol. 72, No. 2
Comparative Genomics of DNA Fragments from Six Antarctic Marine Planktonic Bacteria
Joseph J. Grzymski,1 Brandon J. Carter,1 Edward F. DeLong,2 Robert A. Feldman,3, Amir Ghadiri,3 and Alison E. Murray1
Desert Research Institute, 2215 Raggio Parkway, Reno, Nevada 89512,1 Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139,2 Amersham Biosciences, 928 E. Argues Avenue, Sunnyvale, California 940863
... Two gene finding programs, FgenesB (Softberry Inc.) and GLIMMER (TIGR),
identified open reading frames (ORFs). The results from ...
Nature 439, 847-850 (16 February 2006)
Proteorhodopsin lateral gene transfer between marine planktonic Bacteria and Archaea
Niels-Ulrik Frigaard, Asuncion Martinez, Tracy J. Mincer & Edward F. DeLong
Department of Civil and Environmental Engineering and Division of Biological Engineering, Massachusetts Institute of Technology, Building 48, 15 Vassar Street, Cambridge, Massachusetts 02139, USA.
... Subcloning kit (Invitrogen) combined with sequence assembly with Sequencher v. 4.5
(Gene Codes Corporation) and annotation with FGENESB (Softberry) and Artemis ...
FEMS Microbiology Letters, 2006 257 (2), 177-181.
Isolation of a novel plasmid, pNi15, from Enterobacter sp. Ni15 containing a nickel resistance gene
Young-Keun Lee
et al.,
Radiation Application Research Division, ARTI, Korea Atomic Energy Research Institute, Sinjeong-Dong, Jeongeup, Korea
... bp in size and it contains six ORFs (four in a plus strand and two in a minus strand)
which were analyzed using the FGENESB program at http://www.softberry.com ...
PLoS Biol 2006 4(4): e95
Pathways of Carbon Assimilation and Ammonia Oxidation Suggested by Environmental Genomic Analyses of Marine Crenarchaeota
Steven J. Hallam et al.,
Massachusetts Institute of Technology, Cambridge, Massachusetts, United States of America,
... Fosmid sequences were annotated using the FGENESB pipeline for automatic annotation
of bacterialgenomes from Softberry (http:/ / www.softberry.com/ berry.phtml ...
Applied and Environmental Microbiology
December 2005, p. 8506-8513, Vol. 71, No. 12
Sequence and Expression Analyses of Cytophaga-Like Hydrolases in a Western Arctic Metagenomic Library and the Sargasso Sea
Matthew T. Cottrell, Liying Yu, and David L. Kirchman
University of Delaware, College of Marine Studies, Lewes, Delaware 19958
... obtained from the Welcome Trust Sanger Institute (http://www.sanger.ac.uk/Software/
Artemis/) and using the FGENESB website (http://www.softberry.ru/) (Softberry ...
Infection and Immunity
August 2005, p. 4982-4992, Vol. 73, No. 8
Characterization of the cciIR Quorum-Sensing System in Burkholderia cenocepacia
Rebecca J. Malott,1 Adam Baldwin,2 Eshwar Mahenthiralingam,2 and Pamela A. Sokol
Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada T2N 4N1,1 Cardiff School of Biosciences, Cardiff University, Cardiff CF10 3TL, Wales2
... Cell-Cell Commun. Bacteria, 2004). The promoter regions for cciI and cciR were
predicted in silico using SoftBerry BPROM (http://www.softberry.com). ...
Science, 2005 308 (5721) 554-557
Science Supporting Online Material
Comparative Metagenomics of Microbial Communities
Susannah Green Tringe,
Christian von Mering, Arthur Kobayashi, Asaf A. Salamov,
Kevin Chen, Hwai W. Chang, Mircea Podar, Jay M. Short,
Eric J. Mathur, John C. Detter, Peer Bork, Philip Hugenholtz, Edward M. Rubin
... Functional annotation All genomic sequences from soil, whale falls and acid mine drainage were analyzed by the program FGENESB from Softberry, which predicts...
Nature 428, 37-43 (4 March 2004)
Community structure and metabolism through reconstruction of microbial genomes from the environment
Gene W. Tyson1, Jarrod Chapman3,4, Philip Hugenholtz1, Eric E. Allen1,
Rachna J. Ram1, Paul M. Richardson4, Victor V. Solovyev4, Edward M. Rubin4, Daniel S. Rokhsar3,4 and Jillian F. Banfield1,2
1. Department of Environmental Science, Policy and Management, University of California, Berkeley, California 94720, USA
2. Department of Earth and Planetary Sciences, University of California, Berkeley, California 94720, USA
3. Department of Physics, University of California, Berkeley, California 94720, USA
4. Joint Genome Institute, Walnut Creek, California 94598, USA
...To identify protein and RNA genes in genomic sequences from an environmental sample we applied the Fgenesb_annotator pipeline developed by Softberry Inc (http://www.softberry.com/berry.phtml?topic=gfindb) which provides completely automatic comprehensive annotation of bacterial sequences...
Appl Environ Microbiol. 2004 April; 70(4): 2332-2341
Oxygen-Controlled Bacterial Growth in the Sponge Suberites domuncula: toward a Molecular Understanding of the Symbiotic Relationships between Sponge and Bacteria
Werner E. G. Muller,* Vladislav A. Grebenjuk, Narsinh L. Thakur, Archana N. Thakur, Renato Batel, Anatoli Krasko, Isabel M. Muller, and Hans J. Breter
Institut fur Physiologische Chemie, Abteilung Angewandte Molekularbiologie, Universitat Mainz, D-55099 Mainz, Germany
*Corresponding author. Mailing address: Institut fur Physiologische Chemie, Abteilung Angewandte Molekularbiologie, Universitat Mainz, Duesbergweg 6, 55099 Mainz, Germany. Phone: 6131-3925910. Fax: 6131-3925243. E-mail: wmueller@mail.uni-mainz.de
... For genes and potential promoter prediction, we used the FGENESB-Pattern/Markov
chain-based bacterial operon and gene prediction program from the SoftBerry ...
Molecular Microbiology
Volume 52 Issue 6 Page 1579 - June 2004
doi:10.1111/j.1365-2958.2004.04086.x
Gene conversion: a mechanism for generation of heterogeneity in the tprK gene of Treponema pallidum during infection
Arturo Centurion-Lara*, et al
Affiliations: Departments of Medicine and Pathobiology, University of Washington, Harborview Medical Center, Box 359779, 325 Ninth Ave., Seattle, WA 98104, USA.
... Using the fgenesb program, which identifies putative operons and genes in microbial
genomes (Softberry; http:/ / www.softberry.com/ berry.phtml ), the tprK ORF ...
Journal of Theoretical Biology 230 (2004) 133-144
Computational prediction of conserved operons and phylogenetic footprinting of transcription regulatory elements in the metal-reducing bacterial family Geobacteraceae
Bin Yana, Barbara A. Methe´ b, Derek R. Lovleyc, Julia Krushkala,*
aDepartment of Preventive Medicine, Center of Genomics and Bioinformatics, University of Tennesee Health Science Center,
66 N. Pauline St., Ste. 633, Memphis, TN 38163, USA
bThe Institute for Genomic Research, Rockville, MD, USA
cDepartment of Microbiology, Morrill Science Center IV North, University of Massachusetts, 639 North Pleasant Str., Amherst, MA 01003, USA
... the conserved nature of the operons 2 . Operons in Geobacter sulfurreducens were
predicted ab initio by the public version of program FGENESB (V. Solovyev and V ...
Molecular Microbiology Volume 52 Issue 6 Page 1579 -1596 June 2004
doi:10.1111/j.1365-2958.2004.04086.x
Gene conversion: a mechanism for generation of heterogeneity in the tprK gene of Treponema pallidum during infection
Arturo Centurion-Lara*, Rebecca E. LaFond, Karin Hevner, Charmie Godornes, Barbara J. Molini, Wesley C. Van Voorhis and Sheila A. Lukehart
... Using the fgenesb program, which identifies putative operons and genes in microbial genomes (Softberry; http:/ / www.softberry.com/ berry.phtml ),
the tprK ORF ...
Plasmid
Volume 52, Issue 2, September 2004, Pages 131-138
Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum
Anders Clausen a, 1, 2, Marie Just Mikkelsen a, 2, Imke Schroder b and Birgitte K. Ahring
a Biocentrum-DTU, Building 227, DK-2800, Lyngby, Denmark
b Department of Microbiology, Immunology and Molecular Genetics, University of California at Los Angeles, Los Angeles, CA, USA
... 1913), and orf61 (1897-2223) are predicted to represent genes,
when a FGENESB gene
prediction is run using Bacillus subtilis parameters
at www.softberry.com. ...
Environmental Microbiology, September 2004, vol. 6, no. 9, pp. 903-910(8)
DOI: 10.1111/j.1462-2920.2004.00676.x
Different SAR86 subgroups harbour divergent proteorhodopsins
Gazalah Sabehi1; Oded Beja1; Marcelino T. Suzuki2; Christina M. Preston3; Edward F. DeLong4
Affiliations: 1: Department of Biology, Technion-Israel Institute of Technology, Haifa 32000, Israel. 2: Chesapeake Biological Laboratory, University of Maryland Center for Environmental Sciences, Solomons, MD 20688, USA. 3: Monterey Bay Aquarium Research Institute, 7700 Sandholdt Road, Moss Landing, CA 95039, USA. 4: Massachusetts Institute of Technology, Cambridge, MA 02139, USA.
... program. FGENESB (Softberry), and the annotation was subsequently refined
and curated manually using ARTEMIS (Sanger Center). Fig. ...
Proc Natl Acad Sci U S A. 2003 October 28; 100(22): 12830-12835.
doi: 10.1073/pnas.2133554100. Published online 2003 October 17.
Evolution
Proteorhodopsin genes are distributed among divergent marine bacterial taxa
Jose R. de la Torre, Lynne M. Christianson, Oded Beja, Marcelino T. Suzuki,
David M. Karl, John Heidelberg,** and Edward F. DeLong
Monterey Bay Aquarium Research Institute, 7700 Sandholdt Road, Moss Landing, CA 95039; §Department of Biology, Technion-Israel Institute of Technology, Haifa 32000, Israel; Chesapeake Biological Laboratory, University of Maryland, Solomons, MD 20688; Department of Oceanography, University of Hawaii, Manoa, HI 96822; and **Institute for Genomic Research, Rockville, MD 20850
Edited by Sallie W. Chisholm, Massachusetts Institute of Technology, Cambridge, MA, and approved August 21, 2003, (received for review 2003 June 10)
Present address: Department of Civil and Environmental Engineering, University of Washington, Seattle, WA 98195.
To whom correspondence should be addressed. E-mail: delong@mbari.org.
... Analysis of the potential genes and protein-coding regions was performed by using a combination of the BLAST (11), GLIMMER 2.02 (TIGR) (12, 13), FGENESB (Softberry, Mount Kisco, NY), and ARTEMIS (Sanger Center, Cambridge University, U.K.) (14) software packages.
BPROM
Infection and Immunity
2016, 84(9), 2566-2574. doi: 10.1128/IAI.00297-16
Evidence that BosR (BB0647) is a positive autoregulator in Borrelia burgdorferi
Ouyang, Z., Zhou, J., Norgard, M. V.
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas, USA
... To investigate further the regulation of bosR expression in B. burgdorferi, we analyzed the
5? putative regulatory region upstream of bb0648 using BPROM (SoftBerry), a bacterial
promoter prediction program. A typical bacterial ? 70 promoter (P1) (Fig. ...
Research in microbiology
2016, 167(2), 90-102. http://dx.doi.org/10.1016/j.resmic.2015.10.004
Insights into aureocin A70 regulation: participation of regulator AurR, alternative transcription factor sB and phage f11 regulator cI
Coelho, M. L. V., Fleming, L. R., & de Freire Bastos, M. D. C.
a Departamento de Microbiologia Geral, Instituto de Microbiologia Paulo de Goes, UFRJ, Rio de Janeiro, Brazil
b Instituto Nacional da Propriedade Industrial, INPI, Brazil
... operon, a region of 240 nucleotides
immediately upstream of this operon was analyzed using programs PPP (http://bioinformatics.
biol.rug.nl/websoftware/ppp/ppp_start.php) and BPROM (http://linux1.softberry.com). ...
Applied and environmental microbiology
2016, 82(12), 3503-3514. doi: 10.1128/AEM.00299-16
Agrobacterium tumefaciens Zur Regulates the High-Affinity Zinc Uptake System TroCBA and the Putative Metal Chaperone YciC, along with ZinT and ZnuABC, for Survival under Zinc-Limiting Conditions
Chaoprasid, P. et al.,
aLaboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok, Thailand
bEnvironmental Toxicology, Chulabhorn Graduate Institute, Lak Si, Bangkok, Thailand
... 300 bp (Fig. 1B). The transcriptional start sites of troC (at the A residue) and of yciC
(at the A residue) were determined by 5? RACE, and the ?10 and ?35 sequences
were predicted using BPROM (Softberry) (Fig. 1B). A Zur ...
BMC Genomics
2016, 17:326 DOI: 10.1186/s12864-016-2680-8
Xylan degradation by the human gut Bacteroides xylanisolvens XB1A T involves two distinct gene clusters that are linked at the transcriptional level
Despres, J. et al.,
Institut National de la recherche Agronomique (INRA), UR454 Microbiologie; INRA, Plate-forme d’Exploration du Metabolisme
... Putative promoters and terminators were searched within intergenic sequences (>100 bp) using different tools
(BPROM, PPP, Arnold) available at http://molbiol-tools.ca/Promoters.htm. Operon prediction was carried out using
FGENESB, which is based on distances between ORFs and frequencies of different genes neighboring each other in known bacterial genomes, as well as on promoter and terminator predictions (http://www.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...
Applied and environmental microbiology
2016, 82(4), 1274-1285. doi: 10.1128/AEM.03111-15
A new N-Acyl homoserine lactone synthase in an uncultured symbiont of the Red Sea sponge Theonella swinhoei
Britstein, M. et al.,
aDepartment of Marine Biology, Leon H. Charney School of Marine Sciences, University of Haifa, Haifa, Israel
bBacteriology Group, International Centre for Genetic Engineering & Biotechnology, Padriciano, Trieste, Italy
cArgonne National Laboratory, Institute for Genomic and Systems Biology, Argonne, Illinois, USA
... The intergenic region between TswR and TswI, predicted to contain the promoter region of the
TswI AHL synthase (based on Predictions of Bacterial Promoters [BPROM]; Softberry), and the
intergenic region between TswR-t and TswR, predicted to contain the promoter region ...
SpringerPlus
2016 65:1060 DOI: 10.1186/s40064-016-2693-4
Characterization of antimicrobial substance from Lactobacillus salivarius KL-D4 and its application as biopreservative for creamy filling
Therdtatha, P. et al.,
Specialized Research Unit, Probiotics and Prebiotics for Health, Department of Biotechnology, Faculty of Agro-Industry, Kasetsart University
Center for Advanced Studies for Agriculture and Food (CASAF), Kasetsart University Institute for Advanced Studies (NRU-KU), Kasetsart University
... Bacterial promoter prediction was performed using BROM on the Softberry (online program) on August 4th, 2015 ...
Molecular microbiology
2016, 99(3), 453-469. DOI: 10.1111/mmi.13128
Vibrio cholerae phosphatases required for the utilization of nucleotides and extracellular DNA as phosphate sources
McDonough, E., Kamp, H., Camilli, A.
Howard Hughes Medical Institute and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA
... Using the online promoter prediction tool, Softberry BRPOM (Solovyev and Salamov, 2011), we identified two putative CRP binding sites in the V.?cholerae cpdB promoter. ...
PloS one
2016, 11(7), e0158895. http://dx.doi.org/10.1371/journal.pone.0158895
Identification, Functional Characterization and Regulon Prediction of a Novel Two Component System Comprising BAS0540-BAS0541 of Bacillus anthracis
Gopalani, M., Dhiman, A., Rahi, A., Kandari, D., & Bhatnagar, R.
Laboratory of Molecular Biology and Genetic Engineering, School of Biotechnology, Jawaharlal Nehru University, New Delhi-110067, India
... search. Promoter predictions were done using
PromBase [27] and Bprom program (Softberry) wherever needed. ...
Environmental Microbiology
2016 DOI: 10.1111/1462-2920.13419
The guanidinobutyrase GbuA is essential for the alkylquinolone-regulated pyocyanin production during parasitic growth of Pseudomonas aeruginosa in co-culture with Aeromonas hydrophila
Jagmann, N., Bleicher, V., Busche, T., Kalinowski, J., & Philipp, B.
Institut fur Molekulare Mikrobiologie und Biotechnologie, Westfalische Wilhelms-Universitat (WWU) Munster, Munster, Germany
Center for Biotechnology (CeBiTec), Universitat Bielefeld, Bielefeld, Germany
... With the bacterial promoter prediction program BProm
(www.softberry.com), however, another putative promoter could be identified within the gene ...
Frontiers in Microbiology
26 May 2016, 7, 782 http://dx.doi.org/10.3389/fmicb.2016.00782
When Genome-Based Approach Meets the "Old but Good": Revealing Genes Involved in the Antibacterial Activity of Pseudomonas sp. P482 against Soft Rot Pathogens
Krzyzanowska, D. M. et al.,
1Laboratory of Biological Plant Protection, Department of Biotechnology, Intercollegiate Faculty of Biotechnology of University of Gdansk and Medical University of Gdansk, Gdansk, Poland
2Laboratory of Molecular Bacteriology, Department of Medical Biotechnology, Intercollegiate Faculty of Biotechnology University of Gdansk and Medical University of Gdansk, Medical University of Gdansk, Gdansk, Poland
3School of Life Sciences, Faculty of Medicine and Health Sciences, University of Nottingham, Nottingham, UK
... The sequence of interest (contig JHTS01000055.1, range 27,755–36,623) was analyzed for the presence of sigma housekeeping promoter sequence by three different programs: PromoterHunter9 (Klucar et al., 2010), Promoter prediction10 (Reese, 2001) and
BPROM 11 (Solovyev and Salamov, 2011). ...
RNA
2016, 22(9), 1373-1385. doi: 10.1261/rna.055129.115
A computational strategy for the search of regulatory small RNAs in Actinobacillus pleuropneumoniae
Rossi, C. C. et al.,
1Laboratorio de Genetica Molecular de Micro-organismos, Departamento de Microbiologia, Instituto de Biotecnologia Aplicada a Agropecuaria–BIOAGRO, Universidade Federal de Vicosa, Vicosa, 36570-900, Brazil
2Section of Paediatrics, Imperial College London, St. Mary's Campus, London W2 1PG, United Kingdom
... All the candidates had putative Rho-independent terminator regions and promoter elements
in the close upstream region of each designated gene, as predicted by BPROM (software
Softberry, available at www.softberry.com, Supplemental Fig. S2). ...
Biochemistry (Moscow)
2016, 81(8), 884-891. doi:10.1134/S0006297916080095
Features of gene expression of Bacillus pumilus metalloendopeptidase
Rudakova, N. L. et al.,
Kazan (Volga Region) Federal University
... trpC2; ?glnK – strain deficient in the glnK gene, CmR Page 3. 886 RUDAKOVA et al.
BIOCHEMISTRY (Moscow) Vol. 81 No. 8 2016 metalloendopeptidase gene using the Softberry
BPROM network [10]. The results were statistically processed in Microsoft Excel. ...
Microbial Drug Resistance
2016 doi:10.1089/mdr.2016.0047.
Biochemical Characterization of ?-Lactamases from Mycobacterium abscessus Complex and Genetic Environment of the ?-Lactamase-Encoding Gene
Ramirez, A. et al.,
1Universidad de Los Andes, Facultad de Farmacia y Bioanalisis, Laboratorio de Microbiologia Molecular, Merida, Venezuela.
2Universidad de Buenos Aires, Facultad de Farmacia y Bioquimica, Laboratorio de Resistencia Bacteriana, Buenos Aires, Argentina.
... 60 sec. Putative gene promoter sequences (?35) were recognized using the BPROM
program (http://linux1.softberry.com/berry.phtml?topic=bprom&group=
programs&subgroup=gfindb). DNA sequencing and analysis PCR products ...
Int J Nano Stud Technol
2016, S3:001, 1-8.
Removal of Heavy Metals by Indigenous Microorganisms and Identification of Gene Responsible for Remediation
M.H. Fulekar
1 School of Environment and Sustainable Development, Central University of Gujarat, Gandhinagar, India.
2 Environmental Biotechnology Laboratory,Department of Life Sciences, University of Mumbai, Vidyanagari, Santacruz (E) Mumbai, India.
... biology tools, ExPASy. The restriction endonuclease sites of the gene was
determined with the help of online analysis tools. The promoter region was
determined by Softberry-BRPROM program. Result and Discussion The ...
Frontiers in Microbiology
2016, 7: 1115. doi: 10.3389/fmicb.2016.01115
Thusin, a novel two-component lantibiotic with potent antimicrobial activity against several Gram-positive pathogens
Xin, B. et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China
.. The putative promoter and terminator in the thusin gene
cluster were detected using the Softberry BPROM and Find Term software programs ...
Viruses
2016, 8(8), 213; doi:10.3390/v8080213
Binding Specificities of the Telomere Phage ?KO2 Prophage Repressor CB and Lytic Repressor Cro
Hammerl, J. A., Jackel, C., Lanka, E., Roschanski, N., Hertwig, S.
1 Bundesinstitut fur Risikobewertung (Federal Institute for Risk Assessment), Department of Biological Safety, Diedersdorfer Weg 1, D-12277 Berlin, Germany
2 Max-Planck-Institut fur Molekulare Genetik, Ihnestra?e 63-73, D-14195 Berlin, Germany
... In silico
promoter identification was performed by using BPROM (Softberry, Mount Kisco, NY, USA ...
Frontiers in microbiology
2016, 7: 687. doi: 10.3389/fmicb.2016.00687
The rnc Gene Promotes Exopolysaccharide Synthesis and Represses the vicRKX,/i> Gene Expressions via MicroRNA-Size Small RNAs in Streptococcus mutans
Mao, M. Y. et al.,
1State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China
2Department of Dentistry, Yan'an Hospital Affiliated to Kunming Medical University, Kunming, China
... We first analyzed
these intergenic noncoding sequences by FGENESB and BPROM programs for operon and
promoter prediction, respectively (http://linux1.softberry.com/berry.phtml) (Solovyev and ...
Plasmid
2016, Volumes 84–85, March–May 2016, Pages 36–43. doi:10.1016/j.plasmid.2016.02.005
The ancient small mobilizable plasmid pALWED1. 8 harboring a new variant of the non-cassette streptomycin/spectinomycin resistance gene aadA27
Kurakov, A. et al.,
a Institute of Molecular Genetics, Russian Academy of Sciences, Kurchatov sq. 2, 123182 Moscow, Russia
b Institute of Bioengineering, Research Center of Biotechnology of the Russian Academy of Sciences, Leninsky Ave. 33, bld. 2, 119071 Moscow, Russia
.. Putative ORFs and promoters were detected using
BPROM, FGENESB (http://www.softberry.com/berry.html), and GeneMark.hmm for ...
PloS one
2016, 11(7), e0158793. doi: 10.1371/journal.pone.0158793
In Vitro Analysis of Predicted DNA-Binding Sites for the Stl Repressor of the Staphylococcus aureus SaPIBov1 Pathogenicity Island
Papp-Kadar, V., Szabo, J. E., Nyiri, K., Vertessy, B. G.
Department of Applied Biotechnology and Food Science, Budapest University of Technology and Economics, Budapest, 1111, Hungary, Laboratory of Genome Metabolism and Repair, Institute of Enzymology, Research Centre for Natural Sciences, Hungarian Academy of Sciences, Budapest, 1117, Hungary
... For promoter prediction the BRPOM software was used (http://linux1.
softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) [29]. ...
Molecular Microbiology
2016, doi: 10.1111/mmi.13403
A novel flagellar sheath protein, FcpA, determines filament coiling, translational motility and virulence for the Leptospira spirochete
Author et al.,
1Department of Epidemiology of Microbial Disease, Yale School of Public Health, New Haven, CT 06520, USA.
2Gonc?alo Moniz Research Center, Oswaldo Cruz Foundation, Brazilian Ministry of Health, Salvador, Bahia 40296-710, Brazil
... For complementation, the fcpA gene with its native promoter
region (a 400bp-region upstream the start codon as identified by the Softberry software; http://linux1.softberry.
com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)
Applied and environmental microbiology
2016, 82(6), 1789-1798. doi: 10.1128/AEM.03526-15
A 1, 3-1, 4-b-Glucan Utilization Regulon in Paenibacillus sp. Strain JDR-2
Chow, V. et al.,
aDepartment of Microbiology and Cell Science, University of Florida, Gainesville, Florida, USA
bInstitute for Microbial and Biochemical Technology, Forest Products Laboratory, USDA Forest Service, Madison, Wisconsin, USA
... Bioinformatic analyses by BPROM software (SoftBerry) and ARNold software (http://rna.igmors.
u-psud.fr/toolbox/arnold/index.php) identified putative promoters and terminators within the
genome sequence that includes the bgl16A 1 and bg16lA 2 genes and adjacent genes ...
Applied microbiology and biotechnology
June 2016, Volume 100, Issue 12, pp 5467–5477 DOI: 10.1007/s00253-016-7354-6
New tools for chloroplast genetic engineering allow the synthesis of human growth hormone in the green alga Chlamydomonas reinhardtii
Wannathong, T., Waterhouse, J. C., Young, R. E., Economou, C. K., Purton, S.
Department of Biology, Faculty of ScienceSilpakorn University
Algal Research Group, Institute of Structural and Molecular BiologyUniversity College London
... Promoter prediction software, softberry BPROM, indicates a possible –35 element (TTGTAA) upstream of the –10 element. ...
Journal of biosciences
2016, 41(2), 193-203. DOI: 10.1007/s12038-016-9608-y
In situ real-time evaluation of radiation-responsive promoters in the extremely radioresistant microbe Deinococcus radiodurans
Anaganti, N., Basu, B., Apte, S. K.
1. Molecular Biology Division, Bhabha Atomic Research Centre, Mumbai, 400 085, India
.. start site in D. radiodurans in 500bp upstream DNA
sequence of selected ORFs was carried out by using software ( http://www.fruitfly.org/seq_tools/
promoter.html ) (Reese 2001) or BPROM software ( http://linux1.softberry.com/berry ...
Journal of molecular biology
2016, 428(2), 477-491. doi:10.1016/j.jmb.2015.12.010
The gene transfer agent RcGTA contains head spikes needed for binding to the Rhodobacter capsulatus polysaccharide cell capsule
Westbye, A. B., Kuchinski, K., Yip, C. K., Beatty, J. T.
1 Department of Microbiology and Immunology, The University of British Columbia, Vancouver, BC, Canada V6T 1Z3
2 Department of Biochemistry and Molecular Biology, The University of British Columbia, Vancouver, BC, Canada V6T 1Z3
... 1) was predicted using Softberry ¶
BPROM [28], and a segment of DNA containing 355 bp 5? of the annotated start codon, including
this putative promoter, was found to initiate transcription after fusion to lacZ ...
PloS one
2016, 11(7), e0158447 doi: 10.1371/journal.pone.0158447
Promoter Screening from Bacillus subtilis in Various Conditions Hunting for Synthetic Biology and Industrial Applications
Song, Y. et al.,
Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China, Key Laboratory of Systems Microbial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China
... We selected seven strongest promoter candidates and predicted
the -35, -10 elements and the lengths of the spacers (Fig 3A) using Softberry Inc.,
(http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Journal of applied microbiology
2016, 120(1), 126-137.
Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001
Zhang, C., Guo, T., Xin, Y., Gao, X., Kong, J.
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China
... Promter prediction was
performed by the online available program neural network promoter prediction (http://www.fruitfly.
org/seq_tools/promoter.html) and softberry bprom (http://linux1.softberry.com/berry ...
PloS one
2016, 11(7), e0159408. doi: 10.1371/journal.pone.0159408
Identification of Preferred DNA-Binding Sites for the Thermus thermophilus Transcriptional Regulator SbtR by the Combinatorial Approach REPSA
Van Dyke, M. W. et al.,
Department of Chemistry and Biochemistry, Kennesaw State University, Kennesaw, Georgia, United States of America Department of Molecular and Cellular Biology, Kennesaw State University, Kennesaw, Georgia, United States of America
...Sequences ±200 bp of the genomic SbtR site was analyzed using both Softberry BPROM and University of Groningen PePPER to identify potential promoters [49,50]. ...
Journal of Biotechnology
2016, 233, 17-25. doi:10.1016/j.jbiotec.2016.06.024
Rex in Clostridium kluyveri is a global redox-sensing transcriptional regulator
Hu, L. et al.,
a State Key Laboratory of Microbial Technology, School of life science, Shandong University, Jinan, People’s Republic of China
b Institute of Basic Medicine, Shandong Academy of Medical Science, Jinan, People’s Republic of China
...
To predict promoter, we used the software as follows: BPROM (Softberry, Inc, NY, USA ...
Applied microbiology and biotechnology
2016, 100(3), 1501-1510. DOI: 10.1007/s00253-015-7124-x
Metabolic potential of Bacillus subtilis 168 for the direct conversion of xylans to fermentation products
Rhee, M. S. et al.,
Xycrobe Therapeutics, Inc, College of ForestryNorthwest A&F University, Department of Microbiology and Cell Science, IFASUniversity of Florida
... Using BPROM (Softberry) to identify sequences qualifying as potential promoters, a single
promoter with ?35 and ?10 elements was identified upstream from a transcriptional start site 301
bp upstream of the sequence for a ribosomal binding site and 331 bp upstream of an ATG ...
Toxins
2016, 8(4), 113. doi:10.3390/toxins8040113
Identification and Characterization of the HicAB Toxin-Antitoxin System in the Opportunistic Pathogen Pseudomonas aeruginosa
Li, G. et al.,
Department of Microbiology, Third Military Medical University, Chongqing 400038, China
... The putative promoter and terminator were predicted by BPROM (http://linux1.softberry.com/berry.
phtml) and FindTerm (http://www.softberry.com/berry.phtml?topic=findterm&group=
programs&subgroup=gfindb), respectively. 4.3. DNA Extraction, RNA Purification and RT-PCR. ...
Microbiology
2016, 162(5), 777-788. doi: 10.1099/mic.0.000270
Regulation and production of Tcf, a cable-like fimbriae from Salmonella enterica serovar Typhi
Leclerc, J. M. et al.,
1? Department of Microbiology, Infectiology and Immunology, Universite de Montreal,CP 6128 Succursale Centre-Ville, Montreal, Quebec H3C 3J7,Canada 2? INRS-Institut Armand-Frappier,531 boulevard des Prairies, Laval, Quebec H7V 1B7,Canada
... tcfA promoter region was performed. Putative binding sites for H-NS, RcsB, Fur and
ArgR were identified using the bacterial promoter analysis software Softberry Bprom
(www.softberry.com) (Fig. 4a). Putative regulation by the ...
Microorganisms
2016, 4(1), 3. doi:10.3390/microorganisms4010003
In Silico Analysis of a Novel Plasmid from the Coral Pathogen Vibrio coralliilyticus Reveals Two Potential "Ecological Islands"
Wachter, J., Hill, S. A.
Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA
... Enzyme restriction sites were identified with the NEBcutter V2.0 tool made available through
New England Biolabs [21]. Putative promoters for each orf were identified using BPROM available
on Softberry [22]. tRNAs were identified using the tRNAscan-SE program [23]. ...
Biotechnology and Bioprocess Engineering
2016, 21(1), 68-78. DOI: 10.1007/s12257-015-0618-7
Explored a cryptic plasmid pSXM33 from Shewanella xiamenensis BC01 and construction as the shuttle vector
Zhou, Y., Ng, I. S.
1. Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361-005, China
2. Department of Chemical Engineering, National Cheng Kung University, Tainan, 70101, Taiwan
3. Research Center for Energy Technology and Strategy, National Cheng Kung University, Tainan, 70101, Taiwan
... edu.cn/ Ori-Finder/. Prediction of transcriptional promoters was carried out with a
Web-based BPROM program in http:// www.softberry.com/. The tandem repeats were
searched in http://www.loria.fr/mreps. Circular plasmid map ...
In Vitro Cellular & Developmental Biology-Animal
2016, 52(1), 77-88.DOI: 10.1007/s11626-015-9949-0
he Wolbachia WO bacteriophage proteome in the Aedes albopictus C/wStr1 cell line: evidence for lytic activity?
Baldridge, G. D. et al.,
Department of Entomology University of Minnesota Department of Biochemistry, Molecular Biology and BiophysicsUniversity of Minnesota
... Sequences of the non-coding 125-bp region upstream of WD0612 (A) and the 95-bp region downstream of WD0618 (B) were annotated using
Softberry BPROM prediction (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb; Solovyev and Salamov 2011). ...
Journal of Molecular Catalysis B: Enzymatic
2016, 130, 1-8. doi:10.1016/j.molcatb.2016.04.002
Gene cloning, expression and characterization of a novel cold-adapted protease from Planococcus sp
Zhang, H. et al.,
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, College of Bioengineering, Tianjin University of Science & Technology, Tianjin 300457, PR China
... The sequence assembly was performed using the Vector NTI software (Invitrogen). The promoter
and RBS sites were predicted using the online software of BPROM (http://linux1.softberry.com/
berry.phtml). Alignments of multiple sequences were performed using ClustalX. ...
Microbial cell factories
2016, 15(1), 1. DOI: 10.1186/s12934-016-0448-0
Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum
Heiss, S. et al.,
Christian Doppler Laboratory for Genetically Engineered Lactic Acid Bacteria, Department of Biotechnology, University of Natural Resources and Life Sciences
... codon. The ?35 and ?10 promoter region were identified (SoftBerry, BPROM) and
are underlined. Primer binding sites for negative controls (for construction of negative
controls without promoter) are underlined in dashed line. ...
PloS one
2016, 11(2), e0148221. http://dx.doi.org/10.1371/journal.pone.0148221
The Symbiotic Performance of Chickpea Rhizobia Can Be Improved by Additional Copies of the clpB Chaperone Gene
Paco, A., Brigido, C., Alexandre, A., Mateos, P. F., Oliveira, S.
ICAAM–Instituto de Ciencias Agrarias e Ambientais Mediterranicas (Laboratorio de Microbiologia do Solo), Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002–554, Evora, Portugal
Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002–554, Evora, Portugal, IIFA–Instituto de Investigacao e Formacao Avancada, Universidade de Evora, Ap. 94, 7002–554, Evora, Portugal
... The identification of the putative promoter and terminator regions was previously performed using
BPROM-Prediction of bacterial promoters software (http://www.softberry.com) and ARNold Finding
Terminators at IGM—Web Server (http://rna.igmors.u-psud.fr/toolbox/arnold ...
PloS one
2016, 11(3), e0150234. http://dx.doi.org/10.1371/journal.pone.0150234
Characterization of salA, syrF, and syrG Genes and Attendant Regulatory Networks Involved in Plant Pathogenesis by Pseudomonas syringae pv. syringae B728a
Vaughn, V. L., Gross, D. C.
Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas, United States of America
... Computer analysis. Nucleotide sequences that were 100-bp upstream of identified
transcriptional start sites were analyzed using the Softberry Bprom algorithm
(http://linux1.softberry.com/berry.phtml) to identify putative ? 70 -dependent promoters. ...
Frontiers in microbiology
2016, 7: 146. doi: 10.3389/fmicb.2016.00146
Characterization of Vibrio fluvialis qnrVC5 gene in native and heterologous hosts: Synergy of qnrVC5 with other determinants in conferring quinolone resistance
Vinothkumar, K., Kumar, G. N., Bhardwaj, A. K.
1Molecular Biology of Diseases, Department of Human Health and Diseases, School of Biological Sciences and Biotechnology, Indian Institute of Advanced Research, Gandhinagar, India
2Department of Bio-Chemistry, Faculty of Science, The Maharaja Sayajirao University of Baroda, Vadodara, India
... Softberry-BPROM, a promoter prediction tool was used to find the promoters and other regulatory
elements in qnrVC5 gene cassette 3 . The structure of QnrVC5 was predicted by I-TASSER server
using automated mode, as it employs hierarchical method for protein structure ...
PloS one
2016, 11(5), e0155397. http://dx.doi.org/10.1371/journal.pone.0155397
Regulation of Motility and Phenazine Pigment Production by FliA Is Cyclic-di-GMP Dependent in Pseudomonas aeruginosa PAO1
Lo, Y. L. et al.,
Institute of Molecular Medicine, National Tsing Hua University, Hsin Chu, Taiwan Molecular Infectious Disease Research Center, Division of Pediatric Infectious Diseases, Department of Pediatrics, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan
... Restriction sites and oligonucleotide primer sequences were identified using Vector NTI Advance ®
software (Invitrogen). Promoter regions were predicted using BPROM software (Softberry, Inc).
Flagellar observation through transmission electron microscopy. ...
BMC genomics
2016, 17:47. DOI: 10.1186/s12864-016-2376-0
Discovery and profiling of small RNAs responsive to stress conditions in the plant pathogen Pectobacterium atrosepticum
Kwenda, S. et al.,
Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria Kazan Institute of Biochemistry and Biophysics, Kazan Scientific Center, Russian Academy of Sciences
Division of Plant Sciences, College of Life Sciences, University of Dundee (at The James Hutton Institute)
... and fundamental types of the detected 3? UTR sRNAs based on their biogenesis, we extracted
each sRNA sequence plus 200 nt upstream of the start position of each sRNA and performed
promoter predictions using BPROM program (http://?www.?softberry.?com/?berry ...
Journal of applied microbiology
2016, 120(1), 126-137. DOI: 10.1111/jam.12990
Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001
Zhang, C., Guo, T., Xin, Y., Gao, X., Kong, J.
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China
... Promter prediction was performed by the online available program neural network promoter
prediction (http://www.fruitfly.org/seq_tools/promoter.html) and softberry bprom (http://linux1.
softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Biochemistry and Biophysics Reports
2016, 6, 124-134. doi:10.1016/j.bbrep.2016.03.012
Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression
Rajasree, K., Fasim, A., Gopal, B.
Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560012, India
... the identification of the P1 promoter between the PvuII and RsaI restriction sites in the agr operon
[3]. The region between these two restriction sites was used as an input sequence for the BPROM
server, a web-based bacterial promoter prediction server, (Softberry, Inc., Mount ...
Frontiers in microbiology
2016, 7: 545. doi: 10.3389/fmicb.2016.00545
Genomics of three new bacteriophages useful in the biocontrol of Salmonella
Bardina, C. et al.,
Departament de Genetica i de Microbiologia, Molecular Microbiology, Universitat Autonoma de Barcelona, Barcelona, Spain
... Potential promoter regions and transcription terminators were predicted using the
Softberry programs BProm (http://linux1.softberry.com/berry.phtml), FindTerm (Solovyev
and Salamov, 2011), and TransTerm (Ermolaeva et al., 2000). ...
FEBS open bio
2015, 5, 813-823. doi:10.1016/j.fob.2015.09.004
House dust mites possess a polymorphic, single domain putative peptidoglycan d, l endopeptidase belonging to the NlpC/P60 Superfamily
Tang, V. H., Stewart, G. A., Chang, B. J.
Microbiology & Immunology, School of Pathology and Laboratory Medicine, The University of Western Australia, Crawley, WA, Australia
... sequences were analysed for the presence of prokaryotic promoters using the Neural Network
Promoter Prediction (NNPP) program at the Berkeley Drosophila Genome Project (BDGP)
(www.fruitfly.org/seq_tools/promoter.html) and the program Softberry BPROM (Softberry, Inc ...
Genetics and molecular research: GMR
2015, 14(1), 190. DOI http://dx.doi.org/10.4238/2015.January.16.2
Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii
Zhang, J., Liu, X., Li, X. J.
1Department of Geriatrics Medicine,
The Third People’s Hospital of Chongqing, Chongqing, China
2Department of General Internal Medicine, The First Brand,
The First Affiliated Hospital of Chongqing Medical University,
Chongqing, China
... Transcription terminators in the phage AB3 genome were predicted using the FindTerm program
available from Softberry and promoters in the phage AB3 genome were predicted using the
BPROM program on the Softberry website (linux1. softberry.com/berry.phtml). ...
Journal of bacteriology
2015, 197(2), 354-361. 4doi: 10.1128/JB.01948-14
The Putative Eukaryote-Like O-GlcNAc Transferase of the Cyanobacterium Synechococcus elongatus PCC 7942 Hydrolyzes UDP-GlcNAc and Is Involved in Multiple Cellular Processes
Sokol, K. A., Olszewski, N. E.
aDepartment of Genetics, Cell Biology, and Development, University of Minnesota, Saint Paul, Minnesota, USA
bDepartment of Plant Biology, University of Minnesota, Saint Paul, Minnesota, USA
... two (NSII) of the ?ogt strain. The Softberry bacterial promoter prediction software
BPROM (Softberry, Inc., Mount Kisco, NY) predicts that the SeOGT promoter is 293
bp upstream of the start codon. Wild-type SeOGT with 697 ...
PloS one
2015, 10(7), e0131676. DOI: 10.1371/journal.pone.0131676
Structure and Assembly of TP901-1 Virion Unveiled by Mutagenesis
Stockdale et al.,
School of Microbiology, University College Cork, Western Road, Cork, Ireland
Department of Food Biosciences, Teagasc Food Research Centre, Moorepark, Fermoy, Co. Cork, Ireland
... BLAST, Pfam and HHpred analyses were used for functional annotations of proteins
[61–64]. Putative promoter sequences of NZ9000 prophage t712 were identified using
SoftBerry BPROM (http://www.softberry.com). Significant ...
PloS one
2015, 10(1). DOI: 10.1371/journal.pone.0116611
Genetic Acquisition of NDM Gene Offers Sustainability among Clinical Isolates of Pseudomonas aeruginosa in Clinical Settings
Mishra et al.,
Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, 221005, India
Department of Biotechnology and Bioinformatics, North Eastern Hill University, Shillong, Meghalaya, India
... (http://www.ncbi.nlm.nih.gov/BLAST/). Further, promoter sites were also determined by using
SoftBerry BPROM software (http://linux1.softberry.com/berry.phtml??topic=bprom&group=
programs&subgroup=gfin?db). Results. Genetic context of bla NDM. ...
Journal of Applied Microbiology
2015 DOI: 10.1111/jam.13036
Occidiofungin is an Important Component Responsible for the Antifungal Activity of Burkholderia pyrrocinia Strain Lyc2
Wang, X. Q. et al.,
Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai'an, Shandong, China
Collaborative Innovation Centre for Annually High Yield and High Efficiency Production of Wheat and Corn, Shandong Agricultural University, Tai'an, Shandong, China
... Biosciences, Carlsbad, CA) and Geneious R8 (Biomatters Ltd.). Open reading frames (ORFs)
and genes were predicted by the Softberry FGENESH program (Salamov and Solovyev ... prediction
was accomplished using the web-based software BRROM in the Softberry Page 9. ...
International journal of bioinformatics research and applications
2015, 11(4), 347-365. DOI: http://dx.doi.org/10.1504/IJBRA.2015.070140
Opposite nucleotide usage biases in different parts of the Corynebacterium diphtheriae spaC gene
Khrustalev, V. V., Barkovsky, E. V., Kolodkina, V. L., & Khrustaleva, T. A.
... We used three methods for promoter prediction: the 'BPROM' available via the SoftBerry
server (http://linux1.softberry.com); the 'NNPP' program (http://fruitfly.org/ seq_tools/promoter.
html) (Reese, 2001); the 'PromPredict' (http://nucleix.mbu.iisc. ...
Infection and immunity
2015, 83(9), 3497-3505. doi: 10.1128/IAI.00597-15
Expression of the oligopeptide permease operon of Moraxella catarrhalis is regulated by temperature and nutrient availability
Jones, M. M., Murphy, T. F.
aDepartment of Microbiology and Immunology, University at Buffalo, The State University of New York, Buffalo, New York, USA
bClinical and Translational Research Center, University at Buffalo, The State University of New York, Buffalo, New York, USA
... We identified a putative promoter region, using SoftBerry BPROM bacterial promoter prediction
software (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=
gfindb), in the 204-bp intergenic region between oppF and oppA. ...
Gene
2015, 564(1), 81-86. doi:10.1016/j.gene.2015.03.044
Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC
Cerveau, N. et al.,
a Universite de Poitiers, UMR CNRS 7267 Ecologie et Biologie des Interactions, Equipe Ecologie Evolution Symbiose, 5 Rue Albert Turpin, 86073 Poitiers Cedex 9, France
b Department of Biology, University of Copenhagen, 2200N Copenhagen, Denmark
... 2.2. Bioinformatics analyses. To identify ? 35/? 10 box promoters, the nucleotide
sequence of each IS copy was analyzed using the BPROM software from the SoftBerry
suite (http://linux1.softberry.com/berry.phtml?topic=bprom&gro.
PloS one
2015, 10(7), e0131695. DOI: 10.1371/journal.pone.0131695
Bioinformatic Analysis of Chlamydia trachomatis Polymorphic Membrane Proteins PmpE, PmpF, PmpG and PmpH as Potential Vaccine Antigens
Nunes, A., Gomes, J. P., Karunakaran, K. P., Brunham, R. C.
Bioinformatics Unit, Department of Infectious Diseases, National Institute of Health, Lisbon, Portugal
Vaccine Research Laboratory, University of British Columbia Centre for Disease Control, Vancouver, Canada
... For each operon, in silico promoter predictions were made by using both the Neural Network
Promoter Prediction (NNPP, http://www.fruitfly.org/seq_tools/promoter.html) and the BPROM
software (Softberry, http://linux1.softberry.com/berry.phtml?topic=bprom&group ...
Journal of microbiological methods, 118, 75-77.
2015, 118, 75-77. doi:10.1016/j.mimet.2015.08.016
An improved Tn7-lux reporter for broad host range, chromosomally-integrated promoter fusions in Gram-negative bacteria
Glassing, A., Lewis, T. A.
Department of Biological and Physical Sciences, Montana State University Billings, Billings, MT 59101, United States
... A scan of that sequence using a bacterial promoter-finding software (BPROM, Softberry, Inc.)
found a potential promoter within that region (nt 2338 of GenBank accession #AY962893.1).
We attempted cloning of bacterial promoters into pUC18-mini-Tn7T-Gm-lux using an XcmI ...
Bone & Joint Journal Orthopaedic Proceedings Supplement
2015, 97(SUPP 15), 38-38
THE STRUCTURE AND THE ROLE OF SDR REGION OF STAPHYLOCOCCUS AUREUS GENE IN BONE INFECTIONS
Sitkiewicz, I., Babiak, I.
1Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Warsaw, Poland
2Department of Orthopedics and Traumatology, Medical University of Warsaw, Warsaw, Poland
... The presence of putative promoters and transcriptional organization of the sdr region was detected
using BPROM and FGENESB algorithms (www.softberry.com) based on region 611262bp-
623152bp (GeneBank number CP000730.1) of the Staphylococcus aureus subsp. ...
Food Science and Biotechnology
2015, 24(5), 1749-1753. DOI: 10.1007/s10068-015-0227-4
Prediction and identification of an acid-inducible promoter from Lactococcus lactis ssp. cremoris MG1363
Yu, H. et al.,
1. Laboratory of Food Safety and Molecular Biology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083, China
2. The Supervision, Inspection & Testing Center of Genetically Modified Organisms, Ministry of Agriculture, Beijing, 100083, China
... cremoris MG1363 (16). In addition, the online promoter prediction tools: Neural Network Promoter
Prediction (http:// www.fruitfly.org/seq tools/promoter.html) and SofeBerry (http:// linux1.softberry.
com/berry.phtml?topic=bprom&group=programs& subgroup=gfindb) were used. ...
FEMS microbiology letters
2014, 353(2), 98-105. DOI:10.1111/1574-6968.12411
The pqqC gene is essential for antifungal activity of Pseudomonas kilonensis JX22 against Fusarium oxysporum f. sp. lycopersici
Xu, J. et al.,
1 Key Laboratory of Control Technology and Standard for Agro-product Safety and Quality, Ministry of Agriculture/Jiangsu Academy of Agricultural Sciences, Nanjing, China
2 Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS, USA
... Promoter prediction was conducted using the web-based software bprom in the Softberry package
(Solovyev & Salamov, 2011). Illumina sequencing was used to determine the pqq gene cluster
of P. kilonensis JX22, as described previously (Jalan et al., 2011). ...
Microbiology
2014, 160(Pt 1), 102-112. DOI:10.1099/mic.0.070664-0
OxyR-dependent expression of a novel glutathione S-transferase (Abgst01) gene in Acinetobacter baumannii DS002 and its role in biotransformation of organophosphate insecticides
Longkumer, T., Parthasarathy, S., Vemuri, S. G., Siddavattam, D.
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad 500 046, India
... ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict ORFs
and bprom software (http://linux1.softberry.com/berry.phtml?topic=bprom&group=
programs&subgroup=gfindb) was used for promoter predictions. ...
ACS synthetic biology
April 4, 2014 DOI:10.1021/sb4001189
A synthetic anhydrotetracycline-controllable gene expression system in Ralstonia eutropha H16
Li H., Liao J. C.
†Department of Chemical and Biomolecular Engineering, ‡The Molecular Biology Institute, §Department of Chemistry & Biochemistry, Institute of Genomics and Proteomics, University of California, Los Angeles, California 90095, United States
... Using the bioinformatic tool (BPROM, Softberry), we identified the putative ?10 and ?35 elements
of the P rrsC and the transcriptional start site (Figure 1A). There are two different tetO operators
(tetO1 and tetO2) that can both be recognized by the tetR repressor.(13) We took a ...
Annals of Microbiology
2014, 64(2), 809-814. DOI: 10.1007/s13213-013-0717-7
Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage
Fu, Y., Zhai, Z., An, H., Hao, Y.
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China
... DNASTAR software package was employed to detect direct and inverted repeats.
Putative promoter and terminator predictions were analyzed with BPROM and
FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...
International journal of food microbiology
2014, 177, 89-97. DOI: 10.1016/j.ijfoodmicro.2014.02.011
Response of S. thermophilus LMD-9 to bacitracin: Involvement of a BceRS/AB-like module and of the rhamnose–glucose polysaccharide synthesis pathway
Thevenard B. et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
... The presence of putative promoters, terminators, and operons was evaluated using BPROM
(http://linux1.softberry.com/berry.phtml), BDGP (http://www.fruitfly.org/seq_tools/promoter.html),
FINDTERM (http://linux1.softberry.com/berry.phtml), TranstermHP (http://transterm.cbcb ...
Microbiology
2014, 160(Pt 2), 406-417. DOI: 10.1099/mic.0.074773-0
Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors, and its expression is controlled by NtrC and PhoB acting at two interspaced promoters
Gallarato L. A. et al.,
1Departamento de Biologia Molecular, FCEFQyN, Universidad Nacional de Rio Cuarto, Ruta 36-Km 601, (5800) Rio Cuarto, Cordoba, Argentina
2Departamento de Ingenieria Celular y Biocatalisis, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos 62210, Mexico
... 1999). prodoric was used to determine the integration host factor (IHF) consensus
(Munch et al., 2003). The bprom tool from the SoftBerry server (http://linux1.softberry.
com) was used to identify ? 70 -dependent promoters. NtrC ...
PloS one
2014, 9(2), e90087. DOI: 10.1371/journal.pone.0090087
New Hydrocarbon Degradation Pathways in the Microbial Metagenome from Brazilian Petroleum Reservoirs
Sierra-Garcia I. N. et al.,
Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas - UNICAMP, Campinas, Brazil
Laboratory of Genomics and Expression, University of Campinas - UNICAMP, Campinas, Brazil
... several tools available for gene prediction in prokaryotes through heuristic approaches: Metagene
[14] http://metagene.cb.ku-tokyo.ac.jp/) and MetaGeneMark [15] designed for metagenomic
sequences, GLIMMER 3.02 [16], [17] and FGENESB (http://linux1.softberry.com/berry ...
...Putative ribosomal binding sites were identified using RBSFINDER [22], and the presence
of bacterial promoters and transfer RNA genes was predicted using the programs
BPROM (http://linux1.softberry.com/berry.phtml) and tRNAscan-SE [23], respectively.
...
Plasmid
Volume 74, July 2014, Pages 32–38 DOI: 10.1016/j.plasmid.2014.05.003
Construction of a Novel Inducible Expression Vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21.
Maidin M. S. T. et al.,
a Department of Cell and Molecular Biology, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
b Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
... The potential Pribnow box and -35 site of P hsp were predicted with BPROM (Softberry, USA),
an online bacterial ? 70 promoter (major E. coli promoter class) recognition program with about
80% accuracy and specificity that can be accessed freely at (http://linux1.softberry.com ...
Journal of proteomics
2014, 108, 78-88. DOI: 10.1016/j.jprot.2014.05.005
Phosphate regulated proteins of Xanthomonas citri subsp. citri: A proteomic approach
Pegos, V. R., Nascimento, J. F., Sobreira, T. J. P., Pauletti, B. A., Paes-Leme, A., & Balan, A.
a Laboratorio Nacional de Biociencias — LNBio, Centro de Pesquisas em Energia e Materiais — CNPEM, Campinas, SP, Brazil
b Universidade Estadual de Campinas — UNICAMP, Instituto de Biologia, Campinas, SP, Brazil
... the promoter regions of the X. citri Pho regulon genes, we submitted a sequence of 100
nucleotides upstream of the start codon of isolated genes or from the first gene belonging to an
operon, to the bacterial promoter prediction programme BPROM from the SoftBerry server (http ...
PloS one
2014, 9(3), e90603. Volume DOI: 10.1371/journal.pone.0090603
Analysis of the Promoters Involved in Enterocin AS-48 Expression
Cebrian R et al.,
Departamento de Microbiologia, Facultad de Ciencias, Universidad de Granada, Granada, Spain
... as-48 or bac regions (GenBank KJ146793 and Y12234.1, and D85752.1, respectively [9], [6])
were analysed with the bioinformatic programs Promoter Prediction by Neural Network (NNPP)
[31] (http://s.fruitfly.org/seq_tools/promoter?.html) and BPROM (Softberry Inc., Mount ...
Nature communications
2014 , 5. Article number: 4076 DOI: 10.1038/ncomms5076
Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population
Bailey, S. F., Hinz, A., Kassen, R.
Department of Biology, University of Ottawa, Ottawa, Ontario, Canada K1N 6N5
... Bent arrows indicate promoters predicted by the Softberry BPROM program (
http://linux1.softberry.com/berry.phtml). ...
Microbiology
February 2013 vol. 159 no. Pt 2 230-242 DOI:10.1099/mic.0.061614-0
A CsrA/RsmA translational regulator gene encoded in the replication region of a Sinorhizobium meliloti cryptic plasmid complements Pseudomonas fluorescens rsmA/E mutants
Betina Agaras †, Patricio Sobrero † and Claudio Valverde
Laboratorio de Bioquimica, Microbiologia e Interacciones Biologicas en el Suelo, Departamento de Ciencia y Tecnologia, Universidad Nacional de Quilmes, Roque Saenz Pena 352 – Bernal B1876BXD – Buenos Aires, Argentina
... The rsmA Sm coding sequence is shaded in dark grey. The sequence of the divergently encoded
ORF II gene is shaded in light grey. Putative ? 70 -dependent promoters (boxed) were identified
via the Softberry Bprom algorithm (http://linux1.softberry.com/berry.phtml). ...
PLOS ONE
February 08, 2013DOI: 10.1371/journal.pone.0056321
Generation of an Artificial Double Promoter for Protein Expression in Bacillus subtilis through a Promoter Trap System
Yang et al.,
College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi Province, People's Republic of China
Department of Animal Science, McGill University, Quebec, Canada
... The sequence analysis was performed online with NCBI blast 2.0 (www.ebi.ac.uk);
promoter region was predicted by the BPROM program (Softberry Inc., Mount Kisco, NY,
USA; http://linux1.softberry.com). Sub-cloning of promoter regions. ...
Microbiology
January 2013 vol. 159 no. Pt 1 96-106 DOI:10.1099/mic.0.062349-0
Transcriptional regulation of the Rhodobacter capsulatus response regulator CtrA
Molly M. Leung †, Cedric A. Brimacombe and J. Thomas Beatty
Department of Microbiology and Immunology, The University of British Columbia, 2350 Health Sciences Mall, Vancouver, BC V6T 1Z3, Canada
... Promoter sequence analysis, RNA 5?end-mapping and ?-galactosidase assays. Analysis of
sequences for putative promoter –10 and –35 sites was done using the Softberry bacterial
promoter prediction computer program BPROM (http://www.softberry.com/all.htm). ...
PloS one
February 13, 2013DOI: 10.1371/journal.pone.0056063
A Two-Component System (XydS/R) Controls the Expression of Genes Encoding CBM6-Containing Proteins in Response to Straw in Clostridium cellulolyticum
Celik et al.,
Aix-Marseille Universite, CNRS, UMR7283, Marseille, France
Institut fur Mikrobiologie, Ernst-Moritz-Arndt Universitat, Greifswald, Germany
... D) Genetic organization of xydS/R and xyl-doc genes as in (A) with schematic localizations of
promoters (thin arrow) and terminators (stem-loop) predicted by BPROM and FindTerm programs
(http://linux1.softberry.com). doi:10.1371/journal.pone.0056063.g001. ...
F1000Research
2013, 2:99 (doi: 10.12688/f1000research.2-99.v1
Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [v1; ref status: approved with reservations 2, http://f1000r.es/p3]
Erica L Fonseca, Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil - See more at: http://f1000research.com/articles/2-99#sthash.epID3u3g.dpuf
... The 5'UTR from gcu14 were submitted to the promoter predictor programs Neural Network for
Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/
index.html) and BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml). ...
PloS one
October 16, 2013 DOI: 10.1371/journal.pone.0076685
The Global Anaerobic Regulator Anr, Is Involved in Cell Attachment and Aggregation Influencing the First Stages of Biofilm Development in Pseudomonas extremaustralis
Paula M. Tribelli, Anthony G. Hay, Nancy I. Lopez
IQUIBICEN-CONICET and Dpto. de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina
Department of Microbiology, Cornell University, Ithaca, New York, United States of America
... support [37], and in an intergenic genomic zone. Putative ? 70 dependent promoters
were identified using the Softberry Bprom algorithm (http://linux1.softberry.com/berry.
phtml). Sequence logos was performed using 5 Anr-boxes ...
Microbiology
September 2013 vol. 159 no. Pt 9 1911-1919 DOI: 10.1099/mic.0.064709-0
Identification and characterization of biofilm formation-defective mutants of Xanthomonas citri subsp. citri
Malamud et al.,
1Instituto de Ciencia y Tecnologia Dr Cesar Milstein, Fundacion Pablo Cassara, CONICET, Saladillo 2468, C1440FFX Ciudad de Buenos Aires, Argentina
2Embrapa Recursos Geneticos e Biotecnologia and Centro APTA Citros Sylvio Moreira, Instituto Agronomico de Campinas, Cordeiropolis, Sao Pablo, Brazil
... Tn5. An analysis was performed for each mutant, taking into account the relative
position of the transposon and the presence of promoter regions predicted by BProm
(Softberry, http://linux1.softberry.com/berry.phtml) (Fig. S2 ...
Microbiology
November 2013 mic.0.074773-0 DOI:10.1099/mic.0.074773-0
Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors and its expression is controlled by NtrC and PhoB, acting at two interspaced promoters.
Gallarato et al.,
1 Dep Biologia Molecular, FCEFQyN, Universidad Nacional de Rio Cuarto;
2 Dep Ingenieria Celular y Biocatalisis, Inst Biotecnologia, UNAM, Cuernavaca
... PRODORIC was used to determine the Integration 182 Host Factor (IHF) consensus (Munch
et al., 2003). The BPROM tool from the SoftBerry server 183 (http://linux1.softberry.com) was
used to identify ?70-dependent promoters. NtrC and PhoB 184 ...
Antimicrob. Agents Chemother.
July 2013 vol. 57 no. 7 3430-3433 DOI:10.1128/AAC.00515-13
SatR Is a Repressor of Fluoroquinolone Efflux Pump SatAB
Escudero et al.,
Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Madrid, Spaina
Centro de Vigilancia Sanitaria Veterinaria (VISAVET), Universidad Complutense de Madrid, Madrid, Spainb
... Positive results were obtained for both strains, proving that satR is part of the satRAB operon
(data not shown). Upstream from satRAB, we found two 9-bp pseudopalindromic regions
overlapping the predicted ?10 box (BPROM software; Softberry) (Fig. ...
Archives of Virology
Volume 158, Issue 11 , pp 2409-2413 DOI:10.1007/s00705-013-1726-3
Genome sequence analysis of the Vibrio parahaemolyticus lytic bacteriophage VPMS1
Martin Ramirez-Orozco, Vania Serrano-Pinto, Norma Ochoa-Alvarez, Roman Makarov, Sergio F. Martinez-Diaz
1. Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Instituto Politecnico Nacional, 195, Col. Playa Palo de Santa Rita Sur, 23096, La Paz, B.C.S, Mexico
2. Centro Interdisciplinario de Ciencias Marinas-IPN (CICIMAR), Av. Instituto Politecnico Nacional, s/n Col. Playa Palo de Santa Rita, 23096, La Paz, B.C.S, Mexico
... results were visually inspected. Results were taken as significant when e-values
were under 0.01. Promoter candidates were determined using the BPROM 0.3.2
software (Softberry, Mount Kisco, NY). A CD search to identify ...
BMC Biotechnol.
2013; 13: 25. DOI: 10.1186/1472-6750-13-25
Development of a Fur-dependent and tightly regulated expression system in Escherichia coli for toxic protein synthesis
Lingyu Guan, 1 Qin Liu, 1 Chao Li,1 and Yuanxing Zhang 1
1State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, P. R. China
... Its characteristic regions were demonstrated as the same result by three online promoter
prediction tools-Softberry, BDGP and SCOPE. ... PfhuA characteristic regions were predicted by
online tools: BPROM-bacterial promoter prediction program from Softberry ...
Tuberculosis
Volume 93, Issue 4, July 2013, Pages 389–397 DOI:10.1016/j.tube.2013.03.007
An insight into the regulation of mce4 operon of Mycobacterium tuberculosis
Rathor et al.,
a Department of Microbiology, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi 110007, India
b Medicinal Chemistry Division, Dr B.R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi 110007, India
... (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). To
know fidelity of these softwares, known promoter sequences of purC (Rv0780), katG (Rv1908c),
rpsl (Rv0682) and recA (Rv2737c) genes of M. tuberculosis were also analyzed. ...
Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7
Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage
Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China
... DNASTAR software package was employed to detect direct and inverted repeats.
Putative promoter and terminator predictions were analyzed with BPROM and
FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...
Biochemical and Biophysical Research Communications
Volume 435, Issue 1, 24 May 2013, Pages 28–33 DOI:10.1016/j.bbrc.2013.04.017
Structural and genomic DNA analysis of a putative transcription factor SCO5550 from Streptomyces coelicolor A3(2): Regulating the expression of gene sco5551 as a transcriptional activator with a novel dimer shape
Hayashi et al.,
a Department of Food and Fermentation Science, Faculty of Food and Nutrition, Beppu University, Beppu 874-8501, Japan
b Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810, Japan
c Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Sapporo 062-8517, Japan
... 4A. The translational start site, putative ribosomal binding site (RBS), putative –10,
and –35 promoter elements of the sco5550 and sco5551 were found using the
bacterial promoter predictor BPROM program (SoftBerry, Mt. ...
J. Bacteriol. December
2013 vol. 195 no. 23 5370-5380 DOI:10.1128/JB.00615-13
The sll1951 Gene Encodes the Surface Layer Protein of Synechocystis sp. Strain PCC 6803
Christoph Trautner and Wim F. J. Vermaas
School of Life Sciences, Arizona State University, Tempe, Arizona, USA
... A possible ribosome-binding site (AGGAG) is located at bp ?19 from the start codon, whereas
the most probable ?10 and ?35 transcriptional signals, as predicted via BPROM (Softberry Inc.,
Mount Kisco, NY), appear to be distant at positions ?95 (TGCTATGAT) and ?114 ...
Appl. Environ. Microbiol.
February 2013 vol. 79 no. 4 1150-1159 DOI:10.1128/AEM.03556-12
Genomic Plasticity Enables a Secondary Electron Transport Pathway in Shewanella oneidensis
M. Schicklberger, G. Sturm and J. Gescher
Institute for Applied Biosciences (IAB), Department of Applied Biology, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany
... (35). Promoter prediction.The BPROM bacterial promoter predictor was used to identify
entire (?35/?10) putative promoter regions (SoftBerry, Mt. Kisco, NY). ... Analysis of the hybrid
region by use of bioinformatic tools (BPROM; SoftBerry, Mt. ...
PloS one
October 07, 2013DOI: 10.1371/journal.pone.0076630
Evolutionary Insight into the Functional Amyloids of the Pseudomonads
Morten S. Dueholm, Daniel Otzen, Per Halkj?r Nielsen
Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aarhus, Denmark
Interdisciplinary Nanoscience Center (iNANO), Centre for Insoluble Protein Structures (inSPIN), Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark
... to fapF. A promoter region containing -35 and -10 regions could be identified in front
of the lone fapF in Chromobacterium using the prokaryotic promoter prediction tool
Softberry-BPROM (http://linux1.softberry.com). No promoter ...
Biotechnology Letters
Volume 35, Issue 8 , pp 1331-1337 DOI:10.1007/s10529-013-1209-3
Expression of mosquito-larvicidal toxin genes under the control of a native promoter in Enterobacter amnigenus An11
Wachiraporn Toopaang, Boonsri Jongsareejit, Sumarin Soonsanga, Boonhiang Promdonkoy
1. Department of Microbiology, Faculty of Science, Silpakorn University, Nakhon Pathom, 73000, Thailand
2. National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, 113 Pahonyothin Road, Khlong Nueng, Khlong Luang, Pathum Thani, 12120, Thailand
... Promoter sequence of the inserted fragment was analyzed using BPROM
(http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/
promoter.html) programs. Measurement of GFP intensity. Enterobacter ...
PLoS Pathog
2013 June; 9(6): e1003428. DOI:10.1371/journal.ppat.1003428
A Novel Two-Component Signaling System Facilitates Uropathogenic Escherichia coli's Ability to Exploit Abundant Host Metabolites
Cai et al.,
1Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, Iowa, United States of America
2Laboratory Animal Resources, College of Veterinary Medicine, Iowa State University, Ames, Iowa, United States of America
... The promoter regions of c5032 and c5038 were predicted by BProm program (http://linux1.softberry.com) [45]. . ...
Extremophiles
Volume 17, Issue 5 , pp 809-819 DOI:10.1007/s00792-013-0562-4
Characterization of a cold-adapted and salt-tolerant esterase from a psychrotrophic bacterium Psychrobacter pacificensis
Guojie Wu, Gaobing Wu, Tao Zhan, Zongze Shao, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
2. College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were
analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml), amino acid alignments
by BLASTP (http://www.ncbi.nlm.nih.gov/), and Signal peptide by the SignaIP 4.0 ...
American Journal of Bioinformatics Research
2013; 3(2): 11-20 doi:10.5923/j.bioinformatics.20130302.01
nsilico Analysis of Novel hipAB, ccdBA, and yoeB-yefM Toxin-Antitoxin Homolog’s from the Genome of Xenorhabdus nematophila
Jitendra Singh Rathore, Mahendra Pal Singh, Pradeep Gautam
School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, 201308, India
... 2.5. Promoter Analysis. Identification of putative pro- moters associated with ORFs was determined
by software BPROM (www.softberry.com). 2.6. Genomic DNA Isolation. X. nematophila culture
was inoculated from glycerol stock in 50 ml and grown overnight at 28?, 200 rpm. ...
Microbiology
May 2013 mic.0.066332-0 DOI:10.1099/mic.0.066332-0
A modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius
Jeremy Bartosiak-Jentys, Ali H. Hussein, Claire J. Lewis and David J. Leak1
University of Bath
... 113 A 293nt DNA fragment containing the cellobiose specific phosphotransferase system
operon's 114 promoter sequence (P?glu), predicted using BPROM software (SoftBerry), was
amplified using primers 115 SalI_P?glu_F and XmaI_ClaI_P?glu_R. ...
Biochemical Genetics
Volume 51, Issue 9-10 , pp 766-779 DOI:10.1007/s10528-013-9605-x
Molecular Characterization of a Fungicidal Endoglucanase from the Cyanobacterium Calothrix elenkinii
Chitra Natarajan, Vishal Gupta, Kanika Kumar, Radha Prasanna
1. Division of Microbiology, Indian Agricultural Research Institute, New Delhi, 110012, India
3. Centre for Cellular and Molecular Biology (CCMB), Council of Scientific and Industrial Research (CSIR), Hyderabad, 500007, Andhra Pradesh, India
2. National Research Centre for Plant Biotechnology, IARI, New Delhi, 110012, India
... For each sequence, SignalP-HMM reports the overall signal peptide probability, equal to the
posterior probability of signal peptide (S) for position 1. The bacterial promoter prediction program
BPROM (http://linux1.softberry.com/berry.html) was used to identify the position of the ...
Journal of Molecular Catalysis B: Enzymatic
Volume 98, 30 December 2013, Pages 119–126 DOI:10.1016/j.molcatb.2013.10.012
A novel esterase from a psychrotrophic bacterium Psychrobacter celer 3Pb1 showed cold-adaptation and salt-tolerance
Guojie Wu a, Shuo Zhang a, Houjin Zhang b, Shanshan Zhang a, Ziduo Liu a,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China
b School of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430070, PR China
... of the esterase-encoding gene, est12, was carried out by Basic Local Alignment Search Tool
(BLAST) program on the NCBI online database (http://www.ncbi.nlm.nih.gov), and the promoter
region was analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml ...
DNA Res
(2013) doi: 10.1093/dnares/dst050 First published online: November 25, 2013
Global Transcriptional Response to Heat Shock of the Legume Symbiont Mesorhizobium loti MAFF303099 Comprises Extensive Gene Downregulation
Ana Alexandre 1,2, Marta Laranjo 1,2 and Solange Oliveira 1
1ICAAM – Instituto de Ciencias Agrarias e Ambientais Mediterranicas (Laboratorio de Microbiologia do Solo), Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002-554 Evora, Portugal
2IIFA – Instituto de Investigacao e Formacao Avancada, Universidade de Evora, Ap. 94, 7002-554 Evora, Portugal
... MicrobesOnline Operon Predictions (www.micro-besonline.org/operons/) was used for operon
prediction. 36 The identification of putative promoter sequences was performed using
BPROM-Prediction of bacterial promoters software (www.softberry.com). ...
J. Bacteriol.
September 2013 vol. 195 no. 18 4264-4273 DOI:10.1128/JB.00471-13
Gene Content and Diversity of the Loci Encoding Biosynthesis of Capsular Polysaccharides of the 15 Serovar Reference Strains of Haemophilus parasuis
Howell et al.,
Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdoma
The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, United Kingdomb
... Each capsule locus was analyzed for the presence of promoters using BPROM (http://linux1.
softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), where the top scores
were found and mapped to within 150 bp preceding the start codon of each CDS of ...
Russian Journal of Genetics
Volume 49, Issue 5 , pp 477-486 DOI:10.1134/S1022795413050116
Organization and maintenance features of IncP-7 naphthalene degradation plasmid pFME5 basic replicon
O. V. Volkova, I. A. Kosheleva, A. M. Boronin
19806. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, 142290, Russia
29806. Pushchino State Educational Institute of Natural Sciences, Pushchino, 142290, Russia
... substituted nucleotides are underlined. Page 4. 480 RUSSIAN JOURNAL OF
GENETICS Vol. 49 No. 5 2013 VOLKOVA et al. SOSUI, and BPROM (Softberry)
software available online. RESULTS AND DISCUSSION pFME5 Basic ...
PloS one
January 28, 2013DOI: 10.1371/journal.pone.0054479
A Non-Classical LysR-Type Transcriptional Regulator PA2206 Is Required for an Effective Oxidative Stress Response in Pseudomonas aeruginosa
F. Jerry Reen, Jill M. Haynes, Marlies J. Mooij, Fergal O'Gara
BIOMERIT Research Centre, Department of Microbiology, University College Cork, Cork, Ireland
... Genome sequences were obtained from the www.pseudomonas.com resource [24] and compared
using the ARTEMIS Comparison Tool on the www.webact.org site [25]. Promoter predictions
were performed using BProm software on the http://linux1.softberry.com site. ...
mBio
doi: 10.1128/mBio.00366-13 27 August 2013 vol. 4 no. 5 e00366-13
Vibrio cholerae ToxR Downregulates Virulence Factor Production in Response to Cyclo(Phe-Pro)
X. Renee Bina, Dawn L. Taylor, Amit Vikram, Vanessa M. Ante, James E. Bina
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA
... encoding a hypothetical protein. Analysis of the leuO locus using BPROM promoter
prediction software (http://www.softberry.com) indicated the presence of a single
promoter upstream of VC2486. Consistent with this, VC2486 ...
Genome Biol Evol
(2013) 5 (2): 418-438. doi: 10.1093/gbe/evt008
Strikingly Bacteria-Like and Gene-Rich Mitochondrial Genomes throughout Jakobid Protists
Gertraud Burger 1,*, Michael W. Gray 2, Lise Forget 1 and B. Franz Lang 1
1Department of Biochemistry, Robert-Cedergren Center in Bioinformatics and Genomics, Universite de Montreal, Montreal, Quebec, Canada
2Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada
... Potential bacteria-like promoters were predicted with BPROM (http://linux1.softberry.com), which
was chosen among various public web-accessible predictors, because it yields for jakobid mtDNAs
a reasonable number (in the order of 200) of potential sites per genome, instead ...
PloS one
October 21, 2013DOI: 10.1371/journal.pone.0076030
Divergent Control of Two Type VI Secretion Systems by RpoN in Pseudomonas aeruginosa
Thibault G. Sana, Chantal Soscia, Celine M. Tonglet, Steve Garvis, Sophie Bleves
Laboratoire d’Ingenierie des Systemes Macromoleculaires (UMR7255), CNRS & Aix-Marseille Univ, Marseille, France
... 2C). The BProm algorithm identified one ? 70 dependent promoter upstream of the lip3 gene
and another, in the opposite direction, upstream of the hsiB3 gene (http://linux1.softberry.com/
berry.phtml??topic=bprom&group=programs&subgroup=gfin?db) (Fig. 2C). ...
BMC Genomics
2013, 14:73 doi:10.1186/1471-2164-14-73
Genomic analysis of the regulatory elements and links with intrinsic DNA structural properties in the shrunken genome of Buchnera
Lilia Brinza 123, Federica Calevro 1 and Hubert Charles 12
1 UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, INSA-Lyon, INRA, Universite de Lyon, Villeurbanne, France
2 BAMBOO, INRIA Rhone-Alpes, Montbonnot Saint-Martin, France
3 Present address: Universite de Lyon, Universite Lyon1, CNRS, UMR 5558, Laboratoire de Biometrie et Biologie Evolutive, Lyon, France
... Promoters and transcription starts were predicted, in the four Buchnera strains, using the
software BPROM © (http://linux1.softberry.com/berry.phtml webcite) and MacVector
(MacVector, Cary, NC, USA) for ? 70 and ? 32 promoters, respectively. ...
Microbiology
June 2013 vol. 159 no. Pt 6 1097-1108 DOI:10.1099/mic.0.065763-0
Identification of multiple putative S-layer genes partly expressed by Lysinibacillus sphaericus JG-B53
Lederer et al.,
1Helmholtz-Institute Freiberg for Resource Technology, Helmholtz-Zentrum Dresden-Rossendorf, 01314 Dresden, Germany
2Institute of Resource Ecology, Helmholtz-Zentrum Dresden-Rossendorf, 01314 Dresden, Germany
... Miller, 1991). The analyses of the promoter regions were performed with the program
BPROM (http://linux1.softberry.com/berry.phtml?topic=bprom&group=
programs&subgroup=gfindb; Solovyev & Shahmuradov, 2003). The ...
Microbiology
April 2013 vol. 159 no. Pt 4 737-747 DOI:10.1099/mic.0.064782-0
Type 1 and type 2 strains of Mycoplasma pneumoniae form different biofilms
Simmons et al.,
1Department of Genetics, University of Alabama at Birmingham, Birmingham, AL 35294, USA
2Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA
... Artemis (version 14.0.0; Wellcome Trust Sanger Institute). Promoter sequences were
analysed using bprom (Prediction of Bacterial Promoters; http://linux1.softberry.com).
The genome reference sequences for M. pneumoniae ...
Appl. Environ. Microbiol.
June 2013 vol. 79 no. 11 3494-3502 DOI:10.1128/AEM.03693-12
Identification and Expression of Genes Involved in the Conversion of Daidzein and Genistein by the Equol-Forming Bacterium Slackia isoflavoniconvertens
Christine Schroder a, Anastasia Matthies a, Wolfram Engst b, Michael Blaut a and Annett Braune a
Department of Gastrointestinal Microbiologya
Analytics Group,b German Institute of Human Nutrition Potsdam-Rehbruecke, Nuthetal, Germany
... blast). Searching for putative transcription promoter and terminator sequences was
done using the Web-based programs BPROM (Softberry, Mount Kisco, NY) and
ARNold (http://rna.igmors.u-psud.fr/toolbox/arnold), respectively. ...
J. Bacteriol.
April 2013 vol. 195 no. 7 1504-1514 DOI:10.1128/JB.01999-12
Identification of the Mutation Responsible for the Temperature-Sensitive Lipopolysaccharide O-Antigen Defect in the Pseudomonas aeruginosa Cystic Fibrosis Isolate 2192
Michael R. Davis Jr et al.,
aDepartment of Microbiology, Immunology, and Cancer Biology, University of Virginia Health Sciences Center, Charlottesville, Virginia, USA
bComplex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA
... The deletion in this strain was verified by PCR and sequencing. Promoter identification.An
approximately 1 kb sequence located directly 5? of the wbpM start codon was scanned for
promoters by using the neural network promoter prediction program BPROM (Softberry). ...
PloS one
October 02, 2013DOI: 10.1371/journal.pone.0076198
Pseudomonas putida AlkA and AlkB Proteins Comprise Different Defense Systems for the Repair of Alkylation Damage to DNA – In Vivo, In Vitro, and In Silico Studies
Mielecki et al.,
Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland
Department of Genetics, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia
... Also, the putative -35 and -10 boxes responsible for RNA polymerase interaction are
marked in pink (retrieved from RegulonDB, http://regulondb.ccg.unam.mx) or grey
(SoftBerry BPROM prediction tool, http://linux1.softberry.com). ...
Appl. Environ. Microbiol.
July 2013 vol. 79 no. 13 3967-3973 DOI:10.1128/AEM.00867-13
Biofilm Formation by Psychrobacter arcticus and the Role of a Large Adhesin in Attachment to Surfaces
Shannon M. Hinsa-Leasur a, Cassandra Koid a, James M. Tiedj b and Janna N. Schultzhaus a
Biology Department, Grinnell College, Grinnell, Iowa, USAa
Center for Microbial Ecology, Michigan State University, East Lansing, Michigan, USAb
... with 64 bp separating the two genes. Based on results of the sequence analysis
programs FGENESB and BPROM (SoftBerry), the Psyc_1602-encoding gene and
cat1 reside in an operon. Located 379 bp downstream of cat1 ...
AEM
01197-13 DOI:10.1128/AEM.01197-13
Lytic infection of Lactococcus lactis by bacteriophages Tuc2009 and c2 trigger alternative transcriptional host responses
Stuart Ainsworth 1, Aldert Zomer 2, Jennifer Mahony 1 and Douwe van Sinderen 1, 3
1Department of Microbiology, University College Cork, Western Road, Cork, Ireland
2Centre for Molecular and Biomolecular Informatics, Nijmegen Centre for Molecular Life Sciences, Radboud University Medical Centre, Nijmegen
3Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Western Road, Cork, Ireland
... orf10. Analysis using BPROM 208 (http://www.softberry.com/berry.html) suggests
a previously undetected promoter upstream of 209 orf10 (with proposed -35 and
(extended) -10 sequences that correspond to ATGTAT and 210 ...
Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 113, Issue 3 , pp 387-396 DOI:10.1007/s11240-012-0278-7
Plant tissue-specific promoters can drive gene expression in Escherichia coli
Jopcik et al.,
1. Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, P.O. Box 39A, 950 07, Nitra, Slovak Republic
2. Animal Production Research Centre, 951 41, Nitra, Slovak Republic
3. Constantine the Philosopher University, 949 74, Nitra, Slovak Republic
... elements and are capable to trigger gene expression in E. coli, we analyzed the sequences of
DNA fragments carrying the plant embryo- and/or pollen-specific promoters using the bacterial
sigma70 promoter recognition program BPROM (http://linux1.softberry.com/berry.phtml ...
J. Basic Microbiol.
doi: 10.1002/jobm.201300037
Multiple pqqA genes respond differently to environment and one contributes dominantly to pyrroloquinoline quinone synthesis.
Ge et al.,
1Laboratory of Microorganism Engineering, Beijing Institute of Biotechnology, Beijing, China
2School of Life Science and Biochemical Pharmaceutical, Shenyang Pharmaceutical University, Shenyang, China
... S2c), indicating that the transcriptional regulation events of these five genes were likely to be
different. A high-score of putative prokaryotic promoter and regulation elements were predicted
upstream of the coding sequence of ppqA2 by BProm software (www.softberry.com). ...
World Journal of Microbiology and Biotechnology
Volume 29, Issue 11 , pp 2067-2076 DOI:10.1007/s11274-013-1370-9
Characterization of a serine hydroxymethyltransferase for l-serine enzymatic production from Pseudomonas plecoglossicida
Wei Jiang, Bingzhao Xia, Junjie Huang, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
... 1 Phylogenetic tree of PplglyA. The immediate upstream sequence from the ORF was analyzed;
the promoter of the glyA gene was predicated by the tool of the Prediction of bacterial promoters
(BPROM, http://linux1.softberry.com); and the putative ?10 box (GGTTAGAAT, from ...
Plasmid
Volume 70, Issue 1, July 2013, Pages 52–60 DOI:10.1016/j.plasmid.2013.01.006
Role of plasmid- and chromosomally encoded Hha proteins in modulation of gene expression in E. coli O157:H7
Sonia Paytubi a, Manuela Dietric b, Mario H. Queiroz b, Antonio Juarez a, b
a Departament de Microbiologia, Facultat de Biologia, Universitat de Barcelona, Avda. Diagonal 643, 08028 Barcelona, Spain
b Institut de Bioenginyeria de Catalunya (IBEC), Baldiri i Reixac 10-12, 08028 Barcelona, Spain
... Promoter region was analysed via the BPROM program developed by Softberry, which predicted
two promoters for the hha pO157 gene (TTTTCA-15bp-TCGTAT and TGGAGA-17bp-TGGCAA)
with the respective Pribnow boxes located at positions -243 and -36 relative to the ...
Molecular Plant Pathology
14: 119–130. February 2013 doi: 10.1111/j.1364-3703.2012.00835.x
The ESX/type VII secretion system modulates development, but not virulence, of the plant pathogen Streptomyces scabies
Fyans, J. K., Bignell, D., Loria, R., Toth, I. and Palmer, T.
1Division of Molecular Microbiology, College of Life Sciences, University of Dundee, Dundee, UK
2James Hutton Institute, Invergowrie, Dundee, UK
... carrying esxA and esxB, together with 225 base pairs upstream of esxA, which should cover the
natural promoter region (predicted to lie approximately 100 base pairs upstream of the esxA start
codon according to the bprom prediction program; http://linux1.softberry.com/berry ...
PloS one
October 25, 2013DOI: 10.1371/journal.pone.0076341
Utilisation of Mucin Glycans by the Human Gut Symbiont Ruminococcus gnavus Is Strain-Dependent
Crost et al.,
The Gut Health and Food Safety Institute Strategic Programme, Institute of Food Research, Norwich, United Kingdom
Laboratoire de Chimie Bacterienne, Institut de Microbiologie de la Mediterranee, CNRS and Aix-Marseille University, Marseille, France
... Prediction of the promoters was performed using the BPROM program (http://linux1.softberry.
com/berry.phtml??topic=bprom&group=programs&subgroup=gfin?db). Results. Comparative
analysis of R. gnavus E1 and R. gnavus ATCC 29149 glycobiome. ...
RNA
2013. 19: 1341-1348 DOI:10.1261/rna.038794.113
S6:S18 ribosomal protein complex interacts with a structural motif present in its own mRNA
Matelska et al.,
1Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology, Warsaw, 02-109, Poland
2Bioinformatics Laboratory, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznan, 61-614, Poland
... was analyzed. Full sequence alignment is available as Supplemental File 1. ? 70
promoters associated with the representative motifs (Fig. 2) were predicted with
BPROM (http://linux1.softberry.com/berry.phtml). To estimate ...
ACS Synth. Biol.
2013, 2 (2), pp 111–120 DOI: 10.1021/sb300114d
Promoter Element Arising from the Fusion of Standard BioBrick Parts
Yao et al.,
†Department of Biomedical Engineering, ‡UC Davis Genome Center, and §Department of Computer Science, University of California Davis, One Shields Avenue, Davis, California 95616, United States
Cellular and Molecular Biology Program, University of Michigan, 1011 North University Avenue, Ann Arbor, Michigan 48109, United States
... in silico methods for detecting pKAT or pKAT-like promoters, we examined the DNA sequence
composed of 200 base pairs flanking either side of the barcode (for a 425 bp total sequence)
in BBa_K327001 with the following algorithms: BPROM (http://www.softberry.com/berry ...
J. Bacteriol.
November 2013 vol. 195 no. 22 5025-5040 DOI:10.1128/JB.00669-13
Phosphate Concentration and the Putative Sensor Kinase Protein CckA Modulate Cell Lysis and Release of the Rhodobacter capsulatus Gene Transfer Agent
Westbye et al.,
Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada
... 2A). Analysis of the region upstream of ORF g1 using the bioinformatic tool BPROM (Softberry)
indicated putative ?10 and ?35 sequences (light green in Fig. 2A). However, the location of these
sequences did not correspond to either of the two RNA 5? ends mapped. ...
Molecular Microbiology
(2013), 88: 936–950. doi: 10.1111/mmi.12234
Integrated stress response of Escherichia coli to methylglyoxal: transcriptional readthrough from the nemRA operon enhances protection through increased expression of glyoxalase I
Ozyamak, E., de Almeida, C., de Moura, A. P. S., Miller, S. and Booth, I. R.
1School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Aberdeen, UK
2Institute of Complex Systems & Mathematical Biology, School of Natural & Computer Sciences, University of Aberdeen, Aberdeen, UK
... Averages from two independent experiments are shown. Black arrows indicate locations of known
promoters. Gray arrows indicate promoters predicted by BPROM (http://linux1.softberry.com).
Data smoothing and labels are as described in Fig. 3. Download figure to PowerPoint. ...
The Journal of Pathology
DOI:10.1002/path.4313
Versatile and enhanced tumour modeling in mice via somatic cell transduction
Rodriguez et al.,
1CRUK Cambridge Institute, Department of Molecular Imaging, University of Cambridge, Li Ka Shing Centre, Cambridge, UK
2Histopathology Department, Addenbrookes Hospital, Cambridge, UK
... Nat Protoc 2009; 4: 495-505. 14. BPROM: Available from: http://linux1.softberry.com/berry.phtml?
topic=bprom&group=programs&subgroup=gfind b 15. BDGP Neural Network Promoter Prediction:
Available from: http://www.fruitfly.org/seq_tools/promoter.html 16. ...
PLoS One.
2013; 8(9): e74495. doi: 10.1371/journal.pone.0074495
Determination of sRNA Expressions by RNA-seq in Yersinia pestis Grown In Vitro and during Infection
Yan et al.,
1State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing, China
2Microbiology Laboratory, Sichuan Agricultural University, Yaan, Sichuan province, China
... were further removed. Bacterial promoter regions were predicted by BPROM
(http://linux1.softberry.com/) and Neural Network Promoter Prediction program
(http://www.fruitfly.org/seq_tools/promoter.html). Rho-independent transcription ...
J. Bacteriol.
April 2013 vol. 195 no. 8 1834-1844 DOI:10.1128/JB.01946-12
Sigma Factor RpoS Controls Alkylresorcinol Synthesis through ArpR, a LysR-Type Regulatory Protein, during Encystment of Azotobacter vinelandii
Yanet Romero, Soledad Moreno, Josefina Guzman, Guadalupe Espin and Daniel Segura
Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico
... By using the bacterial promoter recognition program BPROM (http://www.softberry.com/berry.
phtml?topic=bprom&group=programs&subgroup=gfindb), ?35 and ?10 promoter elements
showing similarity to RpoD-dependent promoters were identified in the arsA upstream region ...
Biotechnol. Bioeng.
(2013), 110: 2959–2969. doi: 10.1002/bit.24954
Isolation of fully synthetic promoters for high-level gene expression in Corynebacterium glutamicum.
Yim, S. S., An, S. J., Kang, M., Lee, J. and Jeong, K. J.
1Department of Chemical and Biomolecular Engineering, KAIST, Daejeon, Republic of Korea
2Department of Food Science & Biotechnology, Kyungsung University, Busan, Korea
3Institute for the BioCentury, KAIST, Daejeon, Republic of Korea
... All clones were 74 bp long, except for clone I29 that contained one more base in the promoter
region, which might have been inserted during synthesis with the random primer (Synpro-F).
BPROM software (http://www.softberry.com/berry.phtml) successfully predicted the ...
BMC Biotechnology
2013, 13:22 http://www.biomedcentral.com/1472-6750/13/22
Cloning and characterization of a novel cold-active glycoside hydrolase family 1 enzyme with b-glucosidase, b-fucosidase and b-galactosidase activities
Anna Wierzbicka-Wos 1†, Paulina Bartasun2†, Hubert Cieslinski2* and Jozef Kur2
1 Department of Microbiology, Faculty of Biology, University of Szczecin, Felczaka 3c, Szczecin 71-412, Poland. 2 Department of Microbiology, Gdansk University of Technology, Narutowicza 11/12, Gdansk 80-233, Poland.
... As described on the BProm website, the program has an E. coli promoter recognition accuracy
of approximately 80%, and the most recent version is accessible at http://linux1.softberry.com/
berry.phtml?topic=bprom&group=programs &subgroup=gfindb. ...
Phil. Trans. R. Soc. B
19 April 2013 vol. 368 no. 1616 20120317 DOI:10.1098/rstb.2012.0317
Regulation of reductive dehalogenase gene transcription in Dehalococcoides mccartyi
Wagner et al.,
1Institute of Biology/Microbiology, Martin-Luther-University Halle-Wittenberg, Halle 06099, Germany
2Helmholtz Centre for Environmental Research, UfZ Leipzig, Leipzig 04318, Germany
3Laboratory of Microbiology, Wageningen University, Wageningen 6703 HB, The Netherlands
... start sites; the short arrows above the inverted repeat sequences represent the putative recognition
sequences of the regulator; bold and italic letters depict the consensus sequences of the ?10
and ?35 region predicted by the BPROM software (http://linux1.softberry.com/berry ...
International journal of molecular sciences
2013, 14(8), 16901-16916. DOI:
Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans
Banderas A., Guiliani N.
Laboratory of Bacterial Communication, Department of Biology, Faculty of Sciences,
University of Chile, Santiago 780-0024, Chile
... Manipulation Suite [50] and FaBox [51]. Consensus sigma 70 bacterial promoter -10 and -35
elements were inferred using the Bprom predictor (www.softberry.com) Type I and Type II PBS
sequences with additional 100 bp flanking each side ware used as input for Bprom. ...
Genetics and Molecular Biology
(2013). 36(2), 243-251. DOI:
Characterization of the omlA gene from different serotypes of Actinobacillus pleuropneumoniae: a new insight into an old approach
Rossi, C. C., Araujo, E. F. D., Queiroz, M. V. D., & Bazzolli, D. M. S.
Laboratorio de Genetica Molecular de Micro-organismos, Departamento de Microbiologia, Universidade Federal de Vicosa, Vicosa, MG, Brazil
... pseudogenes. Nucleic Acids Res 31:5338-5348. Internet Resources Bacterial Promoter
Prediction Program BPROM, http://www.softberry.com (March 16, 2013). Associate
Editor: Celia Maria de Almeida Soares License information ...
PloS one
(2013). 8(4), e61808. DOI:
Characterization of the Biocontrol Activity of Pseudomonas fluorescens Strain X Reveals Novel Genes Regulated by Glucose
Kremmydas, G. F., Tampakaki, A. P., & Georgakopoulos, D. G.
Department of Agricultural Biotechnology, Agricultural University of Athens, Athens, Greece
... The putative promoter site prediction was performed with two bioinformatic applications,
BPROM software (Softberry Inc., Mount Kisco, NY, USA) and NNPP 2.2 software (Berkeley
Drosophila Genome Project-BDGP, Berkeley, CA, USA). ...
Scientific reports
(2013). 3.e DOI:10.1038/srep02240
Acinetobacter phage genome is similar to Sphinx 2.36, the circular DNA copurified with TSE infected particles
ThLongkumer et al.,
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad – 500 046, India
Dept. of Plant Sciences, School of Life Sciences, University of Hyderabad, Hyderabad – 500 046, India
Bioinformatics Centre, Pondicherry University, Puducherry - 605 014, India
...and for promoter prediction, BPROM software (www.softberry.com/berry.phtml?topic=bprom) was used. ...
World Journal of Microbiology and Biotechnology
Volume 28, Issue 5 , pp 2221-2228, DOI: 10.1007/s11274-012-1029-y
Identification of a copper-responsive promoter and development of a copper biosensor in the soil bacterium Achromobacter sp. AO22
Shee Ping Ng (1) (2),
Enzo A. Palombo (1),
Mrinal Bhave (1)
1. Environment and Biotechnology Centre, Faculty of Life and Social Sciences, Swinburne University of Technology, PO Box 218, Melbourne, VIC, 3122, Australia
2. School of Science and Technology, Nilai University College, Persiaran Kolej Bbn, 71800, Putra Nilai, Negeri Sembilan, Malaysia
... AO22 (Ng et al. 2012; Genbank num- ber GU929214) contains a 255 bp region between the
proposed start codons of copR and copA (Fig. 1). Analysis by BPROM (http://linux1.softberry.com/
berry.phtml?topic= bprom&group=programs&subgroup=gfindb) (Ng et al. ...
Antonie van Leeuwenhoek
March 2012, Volume 101, Issue 3, pp 583-593 DOI
10.1007/s10482-011-9673-z
Gene expression modulation by heat stress in Acidithiobacillus ferrooxidans LR
Daniela A. Ribeiro,
Lucio F. C. Ferraz,
Renato Vicentini,
Laura M. M. Ottoboni
1. Center for Molecular Biology and Genetic Engineering (CBMEG), State University of Campinas—UNICAMP, C.P. 6010, Campinas, SP, 13083-875, Brazil
... 0.05). Bioinformatic analysis BPROM (Softberry, Inc.) was used to predict the
transcription start site of the genes. BPROM is a bacterial r70 promoter recognition
software program, which has about 80% accuracy and specificity. ...
Molecular Biology
July 2012, Volume 46, Issue 4, pp 542-547 DOI
10.1134/S0026893312030120
Structure of replication initiation region in Pseudomonas IncP-7 streptomycin resistance plasmid Rms148
O. V. Volkova, I. A. Kosheleva, A. M. Boronin
1. Pushchino State University, Pushchino, 142290, Russia
2. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, 142290, Russia
... Russia). Nucleotide and amino acid sequences were analyzed using DnaStar, BLAST,
Jred3, PredictProtein, and BPROM software (Softberry). CLUSTAL and TREECON
programs were used to determine the phylogenetic tree [10]. ...
J Microbiol Biotechnol.
2012 Jun;22(6):742-53.
The heavy metal tolerant soil bacterium Achromobacter sp. AO22 contains a unique copper homeostasis locus and two mer operons
NS Ping, Palombo EA, Bhave M
Environment and Biotechnology Centre, Faculty of Life and Social Sciences, Swinburne University of Technology, PO Box 218, Melbourne, Victoria 3122, Australia.
... DNA regions of interest were submitted in both directions to the BPROM server (http://linux1.
softberry.com/ berry.phtml?topic=bprom&group=programs&subgroup=gfindb) for predicting
potential promoter regions including the -10 and -35 hexamers and likely transcription ...
The Journal of General and Applied Microbiology
Vol. 58 (2012) No. 5 p. 387-395 DOI: 10.2323/jgam.58.387
An examination of an Antarctic soil metagenomic-derivate putative methylthioadenosine phosphorylase gene as a novel reporter gene for promoter trapping
Paulina Bartasun 1), Hubert Cieslinski 1), Jozef Kur 1)
1) Department of Microbiology, Chemical Faculty, Gdansk University of Technology
... BProm has about 80% accuracy in E. coli pro- moter recognition as was described at its
website. The recent version of BProm is accessible from the website (http://linux1.softberry.
com/berry.phtml?topic=bprom& group=programs&subgroup=gfindb). ...
Journal of Industrial Microbiology & Biotechnology
May 2012, Volume 39, Issue 5, pp 731-741 DOI: 10.1007/s10295-011-1074-9
Cloning and characterization of two new thermostable and alkalitolerant a-amylases from the Anoxybacillus species that produce high levels of maltose
Yen Yen Chai et al.,
1. Faculty of Biosciences and Bioengineering, Universiti Teknologi Malaysia, 81310, Skudai, Johor, Malaysia
2. Enzyme and Microbial Technology Research, Faculty of Biotechnology and Biomolecular Science, Universiti Putra Malaysia (UPM), 43400, Serdang, Selangor, Malaysia
... html). The putative ribosome binding site was identified by a sequence comparison
with the corresponding regions of other a-amylase genes. The promoter regions were
pre- dicted using the BPROM program (http://linux1.softberry. ...
Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 464-471 DOI: 10.1128/AAC.00602-11
Identification of Hopanoid Biosynthesis Genes Involved in Polymyxin Resistance in Burkholderia multivorans
Rebecca J. Malott, Barbara R. Steen-Kinnaird, Tracy D. Lee and David P. Speert
Centre for Understanding and Preventing Infection in Children, Department of Pediatrics, University of British Columbia, Vancouver, British Columbia, Canada
.. Lynnon Biosoft, Vaudreuil, Quebec, Canada). Additional in silico promoter and
terminator predictions were performed with BPROM and FindTerm (Softberry, Inc.,
Mount Kisco, NY). Sequence similarity searches were performed ...
Current Microbiology
December 2012, Volume 65, Issue 6, pp 770-775
DOI: 10.1007/s00284-012-0228-y
Evidence for Two Promoters Internal to the Alginate Biosynthesis Operon in Pseudomonas aeruginosa
Janice L. Paletta, Dennis E. Ohman
1. Department of Microbiology and Immunology, Virginia Commonwealth University Medical Center, P.O. Box 980678, Richmond, VA, 23298-0678, USA
2. McGuire Veterans Affairs Medical Center, Richmond, VA, 23249, USA
... The intergenic spaces upstream of algG, algX, algL, algI, algJ, algF, and algA were
analyzed using BPROM software (Softberry, Inc., Mount Kisco, NY) to identify a
sigma-70 bacterial promoter consensus sequence, but none was found. ...
Appl. Environ. Microbiol.
February 2012 vol. 78 no. 3 828-838 DOI: doi: 10.1128/AEM.07480-11
Role of IncP-1b Plasmids pWDL7::rfp and pNB8c in Chloroaniline Catabolism as Determined by Genomic and Functional Analyses
Krol et al.,
aDepartment of Biological Sciences, Institute for Bioinformatics and Evolutionary Studies, University of Idaho, Moscow, Idaho, USA
bDepartment of Microbiology, University of California, Davis, Davis, California, USA
... Van der Auwera, unpublished data), with identity scoring by ClustalW. The pdca
promoter region was analyzed using BPROM (Softberry Inc., Mount Kisco, NY). To
infer the phylogenetic relationships of various IncP-1 plasmids ...
Microbiology
November 2012 mic.0.061614-0 DOI: 10.1099/mic.0.061614-0
A CsrA/RsmA translational regulator gene encoded in the replication region of a Sinorhizobium meliloti cryptic plasmid complements Pseudomonas fluorescens rsmA/E mutants
Betina Agaras, Patricio Sobrero and Claudio Valverde 1
Universidad Nacional de Quilmes
... by a typical AG-rich Shine-Dalgarno motif and by a putative ?70-dependent promoter 207
identified by the Bprom algorithm (http://linux1.softberry.com/berry.phtml), which may 208 drive
rsmASm expression (Fig. 1). A second divergent ?70-dependent promoter was 209 ...
Research in Microbiology
Volume 163, Issues 6–7, July–August 2012, Pages 413–418 DOI: 10.1016/j.resmic.2012.05.006
Two sRNA RyhB homologs from Yersinia pestis biovar microtus expressed in vivo have differential Hfq-dependent stability
Zhongliang Deng et al.,
a Southern Medical University, Guangdong 510450, China
b State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing 100071, China
... than E. coli ryhB RNA (Masse and Gottesman, 2002). The corresponding promoter
regions including the -10 and -35 boxes were predicted using BPROM
(http://linux1.softberry.com). RyhB1 and RyhB2 in Y. pestis contain the ...
Microbiological Research
Volume 168, Issue 2, 22 February 2013, Pages 113–118 DOI: 10.1016/j.micres.2012.07.003
Regulation of Staphylococcus aureus immunodominant antigen B (IsaB)
Nicole M. Mackey-Lawrence , Kimberly K. Jefferson
Department of Microbiology and Immunology, Virginia Commonwealth University, 1101 East Marshall Street, Richmond, VA 23928, USA
... analysis. As Fig. 2 indicates, the TSS matched the TSS predicted by BPROM
(Softberry software). The TSS was 39 bp upstream from the start codon, indicating
that the isaB transcript contains a 39 nt 5?-untranslated region. ...
RNA
2012. 18: 795-806 DOI: 10.1261/rna.029868.111
Regulation of expression and catalytic activity of Escherichia coli RsmG methyltransferase
Alfonso Benitez-Paez 1,2, Magda Villarroya 1 and M.-Eugenia Armengod 1,3
1Laboratorio de Genetica Molecular, Centro de Investigacion Principe Felipe, 46012 Valencia, Spain
2Bioinformatic Analysis Group–GABi, Centro de Investigacion y Desarrollo en Biotecnologia, Bogota D.C. 111221, Colombia
... The top of the figure shows a schematic of the chromosomal region including the mnmG-rsmG
operon and the predictions of the promoter regions by the Neural Network Promoter Prediction
(black) (Reese 2001) and BPROM (gray) (http://www.softberry.com/berry.phtml) servers. ...
Clinical Microbiology and Infection
Volume 18, Issue 11, pages E446–E451, November 2012 DOI: 10.1111/j.1469-0691.2012.03979.x
ISAba825 controls the expression of the chromosomal blaOXA-51-like and the plasmid borne blaOXA-58 gene in clinical isolates of Acinetobacter baumannii isolated from the USA
B. S. Lopes, L. Al-Hassan, S. G. B. Amyes
Medical Microbiology, The University of Edinburgh, Edinburgh, UK.
... four isolates. A putative promoter was found with ?35 (TTGTCA) and ?10 (TATGAA)
located 17 bp apart from each other (BPROM, Softberry, Inc., Mount Kisco, NY) located
97 and 74 bp upstream of the bla OXA-65 gene. A target ...
J. Bacteriol.
July 2012 vol. 194 no. 13 3486-3494 DOI: 10.1128/?JB.00194-12
SMU.152 Acts as an Immunity Protein for Mutacin IV
Mohammad Shahnoor Hossain and
Indranil Biswas
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, Kansas City, Kansas, USA
... Sequence analysis, confirmed using BPROM online software (prediction of bacterial promoters
[Softberry]), indicates the presence of putative ?35 (TTAGAA) and ?10 (TATACT) box motifs 78
and 55 bp, respectively, upstream of the putative start codon with a putative ribosomal ...
J. Virol
2012, 86(23):12625. DOI: 10.1128/JVI.01783-12
Characterization of the genome, proteome and structure of yersiniophage ?R1-37
Skurnik et al.,
1Department of Bacteriology and Immunology, Infection Biology Research Programme, Haartman Institute, University of Helsinki, Helsinki, Finland
2Helsinki University Central Hospital Laboratory Diagnostics, Helsinki, Finland
... The PHIRE program was used to identify 159 repeat sequences in the phage genome
(27). Bacterial promoter sequence identification was 160 carried out online at
(http://linux1.softberry.com/berry.phtml) using the BPROM program. ...
MicrobiologyOpen
DOI: 10.1002/mbo3.53 Early View (Online Version of Record published before inclusion in an issue)
Unique secreted–surface protein complex of Lactobacillus rhamnosus, identified by phage display
Gagic, D., Wen, W., Collett, M. A. and Rakonjac, J.
1
Institute of Molecular BioSciences, Massey University, Palmerston North 4442, New Zealand
2
Fonterra Research and Development Centre, Palmerston North 4442, New Zealand
... Upstream of the transcriptional site a - 10 box (ACATAAAAT) and -35 box (TTGATT) was
iden- tified in the putative promoter region using BPROM pro- moter prediction program
from the Softberry server (http://www.softberry.com/berry.phtml). ...
Antimicrob Agents Chemother.
2012 Nov;56(11):5520-7. doi: 10.1128/AAC.01206-12. Epub 2012 Aug 13.
The putative lactococcal extracytoplasmic function anti-sigma factor llmg2447 determines resistance to the cell wall-active bacteriocin lcn972.
Roces et al.,
1 DairySafe Group, Department of Technology and Biotechnology of Dairy Products, IPLA-CSIC, Villaviciosa, Asturias, Spain.
2 Department of Molecular Genetics. Groningen Biomolecular Sciences and Biotechnology Institute. University of Groningen, Nijenborgh 7, 9747 AG Groningen, The Netherlands
... 8 and Pfam (http://pfam.sanger.ac.uk/). ?70 promoter sequences were identified using Bprom
163 (http://www.softberry.com). Protein topology was predicted with TMHMM Server v2.0 164
(http://www.cbs.dtu.dk/services/TMHMM-2.0/) and SOSUI (http://bp.nuap.nagoya- 165 ...
PLoS ONE
7(10): e46587. doi:10.1371/journal.pone.0046587
QsdH, a Novel AHL Lactonase in the RND-Type Inner Membrane of Marine Pseudoalteromonas byunsanensis Strain 1A01261.
Wei Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, P.R. China
National Key Laboratory of Crop Genetic Improvement, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, P.R. China
...The positive DNA fragment was analyzed with DNASTAR software (DNASTAR, Inc.)
and by BLAST (http://www.ncbi.nlm.nih.gov/), BPROM (http://linux1.softberry.com/berry.phtml)...
Journal of Industrial Microbiology & Biotechnology
Volume 39, Issue 8 , pp 1245-1251 DOI: 10.1007/s10295-012-1128-7
Isolation and characterization of a novel GH67 a-glucuronidase from a mixed culture
Lee et al.,
1. USDA-ARS-WRRC, 800 Buchanan Street, Albany, CA, 94710, USA
2. Engineering Research Center of Eco-environment in Three Gorges Reservoir Region, Ministry of Education, China Three Gorges University, Yichang, 443002, China
... Page 4. J Ind Microbiol Biotechnol 123 When the upstream 5! region of the gene was
analyzed by a bacterial promoter search program (BPROM, Softberry, Inc., Mount Kisco,
NY, USA), ?35 and ?10 promoter ele- ments were identified (Fig. ...
Applied Microbiology and Biotechnology
Volume 94, Issue 1 , pp 261-272 DOI:10.1007/s00253-011-3621-8
Identification of the flavin monooxygenase responsible for ipso substitution of alkyl and alkoxyphenols in Sphingomonas sp. TTNP3 and Sphingobium xenophagum Bayram
Porter et al.,
1. Department of Microbiology, Cornell University, Ithaca, New York, NY, USA
2. Department of Environmental Science, Rutgers, the State University of New Jersey, New Brunswick, NJ, 08901, USA
... 1997), was used as a template for the model. Sequences outside the opdA coding sequence
were compiled as described above. Putative promoter regions were identified with the BPROM
program (Softberry, Inc., Mount Kisco, NY). Nucleotide sequence ...
Infect. Immun.
September 2012 vol. 80 no. 9 3247-3255 DOI: 10.1128/IAI.00178-12
Role of RelA and SpoT in Burkholderia pseudomallei Virulence and Immunity
Muller et al.,
a College of Life and Environmental Sciences, Biosciences, University of Exeter, Exeter, Devon, United Kingdom
b London School of Hygiene and Tropical Medicine, London, United Kingdom
... In silico analyses.Homologies between amino acid sequences were determined using NCBI's
BLASTP algorithm. Conserved domains were analyzed using NCBI's conserved domain database
(CDD). Promoter predictions were performed using the Bprom software (Softberry). ...
AEM
Published ahead of print 7 September 2012, doi: 10.1128/AEM.01693-12
Whole genome microarray and gene deletion studies reveal regulation of the polyhydroxyalkanoate production cycle by the stringent response in Ralstonia eutropha H16
Christopher J. Brigham 1, Daan R. Speth 1,2, ChoKyun Rha 3 and Anthony J. Sinskey 1,4,5
1Department of Biology
2Department of Microbiology, IWWR, Radboud University Nijmegen, Heyendaalseweg 135, 6525 AJ, Nijmegen, The Netherlands
... and further analyzed using MEGA 5 (61). Potential ?54 promoters were manually identified 211
based on the consensus sequence published previously (3). Potential ?70 promoters were 212
identified using BPROM (Softberry). 213 Microarray data accession number. ...
J. Bacteriol.
April 2012 vol. 194 no. 8 1968-1978 DOI: 10.1128/?JB.00037-12
Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans
Jeong Nam Kim, Sang-Joon Ahn, Kinda Seaton, Steven Garrett and Robert A. Burne
Department of Oral Biology, University of Florida, College of Dentistry, Gainesville, Florida, USA
... Transcriptional organization of the relQ operon.Two potential promoters were identified
56 bp and 35 bp upstream of the relQ and pta start sites, respectively, using BPROM
bacterial promoter identification software (Softberry, Inc., NY) (Fig. ...
Biological and Pharmaceutical Bulletin
Vol. 35 (2012) No. 4 P 573-581 DOI: 10.1248/bpb.35.573
Metabolism of Ginsenoside Rb1 by Human Intestinal Microflora and Cloning of Its Metabolizing b-D-Glucosidase from Bifidobacterium longum H-1
Il-Hoon Jung 1), Jeong Hoon Lee 1), Yang-Jin Hyun 1), Dong-Hyun Kim 1
1) Department of Life and Nanopharmaceutical Sciences, College of Pharmacy, Kyung Hee University
... The putative sigma 70 type promoter sequences of both TTTACA (resembling ?35 se- quence)
and GGTTATTAT (resembling ?10 sequence) were identified to be located at positions ?75 and
?55, respectively by using BPROM (http://linux1.softberry.com/berry.phtml?to pic ...
Infect. Immun.
2012, 80(9):3247. DOI: 10.1128/IAI.00178-12
Role of RelA and SpoT in Burkholderia pseudomallei Virulence and
Immunity
Muller et al.,
College of Life and Environmental Sciences, Biosciences, University of Exeter, Exeter, Devon, United Kingdom,
a
and London School of Hygiene and Tropical Medicine,
London, United Kingdomb
... BLASTP algorithm. Conserved domains were analyzed using NCBI's conserved
domain database (CDD). Promoter predictions were performed using the Bprom
software (Softberry). Statistical analyses. Differences between ...
Molecular Plant Pathology
Volume 14, Issue 2, pages 119–130, February 2013 DOI: 10.1111/j.1364-3703.2012.00835.x
The ESX/type VII secretion system modulates development, but not virulence, of the plant pathogen Streptomyces scabies
Joanna K. Fyans 1,2, Dawn Bignell 3, Rosemary Loria 4, Ian Toth 2, Tracy Palmer 1
1Division of Molecular Microbiology, College of Life Sciences, University of Dundee, Dundee, UK
2James Hutton Institute, Invergowrie, Dundee, UK
... carrying esxA and esxB, together with 225 base pairs upstream of esxA, which should cover the
natural promoter region (predicted to lie approximately 100 base pairs upstream of the esxA start
codon according to the bprom prediction program; http://linux1.softberry.com/berry ...
J. Bacteriol.
April 2012 vol. 194 no. 7 1789-1799 doi: 10.1128/JB.06827-11
Autoregulation of the Synthesis of the MobM Relaxase Encoded by the Promiscuous Plasmid pMV158
Fabian Lorenzo-Diaz a,*, Virtu Solano-Collado a, Rudi Lurz b, Alicia Bravo a and Manuel Espinosa a
aCentro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, Madrid, Spain
bMax Planck Institut fur Molekulare Genetik, Berlin, Germany
... Sequence analysis of the region located just upstream of coordinate 3643 using the BPROM
(Softberry, Mount Kisco, NY) prediction program supported the latter hypothesis. It revealed the
existence of an additional promoter sequence, here termed Pmob2 (Fig. ...
BMC Microbiology
2012, 12:268 doi:10.1186/1471-2180-12-268
Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
Ricardo N Moreira 1†, Susana Domingues 1†, Sandra C Viegas 1, Monica Amblar 2 and Cecilia M Arraiano 1*
1 Instituto de Tecnologia Quimica e Biologica, Universidade Nova de Lisboa, Av. da Republica, Oeiras, 2780-157, Portugal
2 Unidad de Patologia Molecular del Neumococo, Centro Nacional de Microbiologia, and CIBER Enfermedades Respiratorias, Instituto de Salud Carlos III. Majadahonda, Madrid, 28220, Spain
...In silico predictions of putative promoters were performed using the BPROM SoftBerry software (http:/ / linux1.softberry.com/ berry.phtml?topic=bprom&group=progr ams&subgroup=gfindb webcite)...
PLoS ONE
7(8): e43444. doi:10.1371/journal.pone.0043444
Rhamnose-Inducible Gene Expression in Listeria monocytogenes
Lars Fieseler, Sibylle Schmitter , Justinas Teiserskas, Martin J. Loessner
Institute of Food, Nutrition, and Health, ETH Zurich, Zurich, Switzerland
Department of Biochemistry and Biophysics, Faculty of Natural Sciences, Vilnius University, Vilnius, Lithuania.
.. Putative -10 and -35 regions were identified by a promoter-finding algorithm (BPROM,
http://linux1.softberry.com/berry.phtml). Cloning Procedures. Plasmid pPL2 was used for cloning
and single copy insertion into a tRNA Arg gene via bacteriophage PSA site-specific integrase. ...
PLoS ONE
7(5): e36709. doi:10.1371/journal.pone.0036709
The mbo Operon Is Specific and Essential for Biosynthesis of Mangotoxin in Pseudomonas syringae
Carrion VJ, Arrebola E, Cazorla FM, Murillo J, de Vicente A
Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” (IHSM-UMA-CSIC), Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Malaga, Spain
Laboratorio de Patologia Vegetal, ETS de Ingenieros Agronomos, Universidad Publica de Navarra, Pamplona, Spain
...The promoter (BPROM) and terminator (FindTerm and FoldRNA) prediction was performed using SoftBerry online programmes (http://www.softberry.com, Mount Kisco, NY, USA). ...
MicrobiologyOpen
Early View (Online Version of Record published before inclusion in an issue) DOI: 10.1002/mbo3.50
First insights into the syntrophic acetate-oxidizing bacteria – a genetic study
Bettina Muller *, Li Sun, Anna Schnurer
Department of Microbiology, Uppsala BioCenter, Swedish University of Agricultural Sciences, Uppsala, Sweden
...BPROM, available online at http://www.softberry.com, was used as the promoter-prediction program....
AEM
Published ahead of print 14 September 2012, doi: 10.1128/AEM.01442-12
Phylogenetically novel LuxI/LuxR-type Quorum Sensing Systems Isolated Using a Metagenomic Approach
Nasuno et al.,
1Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8566, Japan
2Graduate school of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki, 305-8572, Japan
... ausI from fosmid pN52. The G+C content in pN16 (56%) was lower than in pN52 (65%). 296
Promoter prediction software BPROM (Softberry, Mt. Kisco, NY, USA) identified 297 possible
?70 promoters in the upstream regions of both AHL-synthesizing enzyme genes, 298 ...
Plasmid
Volume 68, Issue 1, July 2012, Pages 1–12 DOI: 10.1016/j.plasmid.2012.01.009
Requirements for Borrelia burgdorferi plasmid maintenance
Kit Tilly, 1, , Claire Checroun1, 2, Patricia A. Rosa
Laboratory of Zoonotic Pathogens, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Rocky Mountain Laboratories, Hamilton, MT 59840, United States
... 1C). The ability of this region to confer stable maintenance on a B. burgdorferi shuttle vector (
[Byram et al., 2004] and [Jewett et al., 2007a]) argues in favor of this hypothesis. Searching
for a bacterial promoter using BPROM (Softberry, Inc., Mt. ...
J. Bacteriol.
May 2012 vol. 194 no. 9 2307-2320 DOI: .1128/JB.00142-12
Long-Range Transcriptional Control of an Operon Necessary for Virulence-Critical ESX-1 Secretion in Mycobacterium tuberculosis
Hunt et al.,
aDivision of Mycobacterial Research, MRC National Institute for Medical Research, Mill Hill, London, United Kingdom
bDepartment of Molecular Biology and Biotechnology, University of Sheffield, Sheffield, United Kingdom
... A search for a possible promoter using Softberry BPROM (Mount Kisco, NY; a bacterial ?
70 prediction program) predicted a transcription start site at ?66 bp upstream of the translation
start site in close agreement with the results described above. ...
J. Bacteriol.
October 2012 vol. 194 no. 19 5315-5324 DOI: 10.1128/JB.00984-12
Epoxide-Mediated CifR Repression of cif Gene Expression Utilizes Two Binding Sites in Pseudomonas aeruginosa
Ballok et al.,
aDepartment of Microbiology and Immunology, Geisel School of Medicine at Dartmouth, Hanover, New Hampshire, USA
bDepartment of Biochemistry, Geisel School of Medicine at Dartmouth, Hanover, New Hampshire, USA
... Therefore, we utilized 5?RACE to map the start sites for the cifR gene and morB operon
transcripts, as indicated in Fig. 4C. We next used the promoter prediction software, BPROM
(SoftBerry), to identify the ?10 and ?35 sites for each sequence. As can be seen in Fig. ...
J. Bacteriol.
March 2012 vol. 194 no. 6 1523-1532 doi: 10.1128/JB.06104-11
Characterization of Escherichia colidinJ-yafQ Toxin-Antitoxin System Using Insights from Mutagenesis Data
Julija Armalyte, Milda Jurenaite, Gina Beinoraviciute, Justinas Teiserskas and Edita Suziedeliene
Department of Biochemistry and Biophysics, Faculty of Natural Sciences of Vilnius University, Vilnius, Lithuania
... The open arrowhead indicates free DNA; full arrowheads indicate DNA bound in complex with
DinJ-YafQ(His) 6 . We have identified several palindromic sequences in the promoter region
of dinJ-yafQ by sequence analysis (BPROM; Softberry, Inc., Mount Kisco, NY) (Fig. ...
Infect. Immun.
March 2012 vol. 80 no. 3 1037-1049 doi: 10.1128/IAI.05563-11
Pneumococcal Gene Complex Involved in Resistance to Extracellular Oxidative Stress
Andisi et al.,
aLaboratory of Molecular Bacteriology, Department of Medical Microbiology, University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
bMolecular Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, Rijksuniversiteit Groningen, Groningen, The Netherlands
...Therefore, we analyzed all intergenic regions by hand and with the BPROM software
(Softberry, Mt. Kisco, NY); both methods...
BMC Genomics
2012, 13:550 doi:10.1186/1471-2164-13-550
Identification of novel growth phase- and media-dependent small non-coding RNAs in Streptococcus pyogenes M49 using intergenic tiling arrays
Patenge et al.,
1 Institute of Medical Microbiology and Hospital Hygiene, University of Rostock, Schillingallee 70, 18057, Rostock, Germany
2 Institute of Medical Microbiology, Genome Research, Justus-Liebig-University, Frankfurter Strasse 107, 35392, Giessen, Germany
... Terminators and promoters were predicted by TransTermHP [52] ( http://transterm.cbcb.umd.
edu/tt/Streptococcus_pyogenes_NZ131.tt webcite) and BDGP Neural Network Promoter
Prediction [53], and BProm ( http://www.SoftBerry.com webcite), respectively. ...
MPMI
Vol. 25, No. 1, 2012, pp. 119–128. DOI: 10.1094/ MPMI -07-11-0188
A Role for Bradyrhizobium japonicum ECF16
Sigma Factor EcfS in the Formation
of a Functional Symbiosis with Soybean
S. B. Stockwell, 1 L. Reutimann, 2 and M. L. Guerinot 1
1 Biological Sciences Department, Dartmouth College, Hanover, NH 03755, U.S.A.;
2 ETH, Institute of Microbiology, Zurich,
Switzerland
...Further promoter analysis was performed using motif searches
(MEME Suite) (Bailey et al. 2009) and the virtual footprint
algorithm (Softberry BPROM analysis tool) (Munch et al.
2005); ...
BMC Microbiology
2012, 12:173 doi:10.1186/1471-2180-12-173
Pyrosequencing-based analysis reveals a novel capsular gene cluster in a KPC-producing Klebsiella pneumoniae clinical isolate identified in Brazil
Ramos et al.,
1 Laboratorio Nacional de Computacao Cientifica (LNCC), Petropolis, Rio de Janeiro, Brazil
2 Instituto de Microbiologia Paulo de Goes, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
... webcite. Prediction of promoters was performed using the in-house SABIA platform
as well as the BPROM program (http://linux1.softberry.com webcite), which searches
for promoters under the control of the sigma factor 70. ...
BMC Genomics
2012, 13:37 doi:10.1186/1471-2164-13-37
Expression profiling reveals Spot 42 small RNA as a key regulator in the central metabolism of Aliivibrio salmonicida
Hansen et al.,
1 Department of chemistry, Faculty of science and technology, University of Tromso, N-9037, Tromso, Norway
2 The Norwegian Structural Biology Centre, University of Tromso, N-9037, Tromso, Norway
... However, there is weak conservation among the predicted CRP sites in vibrios. The BPROM
program (from http://www.softberry.com webcite) was used to predict -10 and -35 promoter
sequences. Computational prediction of Spot42-pirin mRNA base-pairing. ...
PLoS ONE
7(3): e32977. doi:10.1371/journal.pone.0032977
Identification of the First Functional Toxin-Antitoxin System in Streptomyces
Laura Sevillano, Margarita Diaz, Yoshihiro Yamaguchi, Masayori Inouye, Ramon I. Santamaria
Instituto de Biologia Funcional y Genomica/Departamento de Microbiologia y Genetica, Consejo Superior de Investigaciones Cientificas, Universidad de Salamanca, Campus Miguel de Unamuno, Salamanca, Spain
Department of Biochemistry, Center for Advanced Biotechnology and Medicine, Robert Wood Johnson Medical School, Piscataway, New Jersey, United States of America
...BPROM software (http://linux1.softberry.com/berry.phtml) was used to search for conserved sequences in the putative promoter of the TA system....
Appl. Environ. Microbiol.
September 2012 vol. 78 no. 18 6568-6575 July 2012, doi: 10.1128/?AEM.01060-12
Mercury Resistance and Mercuric Reductase Activities and Expression among Chemotrophic Thermophilic Aquificae
Zachary Freedman a,b,*,
Chengsheng Zhu a and
Tamar Barkay a,b
aDepartment of Biochemistry and Microbiology
bGraduate Program in Ecology and Evolution, Rutgers University, New Brunswick, New Jersey, USA
... (50). Of the 284 gene homologs available, 99 were selected for reconstruction; the selected
homologs represented all major clusters in the MerA phylogeny. Putative promoter regions
were determined using the BPROM tool (Softberry Inc., Mt. Kisco, NY). ...
Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 565-568 doi: 10.1128/?AAC.00081-11
Description of a 2,683-Base-Pair Plasmid Containing qnrD in Two Providencia rettgeri Isolates
Thomas Guillard et al.,
aCHU Reims, Hopital Robert Debre, Laboratoire de Bacteriologie-Virologie-Hygiene, Reims, France
bUFR Medecine, Universite Reims Champagne-Ardenne, Reims, France
cUniversite Paris Diderot-Paris 7, Paris, France
... 2) (9): (i) an AT-rich region, (ii) iterons, (iii) three DnaA boxes, and (iv) two pairs of inverted repeats
were identified using REPFIND (2). In addition, a putative promoter and transcription start site
have been identified for Orf4 using BPROM (Softberry) and the promoter prediction ...
Extremophiles
Volume 16, Issue 3 , pp 363-376 DOI 10.1007/s00792-012-0435-2
Plasmid pP62BP1 isolated from an Arctic Psychrobacter sp. strain carries two highly homologous type II restriction-modification systems and a putative organic sulfate metabolism operon
Robert Lasek (1)
Lukasz Dziewit (1)
Dariusz Bartosik bartosik@biol.uw.edu.pl (1)
1. Department of Bacterial Genetics, Faculty of Biology, Institute of Microbiology, University of Warsaw, Miecznikowa 1, 02-096, Warsaw, Poland
... 2010). Sequence alignments were per- formed using MUSCLE (Edgar 2004). Putative promoter
sequences were predicted using BPROM (http://www. softberry.com/berry.html). Protein secondary
structures were determined with the application of PredictProtein (Rost et al. ...
Ïîõîæèå ñòàòüè Âñå âåðñèè ñòàòüè (5)
Enzyme and Microbial Technology
Volume 50, Issues 6–7, 10 May 2012, Pages 280–286 http://dx.doi.org/10.1016/j.enzmictec.2012.02.001
The direct repeat sequence upstream of Bacillus chitinase genes is cis-acting elements that negatively regulate heterologous expression in E. coli
Liang Xiao a, b, 1,
Chuan Liu a, b, 1,
Chi-chu Xie a, b,
Jun Cai a, b, c,
Yue-hua Chen a, b, c,
a Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, PR China
b Department of Microbiology, College of Life Sciences, Nankai University, Weijin Road 94, Tianjin 300071, PR China
... The chitinase genes were sequenced and the upstream regions were analyzed using online
softwares REPFIND (http://zlab.bu.edu/repfind/form.html) and BPROM (http://linux1.softberry.
com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Appl. Environ. Microbiol.
February 2012 vol. 78 no. 4 1298-1301 doi: 10.1128/?AEM.07278-11
Requirement for RNA Helicase CsdA for Growth of Yersinia pseudotuberculosis IP32953 at Low Temperatures
Eveliina Palonen et al.,
Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland
... An important role of CsdA at low temperatures was further confirmed by successful
complementation of the csdA mutation. csdA and its putative native promoter, as
predicted by BPROM (softberry, Inc., Mount Kisco, NY). were ...
Applied Microbiology and Biotechnology
Volume 93, Issue 4 , pp 1585-1599 DOI
10.1007/s00253-011-3684-6
Isolation of a strong promoter fragment from endophytic Enterobacter cloacae and verification of its promoter activity when its host strain colonizes banana plants
Yu Guang Wang et al.,
1. Key Laboratory of Tropical Crop Biotechnology, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou, 571101, People’s Republic of China
2. Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, 571737, People’s Republic of China
... Promoters were predicted with Neural Network Promoter Prediction (NNPP) v2.2
(http://www.fruitfly.org/ index.html) and BPROM of SoftBerry (http://linux1.softberry.
com/berry.phtml). Identification of primary promoter functional fragments of complex cloned ...
Antimicrob. Agents Chemother.
doi: 10.1128/?AAC.00846-12 October 2012 vol. 56 no. 10 5171-5179
Reduced Expression of the rplU-rpmA Ribosomal Protein Operon in mexXY-Expressing Pan-Aminoglycoside-Resistant Mutants of Pseudomonas aeruginosa
Calvin Ho-Fung Lau a,
Sebastien Fraud a,
Marcus Jones b,
Scott N. Peterson b and
Keith Poole a
aDepartment of Biomedical and Molecular Sciences, Queen's University, Kingston, Ontario, Canada
bThe J. Craig Venter Institute, Rockville, Maryland, USA
... Intriguingly, the mutation upstream of this operon occurred within the putative ?10 Pribnow box
of the only predicted promoter for rplU-rpmA (SoftBerry BPROM promoter prediction software;
SoftBerry, Inc., Mount Kisco, NY), 135 bp upstream of the rplU start codon (TTGCCT ...
BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10
Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production
Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain
2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain
... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters
in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm
software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...
BMC Microbiology
2012, 12:226 doi:10.1186/1471-2180-12-226
Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by
a transcriptional terminator
Valeria C Caballero et al.,
1 Program of Microbiology and Mycology, Institute of Biomedical Science
(ICBM), Faculty of Medicine, University of Chile, Santiago, Chile
2 Area of Biochemistry, Faculty of Dentistry, University of Chile, Santiago, Chile
... By mean of bioinformatics tools, including BPROM from the Softberry software package
(http://linux1.softberry.com/berry.phtml), we identified those promoters in S. flexneri and
included all three promoters in the constructs indicated in Figure 3A. ...
Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002
IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes
Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany
2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile
... to GenBank sequences. Additional searches for genes, operons, promoters, and
terminators were done using FGENESB, BPROM, and FindTerm at www.softberry.
com (Softberry, Mount Kisco, NY, USA). The sequence data ...
Microbiology.
2012 Jun;158(Pt 6):1581-92. doi: 10.1099/mic.0.055863-0. Epub 2012 Mar 1.
Vru (Sub0144) controls expression of proven and putative virulence determinants and alters the ability of Streptococcus uberis to cause disease in dairy cattle.
Egan SA, Ward PN, Watson M, Field TR, Leigh JA.
The School of Veterinary Medicine and Science, The University of Nottingham, Sutton Bonington, Leicestershire, UK.
... Sequence analysis of the intergenic and promoter regions of the genes sub0144 (vru) and
sub0145 (lbp) was performed using Artemis (Rutherford et al., 2000) and bprom from Softberry
sequence analysis tools (http://linux1.softberry.com/berry.phtml?topic=bprom&group ...
AMB Express
2:41 DOI
10.1186/2191-0855-2-41
Revelation of the ability of sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer
Nyok-Sean Lau (1)
Kumar Sudesh (1)
1. Ecobiomaterial Research Laboratory, School of Biological Sciences, Universiti Sains Malaysia, Penang, 11800, Malaysia
... Center for Biotechnology Information) and ClustalW Multiple Sequence Alignment program
(Thompson et al., 1994). The potential promoter regions recognized by Sigma factor D (?D) were
predicted using prediction of bacterial promoters (BPROM) provided by Softberry Inc. ...
Antimicrob. Agents Chemother.
April 2012 vol. 56 no. 4 1698-1702 doi: 10.1128/AAC.06199-11
Novel Plasmid and Its Variant Harboring both a blaNDM-1 Gene and Type IV Secretion System in Clinical Isolates of Acinetobacter lwoffii
Hongyan Hu et al.,
aDepartment of Laboratory Medicine, The General Hospital of Chinese People's Armed Police Forces, Beijing, China
bCAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China
... constructing the phylogenetic tree. A multiple-sequence alignment was constructed
using ClustalX version 1.8 (27). Promoter searches were performed by using
Softberry's BPROM (Softberry Inc., Mt. Kisco, NY), PPP-Prokaryotic ...
Appl. Environ. Microbiol.
February 2012 vol. 78 no. 4 1228-1236
Identification of an Enzyme System for Daidzein-to-Equol Conversion in Slackia sp. Strain NATTS
Hirokazu Tsujia,
Kaoru Moriyamaa,
Koji Nomotoa and
Hideyuki Akazab
aYakult Central Institute for Microbiological Research, Kunitachi, Tokyo, Japan
bSystems Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, Tokyo, Japan
... For analysis of nucleotide sequences and amino acid sequences, DDBJ-BLAST
(http://www.ddbj.nig.ac.jp/), BPROM (SoftBerry), GeneMark version 2.5 (http://opal.biology.gatech.
edu/GeneMark/), FindTerm (SoftBerry), and PSORT (http://psort.ims.u-tokyo.ac.jp/) were used. ...
Applied Biochemistry and Biotechnology
September 2012 Online ISSN
1559-0291 DOI 10.1007/s12010-012-9889-z
Characterization of a Glycoside Hydrolase Family 1 b-Galactosidase from Hot Spring Metagenome with Transglycosylation Activity
Richa Gupta,
Tanvi Govil,
Neena Capalash,
Prince Sharma
1. Department of Biotechnology, Panjab University, Chandigarh, 160014, India
2. Department of Microbiology, Panjab University, Chandigarh, 160014, India
... Motifs in the considered sequences were scanned using PROSITE [19]. N-terminal signal peptide
analysis was done using Signal IP version 3.0 program [20], and the promoter was located using
SoftBerry BPROM tool (http://www.soft berry.com/berry.html). ...
Antimicrob. Agents Chemother.
June 2012 vol. 56 no. 6 3392-3394
Functional Characterization of a Cassette-Specific Promoter in the Class 1 Integron-Associated qnrVC1 Gene
Erica Lourenco da Fonseca and
Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, Brazil
... presence of internal cassette-specific promoters of aadA2 and qnrVC1 using four promoter
prediction programs: Neural Network for Promoter Prediction (NNPP) version 2.2 (Berkeley
Drosophila Genome Project, http://www.fruitfly.org/index.html), BPROM (SoftBerry, http://linux1 ...
Journal of Biomedical Science and Engineering
Year: 2011 Volume: 04 Issue: 01 Pages: 70-75 DOI: 10.4236/jbise.2011.41009
Analysis of the arginine biosynthetic gene cluster argCJBDFR of Corynebacterium crenatum
Haitao Jiao, Yong Yuan, Yonghua Xiong, Xuelan Chen
... The sequence data were compiled, aligned and ana- lyzed using Lasergene software
(DNASTAR), Soft- berry's BPROM (www.softberry.com) and RNAshapes WebServices
(BiBiServ) et al. 3. RESULTS AND DISCUSSION 3.1. ...
Biologia
2011, vol. 66, no4, pp. 565-573
The role of TerW protein in the tellurite resistance of uropathogenic Escherichia coli
Valkovicova et al.,
(1) Department of Molecular Biology, Faculty of Natural Sciences, Comenius University, SK-84215, Bratislava, Slovakia
... and cloning of a potential promoter se- quence The potential promoter rich region (PPRR) of
the ter operon was determined with the help of the Neural Network Promoter Prediction software
(http://www.fruitfly.org/ seq tools/promoter.html) and Softberry-BPROM software (http ...
Antonie van Leeuwenhoek
Volume 99, Issue 2 , pp 409-416 DOI: 10.1007/s10482-010-9476-7
Characterization of transcription within sdr region of Staphylococcus aureus
Izabela Sitkiewicz, Ireneusz Babiak, Waleria Hryniewicz
1. Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland
2. Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland
... The presence of putative promoters and transcrip- tional organization of the sdr region was
detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region
611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...
FEMS Microbiology Letters
314: 18–24. doi: 10.1111/j.1574-6968.2010.02132.x
ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis.
Marshall, S. H., Henriquez, V., Gomez, F. A. and Cardenas, C.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Facultad de Ciencias, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile
2 NBC, Nucleo de Biotecnologia Curauma, Curauma, Valparaiso, Chile
... sequencing by Macrogen Inc. (Korea). Sequence analysis. The DNA sequence data
were analyzed with softberry server software (http://linux1.softberry.com/berry.phtml)
using the FgenesB and Bprom algorithms. FgenesB is a suite ...
J. Antimicrob. Chemother.
(2011) 66 (4): 797-801.
doi: 10.1093/jac/dkr011
Pc promoter from class 2 integrons and the cassette transcription pattern it evokes
Erica Lourenco da Fonseca*, Fernanda dos Santos Freitas and Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, Fundacao Oswaldo Cruz, Rio de Janeiro, RJ, Brazil
... The attI2 site sequence and the intI2* gene were submitted to four promoter predictor programs:
Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project,
http://www.fruitfly.org/index.html); BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml ...
J. Antimicrob. Chemother.
(2011) 66 (5): 1005-1012. DOI: 10.1093/jac/dkr041
Variation in the genetic environments of blaCTX-M-15 in Escherichia coli from the faeces of travellers returning to the United Kingdom
Dhanji et al.,
1Antibiotic Resistance Monitoring and Reference Laboratory, Health Protection Agency Microbiology Services – Colindale, 61 Colindale Avenue, London NW9 5EQ, UK
2North West London NHS Trust, Northwick Park Hospital, London HA1 3UJ, UK
... DNA sequences that did not contain published bla CTX-M promoters were analysed
with 'SoftBerry BPROM' software. 23. A potential alternative promoter region (promoter
X) was investigated by cloning and northern blotting. ...
BMC Genomics
2011, 12:282 doi:10.1186/1471-2164-12-282
Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential
Oakley et al.,
1 Poultry Microbiological Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA 30605, USA
2 Department of Infectious Diseases & Center for Tropical and Emerging Global Diseases University of Georgia, Athens, GA 30306, USA
... The transcriptional regulation of these genes in our phages remains unknown, but searches for
transcriptional promoters and terminators using BPROM (Softberry, Inc., Mount Kisco, NY, USA;
http://linux1.softberry.com/berry.phtml webcite) and TransTerm (http://nbc3.biologie.uni ...
Biochem. J.
(2011) 433 (107–117) (Printed in Great Britain) doi:10.1042/BJ20101186
Escherichia coli glycogen genes are organized in a single glgBXCAP transcriptional unit possessing an alternative suboperonic promoter within glgC that directs glgAP expression
Montero et al.,
Agrobioteknologiako Instituta, Nafarroako Unibertsitate Publikoa and Consejo Superior de Investigaciones Cientificas, Mutiloako etorbidea zenbaki gabe, 31192 Mutiloabeti, Nafarroa, Spain
... Protein content was measured by the Bradford method using a Bio-Rad prepared reagent.
Computer analyses. Promoters were predicted using the BPROM program (SoftBerry,
http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Molecular Microbiology
(2011) 79: 1602–1614. doi: 10.1111/j.1365-2958.2011.07543.x
tRNA accumulation and suppression of the bldA phenotype during development in Streptomyces coelicolor.
Pettersson, B. M. F. and Kirsebom, L. A.
Department of Cell and Molecular Biology, Box 596, Biomedical Centre, SE-751 24 Uppsala, Sweden.
...The Softberry BPROM promoter prediction software (http://linux1.softberry.com/berry.phtml) was used to predict the tRNAHisGUG and the known tRNALeuUAA transcription start sites, while the tRNALeuCAA transcription start site was manually predicted on the basis of similarity to Escherichia coli?70 promoters....
Antimicrob. Agents Chemother.
December 2011 vol. 55 no. 12 5850-5860 doi: 10.1128/AAC.00498-11
Fluoroquinolone Efflux in Streptococcus suis Is Mediated by SatAB and Not by SmrA
Escudero et al.,
1Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Madrid, Spain
2Centro de Vigilancia Sanitaria Veterinaria (VISAVET), Universidad Complutense de Madrid, Madrid, Spain
... Promoter sequence analysis was performed with Bprom (Softberry, Inc., Mount Kisco,
NY). Protein modeling was done using Phyre server (23) and illustrated using the PyMOL
molecular graphics system (version 1.3; Schrodinger, LLC). ...
Metallomics,
2011,3, 1009-1018 DOI: 10.1039/C1MT00127B
A novel nickel responsive MerR-like regulator, NimR, from Haemophilus influenzae
Kidd et al.,
School of Molecular and Biomedical Science, The University of Adelaide, North Terrace Campus, Adelaide, South Australia 5005, Australia.
... Our in silico analysis identified the promoter regions for each of these using BPROM
(Softberry: www.softberry.com) and the likely MerR-like binding site .19 HI1623 is
annotated as CadR, indicating that it is a cadmium responsive protein . ...
Antimicrob. Agents Chemother.
January 2011 vol. 55 no. 1 361-363 doi: 10.1128/AAC.01672-09
A Novel Insertion Sequence, ISAba10, Inserted into ISAba1 Adjacent to the blaOXA-23 Gene and Disrupting the Outer Membrane Protein Gene carO in Acinetobacter baumannii
Lee et al.,
1Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752, South Korea
2Korean Institute of Tuberculosis, 14 Woomyun-dong, Seocho-gu, Seoul 137-900, South Korea
... additional promoter sequences to the bla OXA-23 gene. Analyses using the online
tool BPROM (Softberry, Inc., Mount Kisco, NY) suggested the presence of a putative
promoter within the ISAba10 element (Fig. 1). View this table ...
Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142
Complete genome sequence of the lytic
Pseudomonas fluorescens phage fjIBB-PF7A
Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological
Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga,
Portugal
... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/
tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly.
org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ...
...Terminators
were predicted using FindTerm http://linux1.softberry.
com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...
Antimicrob. Agents Chemother.
April 2011 vol. 55 no. 4 1460-1469 doi: 10.1128/AAC.01094-10
Role of VltAB, an ABC Transporter Complex, in Viologen Tolerance in Streptococcus mutans
Saswati Biswas and Indranil Biswas
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Centre, Kansas City, Kansas 66160
... In silico analysis by BPROM software (Softberry, Inc.) indicates that this region
contains a weak promoter-like sequence (?10 box [TATATT] at position 362),
indicating that vltAB may be transcribed separately from SMU.902. ...
Antimicrob. Agents Chemother
December 2011 vol. 55 no. 12 5942-5945 doi: 10.1128/AAC.05142-11
Quinolone Induction of qnrVS1 in Vibrio splendidus and Plasmid-Carried qnrS1 in Escherichia coli, a Mechanism Independent of the SOS System
Okumura et al.,
1Division of Infectious Diseases, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts
2 Biological Research Laboratories, Daiichi Sankyo Co., Ltd., Tokyo, Japan
... host (Table 3), we amplified by PCR (primer pairs in Table 4) and cloned a 1,011-bp BamHI-EcoRI
fragment containing qnrVS1, 258 bp of upstream sequence, including the potential native promoter
sequence (bacterial promoter prediction program from Softberry), and 85 bp of ...
Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050
The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay
Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China
b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China
... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM
and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening
of serotype-specific gene. Cross-hybridization experiments ...
FEMS Microbiology Letters
(2011), 323: 97–104. doi: 10.1111/j.1574-6968.2011.02365.x
The copper responding surfaceome of Methylococccus capsulatus Bath
Karlsen, O. A., Larsen, O., Jensen, H. B.
1Department of Molecular Biology, University of Bergen, Norway
2UNI Research, Bergen, Norway
... b Predicted upstream promoter using bprom (http://linux1.softberry.com/all.htm) or
promscan (http://molbiol-tools.ca/promscan/) promotor prediction software. c (Y, yes)
or (N, no) indicates if the encoding gene is part of an operon structure. ...
Infect. Immun.
January 2011 vol. 79 no. 1 342-352 doi: 10.1128/IAI.00736-10
Characterization of a Staphylococcus aureus Surface Virulence Factor That Promotes Resistance to Oxidative Killing and Infectious Endocarditis
Malachowa et al.,
1Department of Microbiology, Molecular Biology, and Biochemistry, University of Idaho, Moscow, Idaho 83844
2Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland
... The BPROM program (Softberry, Inc., Mount Kisco, NY) was used to predict bacterial promoter.
DNA isolation.Genomic DNA was isolated by using Genomic DNA Prep Plus kits (A&A
Biotechnology, Gdynia, Poland) facilitated by a method to promote S. aureus lysis (41). ...
Applied Microbiology and Biotechnology
Volume 90, Issue 1 , pp 159-172 DOI: 10.1007/s00253-010-3028-y
Discovery and characterization of d-phenylserine deaminase from Arthrobacter sp. TKS1
Muramatsu et al.,
1. Multidisciplinary Science Cluster, Research and Education Faculty, Kochi University, B200 Monobe, Nankoku, Kochi, 783-8502, Japan
2. Graduate School of Integrated Arts and Sciences, Kochi University, B200 Monobe, Nankoku, Kochi, 783-8502, Japan
... Institute (Finn et al. 2008). The prediction of the bacterial promoter was performed
with the BPROM software at SoftBerry (http:// linux1.softberry.com/berry.phtml).
Nucleotide sequence accession number The nucleotide sequence ...
World Journal of Microbiology and Biotechnology
Volume 27, Issue 2 , pp 431-441 DOI: 10.1007/s11274-010-0475-7
Gene cloning, expression and characterization of a cold-adapted lipase from a psychrophilic deep-sea bacterium Psychrobacter sp. C18
Ruipeng Chen, Lizhong Guo, Hongyue Dang
1. College of Life Sciences, Qingdao Agricultural University, 266109, Qingdao, China
2. State Key Laboratory of Heavy Oil Processing and Centre for Bioengineering and Biotechnology, China University of Petroleum (East China), 266555, Qingdao, China
... version 2.0; Larkin et al. 2007). The upstream regulatory sequence signatures of the
putative lipase genes were analyzed using the online BPROM program (http://linux1.
softberry. com/berry.phtml?topic=index&group=programs&subgroup ...
International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019
Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus
Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
... Presence of putative promoters, terminators and operons was evaluated using BPROM
(http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter.
html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...
Antimicrob. Agents Chemother.
January 2011 vol. 55 no. 1 118-123 doi: 10.1128/AAC.01062-10
Metallo-b-Lactamase Production by Pseudomonas otitidis: a Species-Related Trait
Thaller et al.,
1Dipartimento di Biologia, Universita di Roma “Tor Vergata,” I-00133 Rome, Italy
2Dipartimento di Biologia Molecolare, Sezione di Microbiologia, Universita di Siena, I-53100 Siena, Italy
... phylogenetic trees. Signal peptide cleavage site was predicted using SignalP (version
3.0). Putative promoter sequences were detected using Bprom software (Softberry,
Inc., Mount Kisco, NY). Nucleotide sequence accession ...
BioData Mining
2011, 4:22
http://www.biodatamining.org/content/4/1/22
Detection of putative new mutacins by
bioinformatic analysis using available web tools
Guillaume G Nicolas
Departement de Biochimie
Microbiologie et Bioinformatique,
Faculte des Sciences et Genie,
Universite Laval, Quebec (Quebec),
G1K7P4, Canada
... Upstream genomic coding sequence was analyse to detect putative promoter regions and
transcription factor binding sites using the bacterial promoter recognition program BPROM
(Softberry inc.) (Figure 2). Many putative mutacin-encoding genes have been previously ...
Appl. Environ. Microbiol.
January 2011 vol. 77 no. 1 281-290 doi: 10.1128/AEM.01403-10
Ethanolamine Utilization Contributes to Proliferation of Salmonella enterica Serovar Typhimurium in Food and in Nematodes
Shabarinath Srikumar and Thilo M. Fuchs
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany
... The home pages for NCBI and Microbes Online were used to determinate the distribution of
the pdu and eut clusters in different serotypes of S. enterica. Promoter sequences located
upstream of the genes identified were predicted with BPROM (Softberry). ...
J. Bacteriol.
October 2011 vol. 193 no. 19 5300-5313 doi: 10.1128/JB.05287-11
Genomes and Characterization of Phages Bcep22 and BcepIL02, Founders of a Novel Phage Type in Burkholderia cenocepacia
Jason J. Gill et al.,
1Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843-2128
2Center for Phage Technology, Texas A&M University, College Station, Texas 77843-2128
... Protein sequences were compared to the NCBI protein database by using BLASTp (9); tRNA
genes were detected with tRNAscan (68); rho-independent terminators were detected with
TransTerm HP (37); promoters were detected using BPROM (Softberry). ...
Infection, Genetics and Evolution
Volume 11, Issue 6, August 2011, Pages 1352–1360 DOI: 10.1016/j.meegid.2011.04.029,
Pseudomonas entomophila and Pseudomonas mendocina: Potential models for studying the bacterial type VI secretion system
Panagiotis F. Sarris a, b, Effie V. Scoulica b
a Department of Biology, University of Crete, P.O. Box 2208, 71409 Heraklion, Greece
b Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, School of Medicine, University of Crete, 71409 Heraklion, Greece
.. Thereby, in order to identify T6SS gene clusters potentially controlled by sigma factors we
performed a survey using the BPROM algorithm (www.softberry.com). ... The sequences were used
for analysis by the BPROM algorithm (www.softberry.com) (Table S1). ...
Appl. Environ. Microbiol.
March 2011 vol. 77 no. 5 1608-1618 doi: 10.1128/AEM.01862-10
Identification and Characterization of Novel and Potent Transcription Promoters of Francisella tularensis
Zaide et al.,
Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, P.O. Box 19, Ness Ziona 74100, Israel
... Computational analysis of promoter elements.The sequences of all the unique
promoter clone DNA inserts were subjected to regulatory element analysis using
the BPROM bacterial promoter prediction program (Softberry). ...
Antimicrob. Agents Chemother.
February 2011 vol. 55 no. 2 917-920 doi: 10.1128/AAC.00491-10
SAba825, a Functional Insertion Sequence Modulating Genomic Plasticity and blaOXA-58 Expression in Acinetobacter baumannii
Pablo Ravasi, Adriana S. Limansky, Ramiro E. Rodriguez, Alejandro M. Viale and Maria A. Mussi
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, 2000 Rosario, Argentina
... The ?35 and ?10 motifs inferred for each of the different promoters are boxed, and the transcription
initiation site (G in bold) resulting from the hybrid promoter (as determined by 5? RACE-PCR)
is indicated by +1. Promoter prediction was done using BPROM (SoftBerry). ...
BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198
Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny
Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden
... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70-
promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were
identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...
J Proteomics Bioinform
4: 179-183. doi:10.4172/jpb.1000187
Bacillus clausii and Bacillus halodurans lack GlnR but Possess Two Paralogs of glnA
Farazmand A, Yakhchali B, Shariati P, Ofoghi H
1Department of Biotechnology, Iranian Research Organization for Science and Technology (IROST), 15815-3538, Tehran, Iran
2Department of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), 14965-161 Tehran, Iran
...the bacterial promoter prediction program, BPROM (www.softberry.com/berry.html) was used. ...
PLoS ONE
(2011) 6(3): e18197. doi:10.1371/journal.pone.0018197
Identification of a Cryptic Prokaryotic Promoter within the cDNA Encoding the 5? End of Dengue Virus RNA Genome.
Li D, Aaskov J, Lott WB
Infectious Diseases Program, Institute of Health and Biomedical Innovation (IHBI), Queensland University of Technology, Brisbane, Australia
... The BPROM promoter prediction program (SoftBerry, Mount Krisco, NY) identified potential
?35 and ?10 bacterial promoter elements at DENV2 cDNA nt positions 53 (TCAACG) and 72
(TTTTTAAT), respectively, which share sequence homology with the wild type E. coli ...
J. Bacteriol.
December 2011 vol. 193 no. 24 6824-6833 doi: 10.1128/JB.05492-11
Mycobacterium smegmatis RoxY Is a Repressor of oxyS and Contributes to Resistance to Oxidative Stress and Bactericidal Ubiquitin-Derived Peptides
Aaron Daugherty, Katelyn M. Powers, Melissa S. Standley, Cathy S. Kim and Georgiana E. Purdy
Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, Oregon 97239
... (D) A diagram of the roxY promoter as well as the homologous synthetic oligonucleotides. The
bent arrow denotes the putative transcription start site and the black boxes the putative ?10
and ?35 regions, respectively, as predicted by Bprom (Softberry, Inc.). ...
BMC Microbiology
2011, 11:259 doi:10.1186/1471-2180-11-259
The small heat shock proteins from Acidithiobacillus ferrooxidans: gene expression, phylogenetic analysis, and structural modeling
Ribeiro et al.,
1 Center for Molecular Biology and Genetic Engineering (CBMEG), State University of Campinas - UNICAMP, Candido Rondon Avenue 400, 13083-875 - Campinas, SP, Brazil
2 National Biosciences Laboratory (LNBio), National Laboratory of Energy and Materials Research (CNPEM), Giuseppe Maximo Scolfaro Street 10000, 13083-970 - Campinas, SP, Brazil
... The alignment was edited with the GeneDoc program [15]. Prediction of the transcription start
site was performed with BPROM software (Softberry, Inc.). A widely accepted theoretical
informational approach was adopted to identify potential ? 32 sites [16,17]. ...
Applied Microbiology and Biotechnology
Volume 90, Issue 6 , pp 1963-1971 DOI: 10.1007/s00253-011-3203-9
Characterization of a gene cluster and its putative promoter region for violacein biosynthesis in Pseudoalteromonas sp. 520P1
Xi Zhang, Keiichi Enomoto
1. Department of Environmental Systems Engineering, Kochi University of Technology, 185 Miyanokuchi, Tosayamada, Kami, Kochi, 782-8502, Japan
... 2008), was obtained by PCR using primers 520P1-before-vioA-Fw2 and 520P1-vioA-
Rv1. Promoter prediction was performed with BPROM software (SoftBerry, Mount Kisco,
NY, USA). Cloning and expression of the violacein gene cluster ...
Appl. Environ. Microbiol.
July 2011 vol. 77 no. 14 4802-4810 doi: 10.1128/AEM.05149-11
Cholesterol Degradation by Gordonia cholesterolivorans
O. Drzyzga 1, L. Fernandez de las Heras 1, V. Morales 2, J. M. Navarro Llorens 1 and J. Perera 1
1Departamento de Bioquimica y Biologia Molecular I, Universidad Complutense de Madrid, 28040 Madrid, Spain
2Departamento de Biologia Medioambiental, Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), 28040 Madrid, Spain
... Putative promoters were analyzed by using the Neural Network Promoter Prediction (NNPP),
Promscan, and BPROM programs (http://www.fruitfly.org/seq_tools/promoter.html,
http://molbiol-tools.ca/promscan/, and http://linux1.softberry.com/berry.phtml, respectively), in ...
Iranian Journal of Microbiology
2011;3(1) : 13-20
The influence of riboflavin and nicotinic acid on Shigella sonnei colony conversion
Dr. Bagher Yakhchali
National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e-Pajoohesh, km 15, Tehran-Karaj Highway, Tehran, Iran.
... CP000038) and analyzed by “Virtual Footprint Online Software” for the presence of OxyR binding
site (19) and by online software “BPROM - Prediction of bacterial promoters of Softberry” for
promoter prediction. All primers were analyzed by in silico simulation of PCR (20). ...
J. Bacteriol.
February 2011 vol. 193 no. 3 611-619 doi: 10.1128/JB.01185-10
The Three Vibrio cholerae Chromosome II-Encoded ParE Toxins Degrade Chromosome I following Loss of Chromosome II
Jie Yuan ,2,3, Yoshiharu Yamaichi 1, and Matthew K. Waldor 1,2
1Channing Laboratory, Brigham and Women's Hospital and Department of Microbiology and Molecular Genetics, Harvard Medical School
2HHMI
... However, bioinformatic analyses of parDE1/3 and parDE2 using BPROM (Softberry, Inc., Mount
Kisco, NY) suggested that, in addition to the expected ParD promoters, P parD1 and P parD2 ,
the parE genes might have their own promoters, P parE1 and P parE2 . ...
Proc. R. Soc.
January 2011 vol. 278 no. 1702 115-121 DOI: 10.1098/rspb.2010.1304
Sources of variation in dietary requirements in an obligate nutritional symbiosis
Kevin J. Vogel* and Nancy A. Moran
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA
... Of the 87 single nucleotide changes, six were located in the region immediately upstream of a
coding region, although none was found in a ?10/?35 promoter region as identified by BPROM
(http://www.softberry.com), suggesting that these mutations have no effect on gene ...
Front Microbiol.
2011; 2: 147. DOI: 10.3389/fmicb.2011.00147
Regulation of Multiple Carbon Monoxide Consumption Pathways in Anaerobic Bacteria
Techtmann et al.,
1Institute of Marine and Environmental Technology, University of Maryland, Baltimore, MD, USA
2Department of the Geophysical Sciences, University of Chicago, Chicago, IL, USA
... These sequences were run through the bprom program (http://softberry.com) to predict the
putative -10 and -35 sites. From this prediction, primers were designed to create a product
that started at the putative -150 site and stretched to start codon. ...
J. Bacteriol.
May 2011 vol. 193 no. 9 2158-2167 DOI: 10.1128/JB.00029-11
Regulation of Type VI Secretion Gene Clusters by ?54 and Cognate Enhancer Binding Proteins
Christophe S. Bernard, Yannick R. Brunet, Marthe Gavioli, Roland Lloubes and Eric Cascales
Laboratoire d'Ingenierie des Systemes Macromoleculaires Institut de Microbiologie de la Mediterranee Aix-Marseille Universite CNRS—UPR9027, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France
... RESULTS. Identification of ? 54 binding boxes.To identify T6SS gene clusters
potentially controlled by ? 54 , we performed a survey using the BProm algorithm
(SoftBerry). The putative ? 54 -dependent T6SS promoter list includes ...
AEM
Published ahead of print 18 November 2011, doi: 10.1128/AEM.07480-11
Genomic and functional analysis of the IncP-1b plasmids pWDL7::rfp and pNB8c explains their role in chloroaniline catabolism
Krol et al.,
1Department of Biological Sciences, Institute for Bioinformatics and Evolutionary Studies, University of Idaho, PO Box 443051, Moscow, ID 83844-3051,U.S.A.
2Department of Microbiology, University of California, Davis, One Shields Avenue, Davis, CA 95616, U.S.A.
... with identity scoring by ClustalW. The pdca promoter region was analyzed using
BPROM 154 (Softberry Inc., Mount Kisco, NY). 155 To infer the phylogenetic
relationships of various IncP-1 plasmids, the deduced amino 156 ...
Archives of Microbiology
Volume 193, Issue 9 , pp 641-650 DOI: 10.1007/s00203-011-0705-x
Genomic analysis of the phenylacetyl-CoA pathway in Burkholderia xenovorans LB400
Patrauchan et al.,
1. Department of Microbiology and Immunology, University of British Columbia, Vancouver, BC, V6T 1Z3, Canada
2. Department of Microbiology and Molecular Genetics, Oklahoma State University, 307 LSE, Stillwater, OK, 74075, USA
... 2001) was used to search for conserved domains and motifs and to validate predicted gene
function. Potential promoter regions were calculated using BPROM software (www.softberry.com)
for paa genes using the gene sequence with a 100-bp upstream fragment. ...
Microbiological Research
Volume 166, Issue 5, 20 July 2011, Pages 403–418 DOI: 10.1016/j.micres.2010.05.003
ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014
Fernandez de Las Heras L, Mascaraque V, Garcia Fernandez E, Navarro-Llorens JM, Perera J, Drzyzga O.
a Departamento de Bioquimica y Biologia Molecular I, Universidad Complutense de Madrid, 28040 Madrid, Spain
b Departamento de Biologia Medioambiental, Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, 28040 Madrid, Spain
... Putative prokaryotic promoters were analysed by the Neural Network Promoter Prediction (NNPP)
server (http://www.fruitfly.org/seq_tools/promoter.html) (Reese et al., 1996), Promscan server
(http://molbiol-tools.ca/promscan/) and Bprom server (http://linux1.softberry.com/berry ...
J. Bacteriol.
May 2011 vol. 193 no. 9 2312-2321 DOI: 10.1128/JB.01355-10
Partial Functional Replacement of CymA by SirCD in Shewanella oneidensis MR-1
Carmen D. Cordova 2, Marcus F. R. Schicklberger 2,#, Yang Yu 2 and Alfred M. Spormann 1,2
1 Departments of Chemical Engineering
2 Civil & Environmental Engineering, Stanford University, Stanford, California
... coli based) (http://www.prodoric.de/vfp/) (29). The BPROM bacterial promoter predictor
was used to identify entire (?35/?10) putative promoter regions (SoftBerry, Mt. Kisco,
NY). E. coli-based predictions were deemed suitable ...
Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166
Antisense RNA associated with biological regulation of a restriction–modification system
Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences
... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator
prediction were performed using the BPROM and FindTerm software, respectively
(http://www.softberry.com/all.htm). RNA secondary structure ...
Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921
The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1
YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture
... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the
& independent terminators were predicted using the BPROM and the FindTerm program
respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...
PLoS Genet
(2011), 7(11): e1002349. doi:10.1371/journal.pgen.1002349
Attenuation of the Sensing Capabilities of PhoQ in Transition to Obligate Insect–Bacterial Association.
Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C
Department of Biology, University of Utah, Salt Lake City, Utah, United States of America
Department of Biological Sciences, Institute of Tropical Medicine, Antwerp, Belgium
... PhoP boxes (inverted text) and putative ribosomal binding site (bold) were identified by visual
inspection of the promoter regions. Putative -35 and -10 regions (underlined) were identified
using the online BPROM tool (SoftBerry, Inc.). doi:10.1371/journal.pgen.1002349.g004. ...
Archives of Microbiology
Volume 193, Issue 4 , pp 263-274 DOI: 10.1007/s00203-010-0669-2
Two promoters and two translation start sites control the expression of the Shigella flexneri outer membrane protease IcsP
Hensley et al.,
1. School of Life Sciences, University of Nevada, 4505 Maryland Parkway, Las Vegas, NV, 89154-4004, USA
2. Department of Molecular Biology, University of Wyoming, Laramie, WY, 82071, USA
... To identify putative promoter sequences, the intergenic region upstream of icsP was
entered into the BPROM program for prediction of promoters regulated by the r70
subunit of RNA polymerase (http://www.linux1. softberry.com). ...
Molecular Microbiology
(2011), 80: 1260–1275. doi: 10.1111/j.1365-2958.2011.07641.x
Antagonistic regulation of dgkA and plsB genes of phospholipid synthesis by multiple stress responses in Escherichia coli.
Wahl, A., My, L., Dumoulin, R., Sturgis, J. N. and Bouveret, E.
LISM, CNRS, Aix-Marseille University, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France.
... ?E-dependent promoter. We ran a search on the dgkA-plsB intergenic sequence for
a putative promoter using a set of bioinformatic servers and got a low hit using BPROM
(http://www.softberry.com/berry.phtml). A +1 transcription ...
Journal of Bioscience and Bioengineering
Volume 112, Issue 5, November 2011, Pages 422–431 DOI: 10.1016/j.jbiosc.2011.07.020
Molecular cloning and characterization of two inducible NAD+-adh genes encoding NAD+-dependent alcohol dehydrogenases from Acetobacter pasteurianus SKU1108
Uraiwan Masud 1, Kazunobu Matsushita 2, Gunjana Theeragool 1, 3
1 Interdisciplinary Graduate Program in Genetic Engineering, The Graduate School, Kasetsart University, Bangkok 10900, Thailand,
2 Department of Biological Chemistry, Faculty of Agriculture, Yamaguchi University, Yamaguchi 753–8515, Japan,
... Based on the E. coli sigma 70 promoter recognition program (BPROM tool of Softberry), the
predicted ? 35 and ? 10 sequences of sigma 70, TTTATT and TGTTTGTAAAAT, were located
from the 961st to 966th and 976th to 987th nucleotide (nt) of the adhI gene, respectively. ...
J. Bacteriol.
May 2011 vol. 193 no. 10 2575-2586 doi: 10.1128/JB.00217-11
Transcription Antitermination by a Phosphorylated Response Regulator and Cobalamin-Dependent Termination at a B12 Riboswitch Contribute to Ethanolamine Utilization in Enterococcus faecalis
Kris Ann Baker and Marta Perego
The Scripps Research Institute, Department of Molecular and Experimental Medicine, La Jolla, California 92037
... In order to determine whether the promoter activity in the eutT-eutG intergenic region
was upstream or downstream from the riboswitch, the sequence of the eutT-eutG
intergenic region was analyzed with the Softberry BPROM program. ...
J. Bacteriol.
May 2011 vol. 193 no. 10 2536-2548 doi: 10.1128/JB.00815-10
Identification of ArgP and Lrp as Transcriptional Regulators of lysP, the Gene Encoding the Specific Lysine Permease of Escherichia coli
Jimena Ruiz ‡, Ina Haneburger and Kirsten Jung
Ludwig-Maximilians-Universitat Munchen, Munich Center for integrated Protein Science (CiPSM) at the Department of Biology I, Microbiology, Grosshaderner Strasse 2-4, 82152 Martinsried, Germany
... Predicted ?35 and ?10 promoter motifs (BProm; http://linux1.softberry.com/berry.phtml?
topic=bprom&group=help&subgroup=gfindb) and the start of transcription (position +1)
previously identified by primer extension analysis (32) are indicated. ...
Antimicrob. Agents Chemother.
April 2011 vol. 55 no. 4 1638-1649 doi: 10.1128/AAC.01366-10
Mutational Analysis of the Thienamycin Biosynthetic Gene Cluster from Streptomyces cattleya
Rodriguez et al.,
Departamento de Biologia Funcional e Instituto Universitario de Oncologia del Principado de Asturias, Universidad de Oviedo, 33006 Oviedo, Spain
... operon thnKJI. Other putative promoter sequences have also been identified for the
ThnI-independent genes (Fig. 1C) by the use of the BPROM bacterial promoter
prediction server (Softberry Inc., Mount Kisco, NY). Upstream of ...
J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11
A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550
Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland
2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy
... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique
terminator region downstream of TTHA1327 were identified using BPROM and
FindTerm (Softberry), respectively. Those findings showed that ...
BMC Genomics
2011, 12:479 doi:10.1186/1471-2164-12-479
Single-nucleotide resolution analysis of the transcriptome structure of Clostridium beijerinckii NCIMB 8052 using RNA-Seq
Yi Wang 1,2, Xiangzhen Li 3, Yuejian Mao 3 and Hans P Blaschek 2,4,5
1 Department of Agricultural and Biological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA
2 Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA
... A prediction of the promoters for primary sigma factors for all the putative HKGs was carried
out using BPROM (http://linux1.softberry.com/berry.phtml webcite). ...
FEMS Microbiology Letters
(2011), 325: 56–63. doi: 10.1111/j.1574-6968.2011.02416.x
Genetic analysis of the pnp–deaD genetic region reveals membrane lipoprotein NlpI as an independent participant in cold acclimatization of Salmonella enterica serovar Typhimurium
Rouf, S. F., Anwar, N., Clements, M. O. and Rhen, M.
BGI
.. Although S. Typhimurium pnp and nlpI are separated by 109 base pairs, the promoter
prediction software bprom (www.Softberry.com) failed to define any tentative nlpI
promoter within this intergenic region (data not shown). ...
Applied Microbiology and Biotechnology
Volume 90, Issue 2 , pp 625-634 DOI: 10.1007/s00253-011-3121-x
Co-transcription of the celC gene cluster in Clostridium thermocellum
Michael Newcomb, Jonathan Millen, Chun-Yu Chen, J. H. David Wu
1. Department of Chemical Engineering, University of Rochester, Room 206 Gavett Hall, Rochester, NY, 14627-0166, USA
2. Novozymes North America Inc., 77 Perry Chapel Church Road, Franklinton, NC, 27525, USA
... The palindromic GlyR3 binding site (Newcomb et al. 2007) is bolded. The ?10 and ?35 sigma
factor binding sites predicted by BProm (http:// linux1.softberry.com/berry. phtml, accessed 3
January 2011) are noted by a solid and a dashed box, respectively 630 ...
BMC Microbiology
2011, 11:90 doi:10.1186/1471-2180-11-90
Integration Host Factor (IHF) binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121
Arvizu-Gomez et al.,
1 Departamento de Ingenieria Genetica, Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional Unidad Irapuato, Apdo Postal 629, CP 36821, Irapuato, Gto, Mexico
2 Laboratorio Nacional de Genomica para la Biodiversidad, Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional, Apdo Postal 629, CP 36821, Irapuato, Gto, Mexico
...we evaluated the presence of putative cis-acting elements within the phtD
promoter region using a transcription factor search program (BPROM, http://www.softberry.com webcite) [26]....
The Journal of Biological Chemistry
November 11, 2011 , 286, 38854-38864, doi: 10.1074/jbc.M111.260992
Identification of a Novel Streptococcal Adhesin P (SadP) Protein Recognizing Galactosyl-a1–4-galactose-containing Glycoconjugates
Kouki et al.,
‡Department of Medical Biochemistry and Genetics, University of Turku, Kiinamyllynkatu 10, Turku FI-20520, Finland,
the ?Department of Biosciences, Division of Biochemistry and Biotechnology, University of Helsinki, P.O.B. 56, Helsinki FI-00014, Finland,
... terminators. SadP was not located in an operon, and promoter sequences typical for
Gram-positive bacteria upstream of the gene and a Rho-independent terminator were
predicted using the program Bprom on the Softberry server. ...
BMC Microbiology
2011, 11:72 doi:10.1186/1471-2180-11-72
Contribution of SecDF to Staphylococcus aureus resistance and expression of virulence factors
Quiblier et al.,
1 Institute of Medical Microbiology, University of Zurich, Gloriastr. 32, 8006 Zurich, Switzerland
2 Division of Infectious Diseases and Hospital Epidemiology, University Hospital Zurich, University of Zurich, Raemistr. 100, 8091 Zurich, Switzerland
...Promoter predictions were performed by BPROM http://linux1.softberry.com/berry.phtml...
J. Bacteriol.
July 2011 vol. 193 no. 13 3207-3219 doi: 10.1128/JB.00044-11
The Anaerobe-Specific Orange Protein Complex of Desulfovibrio vulgaris Hildenborough Is Encoded by Two Divergent Operons Coregulated by ?54 and a Cognate Transcriptional Regulator
Fievet et al.,
1Laboratoire Interactions et Modulateurs de Reponses, Institut de Microbiologie de la Mediterranee, CNRS 13402 Marseille Cedex 20, France
2Laboratoire d'Ingenierie des Systemes Macromoleculaires, Institut de Microbiologie de la Mediterranee, CNRS 13402 Marseille Cedex 20, France
. lactate/sulfate conditions. To characterize the cis elements required for transcription
of the orp1 and orp2 operons, in silico analyses were carried out using the Softberry
(BProm) and PromScan algorithms. These analyses predicted ...
Appl. Environ. Microbiol.
May 2011 vol. 77 no. 9 2823-2830 doi: 10.1128/AEM.02633-10
Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502
Selby et al.,
1Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland
2Center for Biomolecular Sciences, University of Nottingham, Nottingham, United Kingdom
... However, using the bacterial sigma70 promoter recognition software BPROM freeware
(Softberry, Mount Kisco, NY), only one promoter with a ? A binding site was predicted
upstream of the groE operon of C. botulinum strain ATCC 3502. ...
Eukaryotic Cell
December 2011 vol. 10 no. 12 1670-1678 doi: 10.1128/EC.05043-11
Novel Shuttle Markers for Nuclear Transformation of the Green Alga Chlamydomonas reinhardtii
Laurence Meslet-Cladiere† and Olivier Vallon
Centre National de la Recherche Scientifique, Unite Mixte de Recherche 7141/Universite Pierre et Marie Curie, Institut de Biologie Physico-Chimique, Paris 75005, France
... As analyzed using the program BPROM (SoftBerry), the sequence upstream of the CDS, which
by and large corresponds to the first intron of RBCS2, appears to contain a reasonably strong
bacterial promoter (score of 2.93 versus 2.85 for the bla promoter and 5.91 for the ...
PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108
Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence
Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and
bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611
...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the
BProm and TermFind/RNAFold programs (Softberry)....
BMC Plant Biology
2011, 11:64 doi:10.1186/1471-2229-11-64
Evolution of the rpoB-psbZ region in fern plastid genomes: notable structural rearrangements and highly variable intergenic spacers
Lei Gao 1, Yuan Zhou 1, Zhi-Wei Wang 1, Ying-Juan Su 2* and Ting Wang 1
1 CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China
2 State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, China
...The putative promoters were identified by running BPROM [43]....
mBio
doi: 10.1128/mBio.00045-11 3 May 2011 vol. 2 no. 3 e00045-11
Hypervirulent Chlamydia trachomatis Clinical Strain Is a Recombinant between Lymphogranuloma Venereum (L2) and D Lineages
Somboonna et al.,
Center for Immunobiology and Vaccine Development, Children’s Hospital Oakland, Research Institute, Oakland, California, USAa;
Health Sciences Research Institute and School of Natural Sciences, University of California, Merced, Merced, California, USAb;
...The L2c consensus chromosome and plasmid sequences were annotated automatically using the Integrative Services for Genomics Analysis pipeline (16). Promoter 2.0 prediction (http://www.cbs.dtu.dk/services/Promoter/),
Bacterial PROMoter prediction (http://www.softberry.ru/berry.phtml), and ...
(2011), Molecular Microbiology
81: 1271–1285. doi: 10.1111/j.1365-2958.2011.07760.x
Multimodal dynamic response of the Buchnera aphidicola pLeu plasmid to variations in leucine demand of its host, the pea aphid Acyrthosiphon pisum.
Vinuelas et al.,
UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, INSA-Lyon, INRA, Universite de Lyon, Bat. Louis Pasteur, 20 av. Albert Einstein, F-69621 Villeurbanne, France
...putative promoters via the BPROM promoter prediction tool (http://linux1.softberry.com/berry.phtml?topic=gfindb);...
Front Microbiol.
2011; 2: 51. DOI: 10.3389/fmicb.2011.00051
Regulation of Dissimilatory Sulfur Oxidation in the Purple Sulfur Bacterium Allochromatium Vinosum
Frauke Grimm, 1 Bettina Franz, 1,† and Christiane Dahl
Institut fur Mikrobiologie und Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Bonn, Germany
...Promoter prediction for prokaryotic sequence was achieved with Neural Network Promoter Prediction1 and BPROM 2. ...
The Journal of Infectious Diseases
2010;201:414–419
Protein E of Haemophilus influenzae Is a Ubiquitous Highly Conserved Adhesin
Birendra Singh,1
Marta Brant,1
Mogens Kilian,3
Bjorn Hallstrom,2 and
Kristian Riesbeck1
1Medical Microbiology, Department of Laboratory Medicine, University Hospital Malmo, Lund University, Malmo, and 2Department of Cell and Organism Biology, Division of Evolutionary Molecular Systematics, Lund University, Lund, Sweden
... DNA and pe promoter sequences were analyzed by ClustalW2 alignment and BPROM
(Softberry), respectively. The interactive similarity matrix was prepared by EMBOSS
Pairwise Alignment Algorithms (European Bioinformatics Institute). ...
Journal of Economic Entomology
Volume 103, Number 3, June 2010 , pp. 887-897(11)
Limited Endosymbiont Variation in Diuraphis noxia (Hemiptera: Aphididae) Biotypes From the United States and South Africa
Swanevelder, Z. H.; Surridge, A.K.J.; Venter, E.; Botha, A.-M.
... Structural Analysis. Bacterial promoters on the leucine plasmid were predicted with
BPROM (http://softberry.com). ... The plasmids were screened for Rho-independent
terminators using FindTerm (http://softberry.com). Plasmid Copy Numbers. ...
Antimicrob. Agents Chemother.
doi:10.1128/AAC.01062-10
Metallo-{b}-Lactamase Production by Pseudomonas otitidis: a Species-Related Trait
Thaller et al.,
Dipartimento di Biologia, Universita di Roma "Tor Vergata", I-00133 Rome, Italy; Dipartimento di Biologia Molecolare, Sezione di Microbiologia, Universita di Siena, I-53100 Siena, Italy
... phylogenetic trees. Signal peptide cleavage site was predicted using SignalP (version 108 3.0).
Putative promoter sequences were detected using the Bprom software at the 109 Softberry site
(http://linux1.softberry.com/berry.phtml). 110 Nucleotide sequence accession number. ...
PLoS ONE
2010, 5(11): e15528. doi:10.1371/journal.pone.0015528
Activation of the SMU.1882 Transcription by CovR in Streptococcus mutans
Chong P, Chattoraj P, Biswas I
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, Kansas City, Kansas, United States of America
... 1A. Sequence analysis, confirmed using BPROM online software (Prediction of bacterial promoters,
Softberry, http://linux1.softberry.com), indicates the presence of putative -35 (GTGAGT) and -10
(TATAAT) box motifs 151- and 127-bp, respectively, upstream of the putative start ...
Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10
doi:10.1128/JB.01526-09
The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry
Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany
... Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators
were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK
(21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...
Journal of Microbiology
doi:10.1007/s10482-010-9476-7
Characterization of transcription within sdr region of Staphylococcus aureus
Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)
Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland
(2)
Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland
... The presence of putative promoters and transcrip- tional organization of the sdr region was
detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region
611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...
Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09
The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry
Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany
.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators
were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK
(21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...
Journal of Microbiology
doi:10.1007/s10482-010-9476-7
Characterization of transcription within sdr region of Staphylococcus aureus
Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)
Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland
(2)
Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland
... The presence of putative promoters and transcrip- tional organization of the sdr region was
detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region
611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...
J Microbiol.
2010 Jun;48(3):318-24. Epub 2010 Jun 23.
Cel8H, a novel endoglucanase from the halophilic bacterium Halomonas sp. S66-4: molecular cloning, heterogonous expression, and biochemical characterization
Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, PR China.
... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were
predicted using FGENSB and BPROM (http://linux1.softberry.com/berry.phtml). ... Genes in the 3.3
kb DNA fragment were predicted using FGENSB in the softberry website. ...
Nucl. Acids Res.
2010 Volume 38, Issue 22
Pp. 8196-8207 doi: 10.1093/nar/gkq709
Diversity and strength of internal outward-oriented promoters in group IIC-attC introns
Leon G, Quiroga C, Centron D, Roy PH
Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec, Quebec, Canada.
... intron to the nucleotide opposite the start codon of the ORF encoding the IEP on the bottom strand,
using the Neural Network for Promoter Prediction (NNPP) version 2.2 (Berkeley Drosophila
Genome Project, http://www.fruitfly.org/index.html) and BPROM (SoftBerry, http://linux1 ...
Journal of Bacteriology
April 2010, p. 2013-2019, Vol. 192, No. 7, doi:10.1128/JB.01085-09
Precise Excision of IS5 from the Intergenic Region between the fucPIK and the fucAO Operons and Mutational Control of fucPIK Operon Expression in Escherichia coli
Zhongge Zhang, Ming Ren Yen, and Milton H. Saier Jr.
Division of Biological Sciences, University of California at San Diego, La Jolla, California 92093-0116
... Using the SoftBerry BPROM program (http://linux1.softberry.com/berry.phtml?topic=
bprom&group=programs&subgroup=gfindb), the same promoters were identified in the
13-bp deletion and the 7-bp insertion strains but not in the 1-bp insertion strain. ...
Biochimie
Volume 92, Issue 8, August 2010, Pages 1003-1009, doi:10.1016/j.biochi.2010.04.018
The role of a 2-on-2 haemoglobin in oxidative and nitrosative stress resistance of Antarctic Pseudoalteromonas haloplanktis TAC125
Parrilli et al.,
a Dipartimento di Chimica Organica e Biochimica, Universita di Napoli Federico II – Complesso Universitario M.S. Angelo, via Cinthia 4, 80126 Naples, Italy
b Facolta di Scienze Biotecnologiche Universita di Napoli Federico II, Naples, Italy
... This plasmid contains the PSHAa0030 gene and its upstream region (237 bp long), in which
the presence of a putative promoter sequence was predicted by SoftBerry BPROM – Prediction
of bacterial promoters software (http://softberry.com/berry). As shown in Table 3 and Fig. ...
Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10
Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9
Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2
... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc.,
234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator
236 sequences using BPROM and FindTerm programs (Softberry Inc.). ...
Infection and Immunity
January 2010, p. 413-422, Vol. 78, No. 1 doi:10.1128/IAI.00664-09
Human Platelets Recognize a Novel Surface Protein, PadA, on Streptococcus gordonii through a Unique Interaction Involving Fibrinogen Receptor GPIIbIIIa
Petersen et al.,
Department of Oral and Dental Science, University of Bristol, Lower Maudlin Street, Bristol BS1 2LY, United Kingdom,1 Molecular and Cellular Therapeutics, School of Pharmacy, Royal College of Surgeons in Ireland, Dublin 2, Ireland
... Putative promoters with –35 and –10 regions were identified with BPROM software
available from Softberry (Mount Kisco, NY), and putative transcriptional terminator
regions were identified with mfold (37). DNA manipulations. ...
Microbiology
156 (2010), 211-219; DOI 10.1099/mic.0.032342-0
PssA is required for {alpha}-amylase secretion in Antarctic Pseudoalteromonas haloplanktis
Parrilli et al.,
1 Dipartimento di Chimica Organica e Biochimica, Universita di Napoli Federico II – Complesso Universitario M.S. Angelo via Cinthia 4, 80126 Napoli, Italy
2 Facolta di Scienze Biotecnologiche Universita di Napoli Federico II – Complesso Universitario M.S. Angelo via Cinthia 4, 80126 Napoli, Italy
... This plasmid contains both the amy Ct gene and the DNA sequence encoding pssA and its
upstream region (150 bp long), in which the presence of a putative promoter sequence was
predicted (SoftBerry BPROM software: http://linux1.softberry.com/berry.phtml). ...
Infect. Immun.
doi:10.1128/IAI.00736-10
Characterization of a Staphylococcus aureus surface virulence factor promoting resistance to oxidative killing and infectious endocarditis
Malachowa et al.,
Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland; Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institute of Health, Hamilton, MT, 59840, USA;
... server, hydrophobicity (ProtScale), and transmembrane topology (MEMSAT, The PSIPRED
99 Protein Structure Prediction Server). BPROM program (Softberry, Inc. Mount Kisco, NY,
USA) 100 was used to predict bacterial promoter. 101 DNA isolation. ...
Microbiology
156 (2010), 128-138; DOI 10.1099/mic.0.032250-0
myo-Inositol transport by Salmonella enterica serovar Typhimurium
Carsten Kroger 1, Jurgen Stolz 2 and Thilo M. Fuchs 1
1 Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85350 Freising, Germany
2 Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Biochemie, Technische Universitat Munchen, Gregor-Mendel-Str. 2, D-85350 Freising, Germany
... negative species. Promoter sequences located upstream of the identified genes
were predicted with BPROM (http://www.softberry.com/), and transmembrane domains
with TOPCONS (http://topcons.cbr.su.se/). The cladogram ...
FEBS Letters
Volume 584, Issue 21, Pages 4419-4425
A novel secreted metzincin metalloproteinase from Bacillus intermedius
Sabirova et al.,
... nlm.nih.gov) [23]. Promoter regions were identified using the BPROM program
(http://www.softberry.com). Signal peptide was identified using the SignalP 3.0 server
(http://www.cbs.dtu.dk/services/SignalP). The coding region ...
Antimicrobial Agents and Chemotherapy
August 2010, p. 3107-3112, Vol. 54, No. 8 doi:10.1128/AAC.00128-10
Contribution of a Plasmid-Borne blaOXA-58 Gene with Its Hybrid Promoter Provided by IS1006 and an ISAba3-Like Element to b-Lactam Resistance in Acinetobacter Genomic Species 13TU
Chen et al.,
Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei,1 Division of Infectious Diseases, Department of Medicine, Taipei Veterans General Hospital, Taipei,2, Taiwan
... and sequenced. The transcription start site was determined, and conserved motifs
of promoter sequences were identified using the BPROM program (Softberry, Mount
Kisco, NY). Transformation of recombinant plasmids. The ...
Applied and Environmental Microbiology
April 2010, p. 2500-2508, Vol. 76, No. 8 doi:10.1128/AEM.00666-09
Identification of the Biosynthetic Gene Cluster for 3-Methylarginine, a Toxin Produced by Pseudomonas syringae pv. syringae 22d/93
Braun et al.,
Institute of Microbiology, Microbial Phytopathology, University of Jena, Neugasse 25, 07743 Jena, Germany,1 Jacobs University Bremen, School of Engineering and Science, Campus Ring 1, 28759 Bremen, Germany,2
... ClustalX2 (28), and TreeViewX (20). Promoter site prediction was performed with
BPROM software (Softberry Inc., Mount Kisco, NY). Cloning of the SAM-dependent
methyltransferase MrsA. The SAM-dependent methyltransferase ...
Appl. Environ. Microbiol.
doi:10.1128/AEM.01403-10
Ethanolamine utilization contributes to proliferation of Salmonella enterica serovar Typhimurium in food and in nematodes
Shabarinath Srikumar and Thilo M. Fuchs
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany
.. determinate the distribution of the pdu and eut clusters in different serotypes of S. enterica. 133
Promoter sequences located upstream of the identified genes were predicted with BPROM 134
(http://www.softberry.com/). 135 Construction of deletion mutants. ...
Environmental Microbiology
2010. 12: 105–117. doi: 10.1111/j.1462-2920.2009.02049.x
dentification and characterization of new LuxR/LuxI-type quorum sensing systems from metagenomic libraries
Hao, Y., Winans, S. C., Glick, B. R. and Charles, T. C.
1. Department of Biology, University of Waterloo, Waterloo, ON, Canada.
2. Department of Microbiology, Cornell University, Ithaca, NY, USA.
... examined. Using promoter prediction software BPROM (Softberry, Mt. Kisco, NY,
USA) or SAK (Gordon et al., 2003), a possible ? 70 promoter was identified upstream
of both the luxI QS6-1 and luxI QS10-1 regions. Possible ...
INTERNATIONAL MICROBIOLOGY
2010 13:113-121
DOI: 10.2436/20.1501.01.116
Induction, structural characterization, and
genome sequence of Lv1, a prophage from a
human vaginal Lactobacillus jensenii strain
Rebeca Martin, 1 Susana Escobedo, 1 Juan E. Suarez1, 2
1Microbiology Unit, University Institute of Biotechnology, University of Oviedo, Oviedo, Spain.
2Institute of Dairy Products of Asturias-CSIC, Villaviciosa, Spain
... services/TMHMM-2.0/]. Sequences of the s70 pro- moter were
identified using Bprom
[http://www.softberry.com]. Putative ter- minator sequences were detected with the
Terminator function of GCG (ver- sion 10.2). Putative tRNA ...
Journal of Bacteriology
September 2010, p. 4337-4347, Vol. 192, No. 17 doi:10.1128/JB.00359-10
Complete Nucleotide Sequence of TOL Plasmid pDK1 Provides Evidence for Evolutionary History of IncP-7 Catabolic Plasmids
Yano et al.,
Department of Environmental Life Sciences, Graduate School of Life Sciences, Tohoku University, 2-1-1 Katahira, Sendai 980-8577,1 Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa 277-8561, Japan2
... helix, respectively. The putative transcriptional promoter and Rho-independent
terminator were predicted using BPROM and FindTerm, respectively (Softberry).
Nucleotide sequence accession number. Nucleotide sequence ...
Journal of Microbiological Methods
Volume 83, Issue 2, November 2010, Pages 156-163 doi:10.1016/j.mimet.2010.08.004
Novel plasmid-based genetic tools for the study of promoters and terminators in Streptococcus pneumoniae and Enterococcus faecalis
Sofia Ruiz-Cruz a, Virtu Solano-Collado a, Manuel Espinosa a and Alicia Bravo , a,
a Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, Ramiro de Maeztu, 9. E-28040 Madrid, Spain
... A further analysis of the TpolA fragment using the BPROM prediction program (Softberry, Inc.)
revealed a near-consensus 10 hexamer (TAgAAT) located 5 nucleotides downstream of the TpolA
palindrome, as well as a near-consensus extended 10 element (TGTa) (see Fig. ...
Infection and Immunity
March 2010, p. 1176-1184, Vol. 78, No. 3 doi:10.1128/IAI.01014-09
Haemophilus ducreyi SapA Contributes to Cathelicidin Resistance and Virulence in Humans
Mount et al.,
Departments of Microbiology and Immunology,1 Medicine,2 Pathology and Laboratory Medicine,3 Center for Immunobiology, Indiana University School of Medicine, 635 Barnhill Drive, Room MS 420, Indianapolis, Indiana 46202-5124 4
... the 5' end of the sapA clone. Using BPROM software (SoftBerry, Inc., Mount Kisco,
NY), a putative promoter was identified starting 177 bp upstream of tyrR in an
untranslated region. To place the putative promoter upstream of ...
Microbiology
156 (2010), 764-773; DOI 10.1099/mic.0.034645-0
Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum
Frauke Grimm, Nadine Dobler and Christiane Dahl
Institut fur Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Meckenheimer Allee 168, D-53115 Bonn, Germany
... upstream of dsrA. Promoter prediction for prokaryotic sequence was achieved with
Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html)
and BPROM (http://www.softberry.com/berry.phtml). RESULTS. ...
Antimicrob. Agents Chemother.
2010 doi:10.1128/AAC.00491-10
ISAba825, a Functional Insertion Sequence Modulating Genomic Plasticity and blaOXA-58 Expression in Acinetobacter baumannii
Pablo Ravasi, Adriana S. Limansky, Ramiro E. Rodriguez, Alejandro M. Viale, and Maria A. Mussi
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, 2000 Rosario, Argentina
... boxed, and the transcription initiation site (G in bold) resulting from the hybrid 8 promoter
(as determined by 5? RACE-PCR) is indicated by +1. Promoter prediction was 9 done using
BPROM, (http://linux1.softberry.com). The different ATG codons for 10 ...
J. Bacteriol.
2009 doi:10.1128/JB.01185-10
The three Vibrio cholerae chromosome II-encoded ParE toxins degrade chromosome I following loss of chromosome II
Jie Yuan, Yoshiharu Yamaichi, and Matthew K. Waldor
Channing Laboratory, Brigham and Women's Hospital and Department of Microbiology and Molecular Genetics, Harvard Medical School, and HHMI and Immunology Program, Tufts University School of Medicine
... However, bioinformatic analyses of parDE1/3 and parDE2 using BPROM 15 (http://www.softberry.
com/berry.phtml) suggested that in addition to the expected ParD 16 promoters, PparD1, and
PparD2, the parE genes might have their own promoters, PparE1, and PparE2. 17 ...
Proc Biol Sci.
2011 Jan 7;278(1702):115-21. Epub 2010 Jul 28. doi: 10.1098/rspb.2010.1304
Sources of variation in dietary requirements in an obligate nutritional symbiosis
Vogel KJ, Moran NA.
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA
... Of the 87 single nucleotide changes, six were located in the region immediately upstream of a
coding region, although none was found in a ?10/?35 promoter region as identified by BPROM
(http://www.softberry.com), suggesting that these mutations have no effect on gene ...
BMC Microbiology
2010, 10:229 doi:10.1186/1471-2180-10-229
Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans
Esparza M, Cardenas JP, Bowien B, Jedlicki E, Holmes DS.
1 Center for Bioinformatics and Genome Biology, MIFAB, Fundacion Ciencia para la Vida and Depto. de Ciencias Biologicas, Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, Chile
2 ICBM, Faculty of Medicine, University of Chile, Santiago, Chile
... Promoters of the ? 70 -type and rho- independent transcriptional stops were predicted for operons
cbb1-4 using the programs BPROM (http://www.softberry.com) and Transterm [31], respectively.
The organization of gene clusters in facultative and obligate autotrophs involved in ...
BMC Microbiol.
2010 Jul 28;10:202.
Genetic and phenotypic diversity in Burkholderia: contributions by prophage and phage-like elements
Ronning et al.,
J Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA
... replication, and host lysis); (ii) promoter and terminator prediction analysis with BPROM (www.
Softberry.com), PPP ( bioinformatics.biol.rug.nl/websoftware), PROMSCAN [35] or Promoter
Prediction by Neural Network [36]; (iii) prediction of terminators with ...
Antimicrobial Agents and Chemotherapy
October 2010, p. 4389-4393, Vol. 54, No. 10 doi:10.1128/AAC.00155-10
Overexpression of Resistance-Nodulation-Cell Division Pump AdeFGH Confers Multidrug Resistance in Acinetobacter baumannii
Sebastien Coyne, 1 Nicolas Rosenfeld, 1 Thierry Lambert, 1,2 Patrice Courvalin, 1* and Bruno Perichon 1
Institut Pasteur, Unite des Agents Antibacteriens, 75724 Paris Cedex 15,1 Centre d'Etudes Pharmaceutiques, Chatenay-Malabry, France2
... The HelixTurnHelix program (http://mobyle.pasteur.fr/) predicted the presence of a
helix-turn-helix (HTH) DNA-binding motif between residues 11 and 32, typical of the LTTR family.
Sequence analysis of the adeL-adeF intergenic region using BProm software (Softberry, Inc., ...
J. Bacteriol.
2010 doi:10.1128/JB.00752-10
Radiation Desiccation Response Motif (RDRM) like sequences are involved in transcriptional activation of deinococcal ssb gene by ionizing radiation, but not by desiccation
Aman Kumar Ujaoney, Akhilesh A. Potnis, Pratiksha Kane, Rita Mukhopadhyaya, and Shree Kumar Apte
... 3a). In 179 silico analysis of 351 bp region upstream of ssb ORF using BPROM software 180
(http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfin 181 db)
predicted the putative -10 and -35 promoter like sequences, while manual sequence 182 ...
Journal of Bacteriology
April 2010, p. 1965-1974, Vol. 192, No. 7 doi:10.1128/JB.01616-09
Analysis of the dbpBA Upstream Regulatory Region Controlled by RpoS in Borrelia burgdorferi
Zhiming Ouyang, Shayma Haq, and Michael V. Norgard
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas 75390
... When analyzing the 5' sequence upstream of the dbpBA operon using BPROM (http://linux1.
softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), a bacterial 70
promoter recognition program, a typical bacterial 70 promoter harboring canonical –10/–35 ...
Bioscience, Biotechnology, and Biochemistry
Vol. 74 (2010) , No. 8 pp.1564-1571 doi:10.1271/bbb.100135
Effects of Depletion of RNA-Binding Protein Tex on the Expression of Toxin Genes in Clostridium perfringens
Kimihiro ABE 1), Nozomu OBANA 1) and Kouji NAKAMURA 1)
1) Graduate School of Life and Environmental Sciences, University of Tsukuba
... Putative A10 (AATTACTAT) and A35 (TTTAAA) sequences were detected by BPROM software
(http://linux1.softberry.com) 46 and 68nt up- stream of the translational start codon respectively.
These data also suggest that tex is monocistronically transcribed. ...
Appl Microbiol Biotechnol.
2010 Mar;86(2):567-76. Epub 2009 Oct 21
Analysis of extracellular alginate lyase and its gene from a marine bacterial strain, Pseudoalteromonas atlantica AR06
Matsushima et al.,
National Research Institute of Fisheries Science, Fisheries Research Agency, 2-12-4 Fukuura, Yokohama, 236-8648, Japan.
... www. generunner.net/). The promoter motifs and N-terminal signal peptide sequences
were predicted by the BPROM (http:// linux1.softberry.com/berry.phtml) and PSORT
(http://psort. hgc.jp/) programs, respectively. Homology ...
Journal of Bacteriology
July 2010, p. 3780-3787, Vol. 192, No. 14 doi:10.1128/JB.00161-10
Regulation of High-Affinity Iron Acquisition Homologues in the Tsetse Fly Symbiont Sodalis glossinidius
Runyen-Janecky LJ, Brown AN, Ott B, Tujuba HG, Rio RV
Department of Biology, University of Richmond, Richmond, Virginia 23173,1 Department of Biology, West Virginia University, Morgantown, West Virginia 265062
... are shown. The putative –10/–35 sequences and the transcriptional initiation sites,
identified using BPROM (www.softberry.com), are shown as straight lines and
asterisks above the DNA sequences, respectively. The putative ...
ournal of Experimental Microbiology and Immunology (JEMI)
2010 Vol. 14: 74-78
Confirmation of Caspase-3-Like-Protease, Clp, in Pseudomonas aeruginosa as an Individually Regulated Gene and its Involvement in Healthy Colony Formation
wenn Farrell, Alexis Handley, Carol Lewis and Alexander Sio
Department of Microbiology and Immunology, UBC
... high homology. The putative operon PA4577-fklB gene sequence found in the
Pseudomonas Genome Database V2 was searched using BPROM on
www.softberry.com for promoter and manually searched for stop codons. The ...
Infection and Immunity
June 2010, p. 2607-2619, Vol. 78, No. 6 Epub 2010 Apr 12. doi:10.1128/IAI.00134-10
Francisella tularensis dpyrF Mutants Show that Replication in Nonmacrophages Is Sufficient for Pathogenesis In Vivo
Horzempa J, O'Dee DM, Shanks RM, Nau GJ
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261, USA
... 2. Promoter characterization of F. tularensis pyrF. (A) Genomic arrangement of pyrF where
the three predicted –10 and –35 promoter regions are shaded (BPROM; www.softberry.
ru). The start codon of pyrF is boxed and in boldface type. ...
Genetics
Vol. 185, 823-830, July 2010, doi:10.1534/genetics.110.114462
IscR Regulates RNase LS Activity by Repressing rnlA Transcription
Otsuka et al.,
* Department of Biological Sciences, Graduate School of Science, Osaka University, Osaka 560-0043, Japan and {dagger} Division of Life Science, Graduate School of Science and Engineering, Saitama University, Saitama 338-8570, Japan
... Although a promoter corresponding to these sites was not predicted by GENETYX, another
program, BPROM (http://linux1.softberry.com/berry.phtml?topic=bprom&group=
programs&subgroup=gfindb), identified a promoter matching these sites as transcription start ...
Journal of Molecular Biology
Volume 399, Issue 5, 25 June 2010, Pages 759-772 doi:10.1016/j.jmb.2010.04.040
A Bacterial GAP-Like Protein, YihI, Regulating the GTPase of Der, an Essential GTP-Binding Protein in Escherichia coli
Jihwan Hwang and Masayori Inouye
Department of Biochemistry, Center for Advanced Biotechnology and Medicine, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, 679 Hoes Lane, Piscataway, NJ 08854, USA
... The - 35, - 10, and Shine–Dalgarno regions are underlined. The putative promoter sequence
was also predicted by using BPROM (available at http://www.softberry.com.). "+ 1" is the
transcriptional start site, and "M" is the initiation methionine codon. ...
PLoS ONE
2010 5(1): e8601. doi:10.1371/journal.pone.0008601
Sequence Analysis of pKF3-70 in Klebsiella pneumoniae: Probable Origin from R100-Like Plasmid of Escherichia coli
Yi et al.,
1 Institute of Biomedical Informatics/Zhejiang Provincial Key Laboratory of Medical Genetics, Wenzhou Medical College, Wenzhou, China, 2 T-Life Research Center, Fudan University, Shanghai, China
... CD-search was used to identify the conserved domains in some uncharacterized proteins [47].
Promoters were predicted using BPROM (http://linux1.softberry.com/berry.phtml) and insertion
sequences were predicted using IS-finder (http://www-is.biotoul.fr/is.html). ...
New Biotechnology
Volume 27, Issue 1, 28 February 2010, Pages 1-9 doi:10.1016/j.nbt.2009.12.003
Isolation of novel Pseudomonas syringae promoters and functional characterization in polyhydroxyalkanoate-producing pseudomonads
Daniel K.Y. Solaiman and Bryan M. Swingle
1 Eastern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 600 E. Mermaid Lane, Wyndmoor, PA 19038, USA
2 R.W. Holley Center for Agriculture and Health, Agricultural Research Service, U.S. Department of Agriculture, Tower Rd., Ithaca, NY 14853-2901, USA
... 4a). We next subjected the sequence in pBS29-P2-gfp that includes the P2 promoter and
the coding region of the gfp gene to a promoter and transcription factor (TF) analysis using
a BPROM program (www.softberry.com, Mount Kisco, NY, USA). ...
PLoS ONE
2010 5(5): e10877. doi:10.1371/journal.pone.0010877
The GimA Locus of Extraintestinal Pathogenic E. coli: Does Reductive Evolution Correlate with Habitat and Pathotype?
Homeier T, Semmler T, Wieler LH, Ewers C
1 Institute for Microbiology and Epizootics, Veterinary Faculty, Free University Berlin, Berlin, Germany, 2 Institute of Animal Hygiene and Veterinary Public Health, Faculty of Veterinary Medicine, University of Leipzig, Leipzig, Germany
... in the remnant. Additionally, using the BPROM promoter prediction tool (provided
on http://linux1.softberry.com) we could identify a transcriptional factor binding site
upstream of the start codon (data not shown). However, it is ...
Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010
Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...
Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035
Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...
Molecular Microbiology
Volume 77, Issue 4, pages 1009–1020, August 2010 DOI: 10.1111/j.1365-2958.2010.07269.x
Functional amyloid in Pseudomonas
Dueholm et al.,
1 Centre for Insoluble Protein Structures, Interdisciplinary Nanoscience Center (iNANO), Department of Molecular Biology, University of Aarhus (iNANO), 8000 Aarhus C, Denmark
2 Department of Biotechnology, Chemistry, and Environmental Engineering, Aalborg University, 9000 Aalborg, Denmark
... Sequence coverage was calculated by reference genome assembly of reads to the aligned
sequence using the CLC Genomics Workbench 3.0.1. Promotor regions were predicted using
BPROM (http://linux1.softberry.com/berry.phtml). Cloning of pMMB190-UK4fapA–F. ...
BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153
Transcriptome analysis of the mobile genome ICEclc in Pseudomonas knackmussii B13
Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland
... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were
predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map
of ICEclc was designed from SeqBuilder of the Lasergene software package ...
Journal of Bacteriology
January 2009, p. 333-346, Vol. 191, No. 1
Characterization of YmgF, a 72-Residue Inner Membrane Protein That Associates with the Escherichia coli Cell Division Machinery
Gouzel Karimova, Carine Robichon, and Daniel Ladant
Institut Pasteur, CNRS URA 2185, Unite de Biochimie des Interactions Macromoleculaires, Departement de Biologie Structurale et Chimie, 25 rue du Dr Roux, Paris Cedex 15, France
... Bacterial promoter recognition programs (E. coli promoter map from nostradamus.cs.rhul.
ac.uk/vigen (30); BPROM from SoftBerry, Inc.) predicted a putative promoter within a 60-bp
DNA fragment immediately upstream from the ymgF ORF start codon. ...
Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080
Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing
Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA
... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table
2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent
terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...
Journal of Bacteriology
July 2009, p. 4427-4440, Vol. 191, No. 13
A Metabolic Operon in Extraintestinal Pathogenic Escherichia coli Promotes Fitness under Stressful Conditions and Invasion of Eukaryotic Cells
Rouquet et al.,
INRA, UR1282, Unite d'Infectiologie Animale et de Sante Publique, Laboratoire de Pathogenie Bacterienne, Centre de Recherche de Tours, F-37380 Nouzilly, France
... program. Putative 70 transcriptional promoters (bent arrows) and transcriptional
terminators ( ) were predicted with the BPROM (SoftBerry, Inc.) and the mfold
(www.bioinfo.rpi.edu/ ~ zukerm/rna/) programs, respectively. Direct ...
Archives of Microbiology
Volume 191, Number 5 / May, 2009, pp. 441-450
Localization and characterization of VVA0331, a 489-kDa RTX-like protein, in Vibrio vulnificus YJ016
Li-Fang Chou 1 , Hwei-Ling Peng2, Yu-Chung Yang 2, Min-Chieh Kuo 1 and Hwan-You Chang 1
(1) Institute of Molecular Medicine, National Tsing Hua University, Hsin Chu, Taiwan, ROC
(2) Department of Biological Science and Technology, National Chiao Tung University, 300 Hsin Chu, Taiwan, ROC
... 2005) and the program BPROM (SoftBerry, Mount Kisco, NY). Our results demonstrate
that VVA0331 protein was secreted from V. vulniWcus YJ016 in exponential growth
phase. Nevertheless, the functional roles of VVA0331 Fig. ...
PLoS Genet.
2009 March; 5(3): e1000439.
A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element
Rachel A. F. Wozniak 1,2,3 and Matthew K. Waldor 1,2,3*
1Channing Laboratory, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, United States of America
2Howard Hughes Medical Institute, Chevy Chase, Maryland, United States of America
... 5? RACE experiments to identify the +1 nucleotide of the mosA transcript (Figure 5B) suggested
that the true mosA transcript begins upstream from the original annotation (Figure 5). Promoter
and ORF predictions (BProm, FGENESB; http://linux1.softberry.com/berry.phtml) for ...
Journal of Bacteriology
April 2009, p. 2530-2540, Vol. 191, No. 8
Interplay between Two RND Systems Mediating Antimicrobial Resistance in Brucella suis
Martin et al.,
Fundacion Instituto Leloir, IIBBA CONICET and FCEyN, Universidad de Buenos Aires, Patricias Argentinas 435, (C1405BWE) Buenos Aires, Argentina,1 Instituto de Biotecnologia, CICVyA, INTA-Castelar, Las Cabanas y Los Reseros s/n (B1712WAA) Castelar, Buenos Aires, Argentina,2
... bepDE. Our analysis using the promoter prediction software BPROM (SoftBerry Inc.)
indicated the presence of two overlapping and divergent putative promoters within
the 172-bp intergenic region between bepR and bepD (Fig. ...
BMC Microbiology
2009, 9:247 doi:10.1186/1471-2180-9-247
Transcriptional analysis of the jamaicamide gene cluster from the
marine cyanobacterium Lyngbya majuscula and identification of
possible regulatory proteins
Adam C Jones 1, Lena Gerwick 1, David Gonzalez 2,3, Pieter C Dorrestein 2,3,4,5
and William H Gerwick *1,5
1Center for Marine Biotechnology and Biomedicine, Scripps Institution of Oceanography, University of California San Diego, 9500
Gilman Drive, La Jolla, CA 92093 USA, 2Department of Chemistry, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093
USA
... [22]. A software prediction program (BPROM, www.softberry.com) was used to predict ... for conserved
binding regions (in comparison to the?70 E. coliconsensus promoter) using the BPROM predictor
(www.softberry.com; Table 1). The upstream (up-) regions of genes ...
Gene
Volume 442, Issues 1-2, 1 August 2009, Pages 1-7
Characterization of the Haloarcula hispanica amyH gene promoter, an archaeal promoter that confers promoter activity in Escherichia coli
Zeng et al.,
aState Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China
bSchool of Biology and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan 430023, PR China
... In addition, computer analysis of the 5?-flanking region using the BPROM program
(http://www.softberry.com) revealed a typical E. coli ? 70 promoter structure located ? 86 to ?
59 bp upstream of the amyH start codon, where the putative ? 10 box (TAGAAT) matches the ...
Journal of Bacteriology
March 2009, p. 1933-1940, Vol. 191, No. 6
Analysis by Mutagenesis of a Chromosomal Integron Integrase from Shewanella amazonensis SB2BT
Andre Larouche 1,2 and Paul H. Roy 1,2
Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec,1 Departement de Biochimie et de Microbiologie, Faculte des Sciences et de Genie, Universite Laval, Quebec, Canada2
... There is no ORF between attC2 and attC3. The promoter recognition program BPROM sigma70
(http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)
indicates that a mobile promoter region could be within this cassette. ...
Antimicrobial Agents and Chemotherapy
May 2009, p. 1998-2004, Vol. 53, No. 5
Genetic Organization of Transposase Regions Surrounding blaKPC Carbapenemase Genes on Plasmids from Klebsiella Strains Isolated in a New York City Hospital
Gootz et al.,
Department of Infectious Diseases,1 Molecular Biology, Pfizer Global Research and Development, Groton, Connecticut 06340
... primers: CETnF1 (5'-CATGGCGTAGGTTGTTGTCGC) and CETnR1 (5'-
GCGGCAGAAGCCAAAATCG). Promoter analysis for all 15 bla KPC genes was
determined using the BProm software (http://www.softberry.com). RESULTS. ...
Journal of Bacteriology
January 2009, p. 403-410, Vol. 191, No. 1
The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor
Arnadottir et al.,
Institute for Experimental Pathology, University of Iceland, Keldur v/Vesturlandsveg, IS-112 Reykjavik, Iceland,1 Institute for Veterinary Bacteriology, University of Bern, Langastrasse 122, Postfach, CH-3001, Bern, Switzerland2
... html). Prediction of promoter sequences was performed with the software Prediction
of Bacterial Promoters (BPROM) (Softberry) and Prokaryotic Promoter Prediction
(PPP) (http://bioinformatics.biol.rug.nl/websoftware/ppp). The ...
Applied and Environmental Microbiology
October 2009, p. 6581-6590, Vol. 75, No. 20
ACC (1-Aminocyclopropane-1-Carboxylate) Deaminase Activity, a Widespread Trait in Burkholderia Species, and Its Growth-Promoting Effect on Tomato Plants
Janette Onofre-Lemus,1 Ismael Hernandez-Lucas,2 Lourdes Girard,1 and Jesus Caballero-Mellado1
Centro de Ciencias Genomicas, Universidad Nacional Autonoma de Mexico, Ap. Postal No. 565-A, Cuernavaca, Morelos, Mexico,1 Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico2
... In silico analysis of the resulting sequence was performed with the programs FGENESB,
BPROM (http://linux1.softberry.com/berry.phtml), and virtual footprint promoter analysis
version 3.0 (http://www.prodoric.de/vfp/vfp_promoter.php). ...
Applied and Environmental Microbiology
July 2009, p. 4506-4515, Vol. 75, No. 13
bdhA-patD Operon as a Virulence Determinant, Revealed by a Novel Large-Scale Approach for Identification of Legionella pneumophila Mutants Defective for Amoeba Infection
P. Aurass, B. Pless, K. Rydzewski, G. Holland, N. Bannert, and A. Flieger
Robert Koch Institute, Berlin, Germany
... _legion). Nucleotide sequences were also analyzed for promoters using the
Web-based program BPROM (www.softberry.com) and for secretion signals using
the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP). ...
BMC Microbiol.
2009 Jul 27;9:151.
A new cold-adapted beta-D-galactosidase from the Antarctic Arthrobacter sp. 32c - gene cloning, overexpression, purification and properties
Hildebrandt P, Wanarska M, Kur J.
Department of Microbiology, Chemical Faculty, Gdansk University of Technology, Narutowicza 11/12, 80-952 Gdansk, Poland.
... 32c b-D-galactosidase gene with the promoter prediction tool (BPROM software,
http://www.softberry.com) revealed a potential promoter sequence with CTTACA and TACAAT
as -35 and -10 sequences, respectively. A putative ribosomal binding site was ...
Current Genetics
Volume 55, Number 5 / October, 2009, pp. 583-591
Identification of transcribed and persistent variants of the psbA gene carried by plastid minicircles in a dinoflagellate
Satoko Iida 1, Atsushi Kobiyama 2, Takehiko Ogata 2 and Akio Murakami 1
1) Kobe University Research Center for Inland Seas, 2746 Iwaya, Awaji 656-2401, Japan
(2) School of Marine Biosciences, Kitasato University, 160-4 Okiraiazautou, Sanriku, Ofunato 022-0101, Japan
... nlm.nih.gov/projects/gorf/). A start codon was assigned based on sequence alignment, upstream
in-frame TAG and no ATG around the psbA 5 end. Predictions of prokary- otic-type promoters
were performed using BPROM pro- grams (http://www.softberry.com). ...
FEMS Microbiol Lett.
2009 Jun;295(1):96-102.
Transcriptome analysis of Escherichia coli O157:H7 EDL933 during heat shock
Carruthers MD, Minion C.
Department of Veterinary Microbiology and Preventive Medicine, Iowa State University, Ames, IA, USA.
... Z5121). Motifs were deemed significant if identified by BIOOPTIMIZER using both
MEME and BIOPROSPECTOR output as input. BPROM (http:// www.softberry.com)
was used for promoter prediction. Validation of microarray data ...
Nucleic Acids Research
2009 37(16):5465-5476; doi:10.1093/nar/gkp501
Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence
Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence
Department of Microbiology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA
... determined (15,28). In addition, promoter predictions were generated using the
Softberry BPROM network server and the Neural Network Promoter Prediction by
the BDGP using prokaryotic settings. The sequences analyzed ...
BMC Microbiology
2009, 9:7doi:10.1186/1471-2180-9-7
Characterization of the meningococcal DNA glycosylase Fpg involved in base excision repair
Tibballs et al.,
1 Centre for Molecular Biology and Neuroscience and Institute of Microbiology, University of Oslo, Rikshospitalet, NO-0027 Oslo, Norway
2 Institute of Microbiology, Rikshospitalet, NO-0027 Oslo, Norway
... Putative promoters were identified with the transcription promoter predictor available at the
Berkeley Drosophila Genome Project http://www.fruitfly.org/seq_tools/promoter.html webcite and
the BPROM predictor of bacterial promoters http://www.softberry.com/berry.phtml webcite ...
In Silico Biology
Volume 9, Number 1-2 / 2009, pp. S1-S16
Analysis of n-Gram based Promoter Recognition Methods and Application to Whole Genome Promoter Prediction
T. Sobha Rani 1, Raju S. Bapi 1
1Computational Intelligence Lab, Department of Computer and Information Sciences, University of Hyderabad, Hyderabad, India
... TATA box and Inr (Neural Network Promoter Predictor, indicated as a tool for promoter prediction
of both prokaryotes and eukaryotes) (http://www.fruitfly.org/seq tools/promoter.html), BPROM
uses functional motifs and oligonucleotide information (http://www.softberry.com/berry ...
Journal of Microbiological Methods
Volume 79, Issue 1, October 2009, Pages 23-31
Characterization of pNC1, a small and mobilizable plasmid for use in genetic manipulation of Desulfovibrio africanus
I. Nydia Castaneda-Carrion, Marvin Whiteley and Lee R. Krumholz
aDepartment of Botany and Microbiology, University of Oklahoma, Norman, OK 73019, United States
bSection of Molecular Genetics and Microbiology, University of Texas at Austin, Austin, TX 78712, United States
... et al., 2002). ORFs greater than 300 nucleotides long were compared to the GenBank
protein database using the blastp algorithm (Altschul et al., 1997). Promoters were
detected by BPROM from Softberry. Direct repeats and ...
Appl. Environ. Microbiol.
doi:10.1128/AEM.01864-09 2009
Functional genomic analysis of two Staphylococcus aureus phages isolated from the dairy environment
Garcia et al.,
Instituto de Productos Lacteos de Asturias (IPLA-CSIC). Apdo. 85. 33300- Villaviciosa, Asturias, Spain; Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven, Belgium;
... YASPIN (http://www.ibi.vu.nl/programs/yaspinwww/). s70 promoter sequences were identified
using Bprom (http://www.softberry.com) and PPP (Prokaryotic Promoter Prediction,
http://bioinformatics.biol.rug.nl/websoftware/ppp/ppp_start.php). Putative ...
The Journal of Infectious Diseases
2009;199:513–521
Penicillin-Binding Protein 7/8 Contributes to the Survival of Acinetobacter baumannii In Vitro and In Vivo
Russo et al.,
Veterans Administration Western New York Healthcare System and 2The Witebsky Center for Microbial Pathogenesis
... Finally, a promoter prediction analysis was performed on the 5' DNA sequence to the
predicted transcriptional start site of pbpG (BPROM [SoftBerry]; available at: http://www.softberry.
com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Journal of Bacteriology
May 2009, p. 3142-3148, Vol. 191, No. 9 doi:10.1128/JB.01575-08
Isolation and Characterization of Azotobacter vinelandii Mutants Impaired in Alkylresorcinol Synthesis: Alkylresorcinols Are Not Essential for Cyst Desiccation Resistance
Segura et al.,
Departamento de Microbiologi'a Molecular, Instituto de Biotecnologi'a, Universidad Nacional Auto'noma de Me'xico, Cuernavaca, Morelos, Me'xico,1 Centro de Investigaciones en Ciencias Microbiolo'gicas, Beneme'rita Universidad Auto'noma de Puebla, Puebla, Me'xico2
... nucleotides in each case. In addition, no promoter consensus sequences were
identified in the 83-nucleotide intergenic arsA-arsB sequence (SoftBerry BPROM
program; http://linux1.softberry.com/berry.phtml). Because a mutation ...
Plasmid
Volume 62, Issue 1, July 2009, Pages 44-49
Characterization of a cryptic plasmid pSFKW33 from Shewanella sp. 33B
Katarzyna Werbowy a, Hubert Cies'lin'ski a, and Jo'zef Kur
aDepartment of Microbiology, Chemical Faculty, Gdan'sk University of Technology, Narutowicza 11/12, 80-952 Gdan'sk, Poland
... The prediction of bacterial promoters was carried out with BPROM software (www.softberry.com). ...
Furthermore, the analysis of DNA sequence upstream ORF3 with the promoter prediction tool
(BPROM software, http://www.softberry.com) revealed a potential promoter sequence. ...
Biochem. J.
2009, 418, 431–441 (Printed in Great Britain) doi:10.1042/BJ20081488
Characterization of the phenylurea hydrolases A and B: founding members
of a novel amidohydrolase subgroup
KHURANA et al.,
CSIRO Entomology, Canberra, ACT 2601, Australia, and †Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia
... Genomic and phylogenetic analysis FGENESB (http://www.softberry.com) was used to
detect ORFs (open reading frames), which were then manually confirmed. ... Identification
of promoters utilized the program BPROM (http://www.softberry.com). ...
Journal of Bacteriology
October 2009, p. 5953-5963, Vol. 191, No. 19 doi:10.1128/JB.00647-09
The pgaABCD Locus of Acinetobacter baumannii Encodes the Production of Poly-?-1-6-N-Acetylglucosamine, Which Is Critical for Biofilm Formation
Alexis H. K. Choi, Leyla Slamti, Fikri Y. Avci, Gerald B. Pier, and Tomas Maira-Litran
Channing Laboratory, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts
... of molecular biology applications (http://www.emboss.org/). Promoter prediction was
done with BPROM (http://www.softberry.com/all.htm) (Softberry, Inc., Mt. Kisco, NY).
PNAG purification. PNAG was prepared from a 6-liter culture ...
Microbiology
155 (2009), 2490-2497; DOI 10.1099/mic.0.027433-0
SoxS regulates the expression of the Salmonella enterica serovar Typhimurium ompW gene
Hernandez-Lucas et al.,
1 Laboratorio de Microbiologi'a Molecular, Departamento de Ciencias Biolo'gicas, Universidad Andre's Bello, Santiago, Chile
2 Departamento de Microbiologi'a Molecular, Instituto de Biotecnologi'a, Universidad Nacional Auto'noma de Me'xico, Cuernavaca, Mexico
3 Laboratorio de Bioqui'mica, Departamento de Ciencias Biolo'gicas, Universidad Andre's Bello, Santiago, Chile
... To support these results, a bioinformatic search was performed using the Softberry BPROM
program (www.softberry.com/berry.phtml? Topic=bprom). Thus, a 400 bp region upstream of
the start codon was analysed for putative -35 and -10 promoter regions. ...
Appl. Environ. Microbiol.
2009 doi:10.1128/AEM.01366-09
Long term survival of Campylobacter jejuni at low temperature is dependent on polynucleotide phosphorylase activity
Nabila Haddad et al.,
Division
... 210 Transcriptional start site was predicted using Softberry BPROM program 211
(http://linux1.softberry.com/cgi-bin/programs/gfindb/bprom.pl). ... Therefore, a putative transcriptional
start site was identified 100 bp from the start codon by 242 Softberry-BPROM programme (Fig. ...
Applied and Environmental Microbiology
March 2009, p. 1471-1477, Vol. 75, No. 6
Role of proP and proU in Betaine Uptake by Yersinia enterocolitica under Cold and Osmotic Stress Conditions
Thirunavukkarasu Annamalai 1 and Kumar Venkitanarayanan 2
Department of Biochemistry and Molecular Biology, New York Medical College, Valhalla, New York 10595,1 Department of Animal Science, Unit 4040, University of Connecticut, Storrs, Connecticut 062692
... extracted plasmid DNA. The sequences generated were analyzed by using
Sequencher 4.1.4 (Gene Codes Corporation, Ann Arbor, MI), BPROM (http://www.
softberry.com), ClustalW (EMBnet), and Blastn (NCBI). View this table ...
Biochem. J.
2009, 418, 431–441 (Printed in Great Britain) doi:10.1042/BJ20081488
Characterization of the phenylurea hydrolases A and B: founding members
of a novel amidohydrolase subgroup
KHURANA et al.,
CSIRO Entomology, Canberra, ACT 2601, Australia, and †Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia
... Genomic and phylogenetic analysis FGENESB (http://www.softberry.com) was used to
detect ORFs (open reading frames), which were then manually confirmed. ... Identification
of promoters utilized the program BPROM (http://www.softberry.com). ...
J Bacteriol.
2009 Vol. 191, No. 1, p. 210-219
Interaction between bacteriophage DMS3 and host CRISPR region inhibits group behaviors
of Pseudomonas aeruginosa
Zegans et al.
Dept. of Microbiology & Immunology, Rm 505 Vail Building, Dartmouth Medical School, Hanover, NH 03755; Department of Surgery, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756
... the forward 161 and reverse strands, and with BPROM bacterial promoter predictor
(Softberry, Mt. Kisco, NY; 162 http://www.softberry ...
Journal of Bacteriology
January 2009, p. 545-554, Vol. 191, No. 2
Characterization of the myo-inositol utilization island of 2 Salmonella
enterica serovar Typhimurium
Kroger C, Fuchs TM
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie,
Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany
.. species. Promoter sequences located upstream of the identified genes were
predicted with 114 BPROM (http://www.softberry.com/). 115 ...
Appl. Environ. Microbiol.
2008. doi:10.1128/AEM.01644-08
Characterizing the role of proP and proU in betaine uptake by Yersinia enterocolitica during cold and osmotic stress
Thirunavukkarasu Annamalai and Kumar Venkitanarayanan
Department of Biochemistry and Molecular Biology, New York Medical College Valhalla, NY 10595; Department of Animal Science, Unit-4040, University of Connecticut, Storrs 06269
... The sequences generated were analyzed by Sequencher 2 4.1.4 (Gene Codes
Corporation, Ann Arbor, MI), BPROM (http://www.softberry.com), 3 ...
In Silico Biology
8, 0042 (2008)
Analysis of n-gram based promoter recognition methods and application to whole genome promoter prediction
T. Sobha Rani and Raju S. Bapi
Computational Intelligence Lab, Department of Computer and Information Sciences, University of Hyderabad, Hyderabad, India
... and eukaryotes) (http://www.fruitfly.org/seq_tools/promoter.html), BPROM uses
functional motifs and oligonucleotide information (http://www.softberry.com/berry ...
Genes & Dev.
2008. 22: 3497-3508 doi: 10.1101/gad.1729508
YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
Kwang-sun Kim, Robert Manasherob, and Stanley N. Cohen
Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA
... 2007), as well as ymdB, were identified using BPROM (Softberry, Inc.)-which detects
consensus sequences for RNA polymerase ? 70 recognition sites (Campbell ...
BMC Microbiol.
2008; 8: 214. doi: 10.1186/1471-2180-8-214.
Insecticidal genes of Yersinia spp.: taxonomical distribution, contribution to toxicity towards Manduca sexta and Galleria mellonella, and evolution
Fuchs et al.,
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Germany
... TREECON [28]. Promoter sequences located upstream of the identified genes
were deduced with BPROM http://www.softberry.com/. The ...
BMC Genomics
2008, 9:229 doi:10.1186/1471-2164-9-229
Photorhabdus luminescens genes induced upon insect infection
Anna Munch, Lavinia Sting, Kirsten Jung and Ralf Heermann
1Ludwig-Maximilians-Universitat Munchen, Department Biologie I, Bereich Mikrobiologie, Maria-Ward-Str. 1a, D-80638 Munchen,
Germany, 2Munich Center for Integrated Protein Science (CIPSM), Ludwig-Maximilians-Universitat Munchen, Munchen, Germany,
.. analysis using the software BProm. ... BProm within the sequence of clone 1.
In summary, 29 promoters of different genes or operons ...
Antimicrob Agents Chemother.
2008 Jul;52(7):2573-80. Epub 2008 Apr 28
Acquisition of a plasmid-borne blaOXA-58 gene with an upstream IS1008 insertion conferring a high level of carbapenem resistance to Acinetobacter baumannii
Chen TL, Wu RC, Shaio MF, Fung CP, Cho WL
Division of Infectious Diseases, Department of Internal Medicine, Taipei Veterans General Hospital, Taipei, Taiwan
... RACE fragments and conserved motifs. Promoter sequences were identified
using the BPROM program. RT-PCR. Bacterial RNA was isolated ...
J Bacteriol.
2008 Oct 24. [Epub ahead of print]
The AsaP1 peptidase of Aeromonas salmonicida subsp. achromogenes is a highly conserved deuterolysin metalloprotease (family M35) and a major virulence factor
Arnadottir et al.
.. Prediction of Bacterial Promoters (BPROM), http://www.softbery.com, and Prokaryotic
145 ACCEPTED at Google Indexer on November 18, 2008 jb.asm.org ...
Mol Genet Genomics.
2008 Jul;280(1):59-72. Epub 2008 Apr 30
Global consequences of phosphatidylcholine reduction in Bradyrhizobium japonicum.
Hacker S, Godeke J, Lindemann A, Mesa S, Pessi G, Narberhaus F.
Lehrstuhl fur Biologie der Mikroorganismen, Ruhr-Universitat Bochum, NDEF 06/783, 44780 Bochum, Germany.
The BPROM program (http://www.softberry.com/berry.phtml) predicts a s70-type-10 promotor region (TACAAT) located about 85 bp upstream from the ATG start codon.
Appl Environ Microbiol.
2008 Jan;74(1):336-41. Epub 2007 Nov 16
Genomic markers for differentiation of Francisella tularensis subsp. tularensis A.I and A.II strains.
Molins-Schneekloth CR, Belisle JT, Petersen JM
Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases, Bacterial Diseases Branch, 3150 Rampart Road, Fort Collins, CO 80521, USA
.. RDs within intergenic regions were analyzed for putative promoter sequences (BPROM).
See Table S2 in the supplemental material for a summary of this analysis. ...
Appl Environ Microbiol.
2008 Dec;74(24):7552-60. Epub 2008 Oct 24
Isolation of new stenotrophomonas bacteriophages and genomic characterization of temperate phage s1
Garcia et al.
Area de Microbiologi'a, Facultad de Medicina, Universidad de Oviedo, Asturias, Spain.
... (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Likely ? 70 target promoter 19 sequences
were identified using Bprom (http://www.softberry.com). Putative 20 ...
FEMS Microbiol Lett.
2008 Jun;283(1):36-41
Effect of growth conditions on poly-N-acetylglucosamine expression and biofilm formation in Escherichia coli
Cerca N, Jefferson KK
Department of Microbiology and Immunology, Virginia Commonwealth University, Richmond, VA, USA
... We investigated the possible role of other regulators in pga expression, and analysis
of the pga promoter region using the BPROM online promoter analysis tool ...
Biochem. J.
(2008) Immediate Publication, doi:10.1042/BJ20081488
Characterization of the phenylurea hydrolases A and B:
founding members of a novel amidohydrolase subgroup
Khurana et al.
Division of Entomology, CSIRO, Canberra, ACT 2601, Australia.
.. Search Tools (BLAST; [23]). Identification of promoters utilised the program
BPROM (http://www.softberry.com). BioEdit version 7.0 ...
Antimicrob Agents Chemother.
2008 Jul;52(7):2473-9. Epub 2008 Apr 28
Functional diversity among metallo-beta-lactamases: characterization of the CAR-1 enzyme of Erwinia carotovora
Stoczko M, Frere JM, Rossolini GM, Docquier JD
Dipartimento di Biologia Molecolare, Laboratorio di Fisiologia e Biotecnologia dei Microrganismi, Universita` di Siena, I-53100, Siena, Italy
... predicted using SignalP (version 3.0) (5). Putative promoter sequences and binding
sites for regulatory proteins were performed using bprom software (Softberry ...
Appl Environ Microbiol.
2008 Apr;74(7):2161-70. Epub 2008 Feb 1.
Characterization and application of a glucose-repressible promoter in Francisella tularensis
Horzempa J, Tarwacki DM, Carlson PE Jr, Robinson CM, Nau GJ.
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, E1256 BSTWR, 200 Lothrop St., Pittsburgh, PA 15261, USA.
... An analysis of the FGRp sequence near and upstream of the truncation of pTC3Dt3
with the BPROM program (Softberry) revealed the presence of putative -10 and ...
Antimicrob Agents Chemother.
2008 Apr;52(4):1472-80. Epub 2008 Feb 11
Different pathways to acquiring resistance genes illustrated by the recent evolution of IncW plasmids
Revilla et al.
Departamento de Biologi'a Molecular e Instituto de Biomedicina y Biotecnologi'a de Cantabria, Universidad de Cantabria-CSIC-IDICAN, C. Herrera Oria s/n, 39011 Santander, Spain.
... promoter is located upstream of aadA13 in the 'osa region (detected using the bacterial
promoter prediction BPROM program at http://www.softberry.com) (see Fig ...
Microbiology.
2008 May;154(Pt 5):1372-83.
Instability of the Salmonella RcsCDB signalling system in the absence of the attenuator IgaA
Mariscotti JF, Garci'a-Del Portillo F.
Departamento de Biotecnologi'a Microbiana, Centro Nacional de Biotecnologi'a-Consejo Superior de Investigaciones Cienti'ficas (CSIC), Darwin 3, 28049 Madrid, Spain
... The BPROM program, which predicts 70 promoter sites (http://www.softberry.com/berry.
phtml?topic=bprom&group=programs&subgroup=gfindb), was used to analyse in ...
J Bacteriol.
2008 Mar;190(6):2096-105. Epub 2008 Jan 11
Regulation of type IV secretion apparatus genes during Ehrlichia chaffeensis intracellular development by a previously unidentified protein
Cheng Z, Wang X, Rikihisa Y.
Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, 1925 Coffey Road, Columbus, OH 43210-1093, USA
... sites and 70 -like promoter elements of virB8-2, virB9-2, and virB4-2 upstream of
these three genes were predicted by the BPROM program (Softberry, Inc., Mount ...
J Bacteriol.
2008 Jul;190(13):4559-67. Epub 2008 May 9.
Lactobacillus reuteri DSM 20016 produces cobalamin-dependent diol dehydratase in metabolosomes and metabolizes 1,2-propanediol by disproportionation
Sriramulu et al.
Department of Microbiology, University College Cork, Cork, Ireland
... 26). Promoter prediction was performed with BPROM (software available from
SoftBerry (Mount Kisco, NY). Primer extension analysis. ...
Research in Microbiology
2008 May;159(4):270-8. Epub 2008 Mar 29
The omp50 gene is transcriptionally controlled by a temperature-dependent mechanism conserved among thermophilic Campylobacter species
Dedieu L, Pages JM, Bolla JM.
UMR-MD-1, IFR 48, Faculte de Medecine, Universite' de la Mediterranee, 27 Boulevard Jean Moulin, Marseille Cedex 5, France
... codon of the C. jejuni NCTC 11168 strain was computer-analyzed using a bacterial
promoter prediction tool (BPROM at the URL: http://www.softberry.com/berry ...
Microbiology.
2008 Jun;154(Pt 6):1719-28.
flhDC, but not fleQ, regulates flagella biogenesis in Azotobacter vinelandii, and is under AlgU and CydR negative control
Leon R, Espin G
Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo Postal 510-3, Cuernavaca, Morelos 62250, Mexico.
... For putative RpoD (sigma 70)-recognized promoters, we used BPROM (http://www.softberry.
com/berry.phtml), which is a program for the prediction of bacterial ...
Infect Immun.
2008 Jul 21
A tripartite efflux pump involved in gastrointestinal colonization by Klebsiella pneumoniae confers a tolerance response to inorganic acid
Sophie Coudeyras, Laurence Nakusi, Nicolas Charbonnel, Christiane Forestier
Univ Clermont 1, UFR Pharmacie, Laboratoire de Bacte'riologie, Clermont-Ferrand, France.
... A promoter consensus sequence was detected upstream of the eefX start codon
(-35 : CTTTCC; -10 : TCGTATAAT, softberry bprom). Analysis ...
Antimicrob Agents Chemother.
2008 May;52(5):1703-12. Epub 2008 Feb 25
Transcriptional and translational control of the mlr operon, which confers resistance to seven classes of protein synthesis inhibitors
Smith LK, Mankin AS.
Center for Pharmaceutical Biotechnology, m/c 870, University of Illinois, 900 S. Ashland Ave., Chicago, IL 60607, USA
... Analysis of the nucleotide sequence of the erm(B)-cfr intergenic spacer with the
BPROM algorithm of the Softberry genome analysis suite (http://softberry.com ...
Infect Immun.
2008 Sep;76(9):4000-8. Epub 2008 Jun 23
Genome of Mycoplasma arthritidis
Dybvig et al.
Department of Genetics, University of Alabama Birmingham, Birmingham, Alabama 35294-0024, USA.
... Potential promoters in genes containing upstream poly(T) or poly(A) tracts were
identified using BPROM at http://www.softberry.com/berry.phtml. ...
Infect Immun.
2008 Nov;76(11):5392-401. Epub 2008 Sep 2
Analysis of the isoprenoid biosynthesis pathways in Listeria monocytogenes reveals a role for the alternative 2-C-methyl-D-erythritol 4-phosphate pathway in murine infection.
Begley et al.
Alimentary Pharmabiotic Centre, Department of Microbiology, University College Cork, Cork, Ireland
... Predicted promoter regions were analyzed using BPROM (http://www.softberry.
com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...
Expert Opinion on Drug Discovery
August 2008, Vol. 3, No. 8, Pages 903-929
(doi:10.1517/17460441.3.8.903)
Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery
Nishikant V Wase & Phillip C Wright
The University of Sheffield, Biological and Environmental Systems Group, Department of Chemical and Process Engineering, Mappin St., Sheffield, S1 3JD, UK +44 0 114 2227577; +44 0 114 2227501
... of software packages found on Softberry [63], including fgenesB [64] (Pattern/Markov
chain-based bacterial operon and gene prediction), BPROM [65] (Prediction ...
Infection and Immunity
August 2008, p. 3587-3594, Vol. 76, No. 8 doi:10.1128/IAI.01568-07
D-Alanylation of Lipoteichoic Acid Contributes to the Virulence of Streptococcus suis
Nahuel Fittipaldi et al.,
Groupe de Recherche sur les Maladies Infectieuses du Porc and Centre de Recherche en Infectiologie Porcine, Faculte' de me'decine ve'te'rinaire, Universite' de Montre'al, St-Hyacinthe, Quebec J2S 7C6, Canada,1 Research Team for Bacterial/Parasitic Diseases, National Institute of Animal Health, National Agriculture and Food Research Organization, Tsukuba, Ibaraki 305-0856, Japan,2
... A putative strong promoter (indicated by P) was predicted 228 bp upstream of the
start codon for dltA using the software package Softberry BProm (http://www ...
Extremophiles
Volume 12, Number 3 / May 2008 pp. 415-429
Complete nucleotide sequence of pGS18, a 62.8-kb plasmid from Geobacillus stearothermophilus strain 18
Milda Stuknyte et al.,
(1) Department of Plant Physiology and Microbiology, Faculty of Natural Sciences, Vilnius University, Ciurlionio 21/27, 03101 Vilnius, Lithuania
(2) Department of Food Science and Microbiology, Industrial Microbiology Section, Faculty of Agriculture, University of Milan, Via Celoria 2, 20133 Milan, Italy
... Promoter -10 and -35 position determination was accomplished using BPROM provided
by SoftBerry (http://www.softberry.com/berry.phtml). ...
Applied and Environmental Microbiology
November 2008, p. 6739-6745, Vol. 74, No. 21 doi:10.1128/AEM.01021-08
Dynamic Localization of MreB in Vibrio parahaemolyticus and in the Ectopic Host Bacterium Escherichia coli
Shen-Wen Chiu, Shau-Yan Chen, and Hin-chung Wong
Department of Microbiology, Soochow University, Taipei, Taiwan 111, Republic of China
... The DNA sequences 500 bp upstream of mreB were analyzed using BPROM (http://www.
softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) to ...
Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10
Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii
Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504
... gordonii genome sequence were detected using the BProm and FindTerm modules of the
fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...
Canadian Journal of Microbiology
Volume 54, Number 5, 1 May 2008 , pp. 341-351(11)
Characterization of putative membrane protein genes of the 'Candidatus Phytoplasma asteris', chrysanthemum yellows isolate
Galetto, Luciana et al.,
... Bacterial promoters and terminators were searched with BPROM and FindTerm softwares
available on the SoftBerry server (www.softberry.com/berry.phtml). ...
Microbiological Research
Volume 163, Issue 1, 15 January 2008, Pages 39-50
The expression of the serine proteinase gene of Bacillus intermedius in Bacillus subtilis
Margarita Sharipova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia
... proteinase was inspected for the occurrence of the characteristic -35 and -10
boxes of SigA-type promoters (Helmann, 1995) by Softberry BPROM (Prediction ...
FEMS Microbiology Letters
Volume 281 Issue 2 Page 160-166, April 2008
The prpZ gene cluster encoding eukaryotic-type Ser/Thr protein kinases and phosphatases is repressed by oxidative stress and involved in Salmonella enterica serovar Typhi survival in human macrophages
Sebastien P. Faucher, Charles Viau, Pierre-Paul Gros, France Daigle, Herve Le Moual
1Department of Microbiology and Immunology, McGill University, Montreal, Quebec, Canada; and 2Department of Microbiology and Immunology, University of Montreal, Montreal, QC, Canada
... No such internal promoter sequences were identified using BPROM on the
Softberry website (http://www.softberry.com/berry.phtml). ...
Journal of Bacteriology
June 2008, p. 3877-3885, Vol. 190, No. 11
Transcriptional Analysis and Functional Characterization of a Gene Pair Encoding Iron-Regulated Xenocin and Immunity Proteins of Xenorhabdus nematophila
Jitendra Singh and Nirupama Banerjee
School of Biotechnology, Jawaharlal Nehru University, New Delhi 110067, India,1 International Centre for Genetic Engineering and Biotechnology, New Delhi 110067, India2
... Identities of promoter sequences associated with the ORFs were determined by using
the software BPROM (www.softberry.com) and www.fruitfly.org. ...
Biotechnology Letters
Volume 30, Number 3 / March, 2008 Pages 521-527
Identification of new internal promoters of the Xanthomonas oryzae pathovar oryzae gum gene cluster
Choong-Koo Lee, Byoung-Moo Lee and Jae-Yong Cho
(1) Division of Animal Science and Biotechnology, Sangji University, 660 Woosan-dong, Wonju-si, Gangwon-do, 220-702, Korea
(2) Microbial Genetics Division, National Institute of Agricultural Biotechnology, 225 Seodun-dong, Suwon, 441-707, Korea
... and BPROM software (Softberry, Inc.). Transcrip- tional terminators were predicted
with the TransTerm software (http://www.cbcb.umd.edu/software/Trans Term). ...
Journal of Molecular Catalysis B: Enzymatic
Volumes 52-53, June 2008, Pages 2-12
Genes responsible for hydantoin degradation of a halophilic Ochrobactrum sp. G21 and Delftia sp. I24 — New insight into relation of d-hydantoinases and dihydropyrimidinases
Durr et al.,
Department of Chemical Engineering, Chair of Technical Biology, University of Karlsruhe (TH), Germany
... BlastN and BlastP [21], ORF finder (at the National Centre for Biotechnology
Information website), ClustalW [22], BPROM (available at www.softberry.com) and ...
Appl. Environ. Microbiol.
June 2008, p. 3644-3651, Vol. 74, No. 12 doi:10.1128/AEM.00429-08
Increased Fitness of Pseudomonas fluorescens Pf0-1 Leucine Auxotrophs in Soil
Wook Kim and Stuart B. Levy
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111, USA
... downsteam from the 3'end of the opposite leuA2 gene by 5'RACE (Fig 1B).
BPROM (http://www.softberry.com) and NNPP (http://www ...
Antimicrob. Agents Chemother.
doi:10.1128/AAC.00393-08
Acquisition of a Plasmid Borne blaOXA-58 Gene with an Upstream IS1008 Insertion Conferring a High Level of Carbapenem Resistance to Acinetobacter baumannii
Te-Li Chen, Roy Chen-Chih Wu, Men-Fang Shaio, Chang-Phone Fung, and Wen-Long Cho
Division of Infectious Diseases, Department of Internal Medicine, Taipei Veterans General Hospital, Institute of Tropical Medicine, School of Medicine, National Yang-Ming University, Taipei, Division of Clinical Research, Department of Medical Research, Kuang Tien General Hospital, Institute of Clinical Nutrition, Hung Kuang University, Taichung, Taiwan
... motifs. Promoter sequences were identified using BPROM program 12
(www.softberry.com). 13 14 Reverse transcription-PCR (RT-PCR) 15 ...
FEMS Microbiology Ecology
2008 Aug;65(2):202-19. Epub 2008 Apr 9.
Physical organization and phylogenetic analysis of acdR as leucine-responsive
regulator of the 1-aminocyclopropane-1-carboxylate deaminase gene acdS in
phytobeneficial Azospirillum lipoferum 4B and other Proteobacteria
Claire Prigent-Combaret et al.,
1Universite' de Lyon, Lyon, F-69003, France; Universite' Lyon 1, Lyon, F-69003, France; CNRS, UMR 5557, Ecologie Microbienne, Villeurbanne, F-69622, France; IFR 41, Villeurbanne, F-69622, France
... of acdS in A. lipoferum 4B and other acdS + Proteobacteria was screened for putative
promoters (using the program BPROM; at http://www.softberry.com/berry.phtml ...
Environmental Microbiology
Volume 10 Issue 5 Page 1101-1107, May 2008
Ecology of type II secretion in marine gammaproteobacteria
Flavia F. Evans,
Suhelen Egan and
Staffan Kjelleberg
School of Biotechnology and Biomolecular Sciences and Centre for Marine Bio-Innovation, University of New South Wales, Sydney, Australia
... 2). Just downstream of this gene and separated by an apparent promoter-less 66
base-pair nucleotide region (BPROM, Softberry Package), a unique copy of the ...
Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0
Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes
Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA
... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry.
com), were used for operon and gene predictions. RESULTS. ...
Infection and Immunity,
September 2007, p. 4506-4513, Vol. 75, No. 9
Glutathione-Dependent Alcohol Dehydrogenase AdhC Is Required for Defense against Nitrosative Stress in Haemophilus influenzae
Stephen P. Kidd, Donald Jiang, Michael P. Jennings, and Alastair G. McEwan
Australian Bacterial Pathogenesis Program and Centre for Metals in Biology, School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Queensland 4072, Australia
... adhC-nmlR intergenic spacer regions of the NmlR subfamily from a number of bacteria
were identified using BPROM software available from Softberry (Mount Kisco ...
Genetica
Volume 131, Number 3 / November 2007 p. 255-265
Isolation, gene structure, and comparative analysis of the S-layer gene sslA of Sporosarcina ureae ATCC 13881
Pavel M. Ryzhkov, Kai Ostermann and Gerhard Rodel
Institut fur Genetik, Technische Universitat Dresden, Helmholtzstr. 10, 01062 Dresden, Germany
... sequences and promoter regions were identified by means of BestPal and Bprom programs
from ''SoftBerry'' software package (http://www.softberry.com). ...
Current Microbiology
Volume 55, Number 3 / September 2007 p. 185-192
A Novel Phytase appA from Citrobacter amalonaticus CGMCC 1696: Gene Cloning and Overexpression in Pichia pastoris
Huiying Luo et al.,
Microbial Engineering Department, Feed Research Institute, Chinese Academy of Agricultural Sciences, 100081 Beijing, China
... The promoter was predicted using the prediction of bacterial promoter program,
BPROM (available at: http://www.softberry.com/berry.html). ...
Journal of Bacteriology,
May 2007, p. 3335-3347, Vol. 189, No. 9
Transcriptional Regulation of the CO2-Concentrating Mechanism in a Euryhaline, Coastal Marine Cyanobacterium, Synechococcus sp. Strain PCC 7002: Role of NdhR/CcmR
Fiona J. Woodger, Donald A. Bryant, and G. Dean Price
Molecular Plant Physiology Group, Research School of Biological Sciences, Australian National University, P.O. Box 475, Canberra ACT 0200, Australia
... Putative LysR binding sites are underlined, and putative -35 and -10 elements (as
predicted by BPROM at www.softberry.com) are shown in boldface. ...
Journal of Bacteriology,
April 2007, p. 3051-3062, Vol. 189, No. 8
YcfR (BhsA) Influences Escherichia coli Biofilm Formation through Stress Response and Surface Hydrophobicity
Xue-Song Zhang, Rodolfo Garcia-Contreras, and Thomas K. Wood
Artie McFerrin Department of Chemical Engineering, Department of Biology, Zachry Department of Civil Engineering, Texas A & M University, College Station, Texas 77843-3122
... Further analysis of the ycfR promoter with BPROM, a bacterial promoter prediction
program (SoftBerry, Mount Kisco, NY), showed the presence of a putative SoxS ...
Journal of Bacteriology,
May 2007, p. 3776-3783, Vol. 189, No. 10
XphA/XqhA, a Novel GspCD Subunit for Type II Secretion in Pseudomonas aeruginosa
Gerard P. F. Michel, Eric Durand, and Alain Filloux
Laboratoire d'Ingenierie des Systemes Macromoleculaires, Institut de Biologie Structurale et Microbiologie, Centre National de la Recherche Scientifique, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 20, France
... Moreover, a search for promoters using the BPROM software (www.softberry.com) indicated
-10 and -35 boxes, respectively, 392 bp and 416 bp upstream of the ...
Microbiology
153 (2007), 3608-3622
Promoter-trap identification of wheat seed extract-induced genes in the plant-growth-promoting rhizobacterium Azospirillum brasilense Sp245
Joel F. Pothier et al.,
Universite de Lyon, Lyon, F-69003, France
... pl) (Ishikawa & Hotta, 1999 Down). BPROM was used for prediction of promoters
(http://www.softberry.com). SignalP 3.0 was used to ...
Journal of Bacteriology,
January 2007, p. 491-500, Vol. 189, No. 2
Characterization of a higBA Toxin-Antitoxin Locus in Vibrio cholerae
Priya Prakash Budde, Brigid M. Davis, Jie Yuan, and Matthew K. Waldor
Department of Molecular Biology and Microbiology, Program in Immunology, Tufts University School of Medicine, Howard Hughes Medical Institute, Boston, Massachusetts 02111
... Bioinformatic analysis of V. cholerae higBA (BPROM; http://www.softberry.com/berry.
phtml?topic=bprom&group=programs&subgroup=gfindb) suggested that this might ...
Research in Microbiology
Volume 158, Issue 6, July-August 2007, Pages 529-536
The ompW (porin) gene mediates methyl viologen (paraquat) efflux in Salmonella enterica serovar Typhimurium
Fernando Gil et al.,
Laboratorio de Microbiologi'a Molecular, Facultad de Ciencias de la Salud, Universidad Andre's Bello, Santiago, Chile
... MV induces ompW expression. BPROM software (http://www.softberry.com/berry.phtml?
topic=bprom) was used to analyze a 400 bp region upstream from the ompW gene. ...
Journal of Bacteriology,
April 2007, p. 3006-3016, Vol. 189, No. 8
Expression of the bviIR and cepIR Quorum-Sensing Systems of Burkholderia vietnamiensis
Rebecca J. Malott and Pamela A. Sokol
Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada T2N 4N1
... G4cepRGSV). Construction of luxCDABE transcriptional fusions. Promoter regions
were predicted in silico using SoftBerry BPROM. Promoter ...
Journal of Bacteriology,
August 2007, p. 5916-5928, Vol. 189, No. 16
Ler and H-NS, Regulators Controlling Expression of the Long Polar Fimbriae of Escherichia coli O157:H7
Alfredo G. Torres et al.,
Department of Microbiology and Immunology, Department of Pathology and Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas 77555-1070
... The bacterial promoter recognition program BPROM (http://www.softberry.com/berry.
phtml?topic=bprom&group=programs&subgroup=gfindb) was used to predict the ...
Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54
Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520
Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China
... Promoter and terminator predictions were performed using BPROM and FindTerm,
respectively (http://www.softberry.com/berry.phtml). ...
Microbiology
Volume 76, Number 5 / October 2007 p. 569-574
Heterologous expression of Bacillus intermedius gene of glutamyl endopeptidase in Bacillus subtilis strains defective in regulatory proteins
E. I. Shagimardanova et al.,
Kazan State University, ul. Kremlevskaya 18, Kazan, 420008, Russia
... potential -10 and -35 regions for the recognition by the sigma A factor of
transcriptional RNA polymerase were identified using the Softberry BPROM server ...
Journal of Bacteriology,
July 2007, p. 5119-5129, Vol. 189, No. 14
Only One of Four Oligopeptide Transport Systems Mediates Nitrogen Nutrition in Staphylococcus aureus
Aurelia Hiron, Elise Borezee-Durant, Jean-Christophe Piard, and Vincent Juillard
Unite Bacteries Lactiques et pathogenes Opportunistes, Institut National de la Recherche Agronomique, Domaine de Vilvert, 78352 Jouy en Josas cedex, France
... Putative promoter sequences were identified using the BPROM prediction
of bacterial promoter program (http://www.softberry.com). ...
Infection and Immunity,
September 2007, p. 4482-4489, Vol. 75, No. 9
Genetic Basis for the New Pneumococcal Serotype, 6C
In Ho Park, Saeyoung Park, Susan K. Hollingshead, and Moon H. Nahm
Departments of Pathology,1 Microbiology, University of Alabama at Birmingham, 845 19th Street South, BBRB 614, Birmingham, Alabama 35294
... and genes, promoters, and transcription terminators in the capsule gene locus were
identified using fgenesB, BPROM, and FindTerm (Softberry Inc.), which are ...
Microbiology
153 (2007), 3478-3498; DOI 10.1099/mic.0.2007/008250-0
Molecular analysis of the distribution and phylogeny of dissimilatory adenosine-5'-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes
Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany
... promoters, termination sites and gene arrangement in operons was performed using
the web versions FGENESB, BPROM and BTERM of the Softberry program package ...
Microbiology
153 (2007), 2026-2044; DOI 10.1099/mic.0.2006/003152-0
Phylogeny of the alpha and beta subunits of the dissimilatory adenosine-5'-phosphosulfate (APS) reductase from sulfate-reducing prokaryotes – origin and evolution of the dissimilatory sulfate-reduction pathway
Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany
... promoters, termination sites and operons in genome data were performed using the
web versions FGENESB, BPROM and BTERM of the Softberry program package ...
Research in Microbiology
Volume 158, Issue 2, March 2007, Pages 175-186
Isolation and characterization of a gene cluster involved in PAH degradation in Mycobacterium sp. strain SNP11: Expression in Mycobacterium smegmatis mc2155
Christophe Pagnout et al.,
Laboratoire d'Ecotoxicite, Sante Environnementale, CNRS UMR 7146, Universite Paul Verlaine, rue du General Delestraint, F-57070 Metz, France
... Prediction and BPROM software available at the Berkeley Drosophila Genome Project
(http://www.fruitfly.org/seq_tools/promoter.html) and SoftBerry (http://www ...
Journal of Bacteriology,
January 2007, p. 491-500, Vol. 189, No. 2
Characterization of a higBA Toxin-Antitoxin Locus in Vibrio cholerae
Priya Prakash Budde ,1,2,, Brigid M. Davis,2,* Jie Yuan,3 and Matthew K. Waldor1,2,3
Department of Molecular Biology and Microbiology,2 Program in Immunology, Tufts University School of Medicine,3 Howard Hughes Medical Institute, Boston, Massachusetts 021111
... Bioinformatic analysis of V. cholerae higBA (BPROM; http://www.softberry.com/berry.
phtml?topic=bprom&group=programs&subgroup=gfindb) suggested that this might ...
Environmental Microbiology
2007, 9 (3), 765 - 776.
doi:10.1111/j.1462-2920.2006.01198.x
Molecular diversity of nitrite reductase genes (nirK) in nitrifying bacteria
J. Jason L. Cantera, Lisa Y. Stein
Department of Environmental Sciences, Geology 2207, University of California, Riverside, CA 92521, USA.
... gene sequences located upstream of translational start sites for nirK genes were
analysed for sigma70 binding sites using BPROM (SoftBerry, Mount Kisco, NY). ...
Journal of Bacteriology,
June 2007, p. 4265-4274, Vol. 189, No. 11
Mycobacterial Bacilli Are Metabolically Active during Chronic Tuberculosis in Murine Lungs:
Insights from Genome-Wide Transcriptional Profiling
Adel M. Talaat et al.,
Laboratory of Bacterial Genomics, Department of Pathobiological Sciences, University of Wisconsin—Madison, Madison, Wisconsin 53706
... Using a promoter recognition algorithm, BPROM (http://www.softberry.com/berry.phtml),
we were able to predict a potential promoter binding site (TGGGTA-N[12 ...
Environmental Microbiology
Volume 9, Number 3, March 2007 , pp. 814-818(5)
The use of functional genomics for the identification of a gene cluster encoding for the biosynthesis of an antifungal tambjamine in the marine bacterium Pseudoalteromonas tunicata
Burke, Catherine; Thomas, Torsten; Egan, Suhelen; Kjelleberg, Staffan
... Upstream of the cluster a consensus region for a bacterial promoter was identified
using the Softberry BPROM program (http://www.softberry.com). ...
Molecular Biology Reports
Volume 34, Number 2 / June, 2007 pp.79-87
The expression of Bacillus intermedius glutamyl endopeptidase
gene in Bacillus subtilis recombinant strains
Sharipova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia
... was inspected for the occurrence of the characteristic –35 and –10 boxes of
SigA-type promoters (Helmann 1995) by using the Softberry BPROM (Prediction of ...
Journal of Bacteriology,
January 2007, p. 351-362, Vol. 189, No. 2
Global Gene Expression and Phenotypic Analysis of a Vibrio cholerae rpoH
Deletion Mutant
Leyla Slamti, Jonathan Livny, and Matthew K. Waldor*
Department of Molecular Biology and Microbiology, Tufts University School of Medicine, and Howard Hughes Medical Institute, 136 Harrison Avenue, Boston, Massachusetts 02111
... Promoter predictions were performed by using Bprom on the Softberry website
(http://www.softberry.com/berry.phtml). Microarray accession number. ...
Applied and Environmental Microbiology,
January 2007, p. 390-398, Vol. 73, No. 2
Involvement of Pseudomonas aeruginosa Rhodanese in Protection from Cyanide Toxicity
Rita Cipollone et al.,
Dipartimento di Biologia, Universita Roma Tre, Viale G. Marconi 446, 00146 Rome, Italy
... promoter elements was predicted by the Neural Network Promoter Prediction
(http://www.fruitfly.org/seq_tools/promoter.html) and BPROM (Softberry Inc.) software ...
Archives of Microbiology
Volume 187, Number 1 / January, 2007 67-77
Multiple regulators of the Flavohaemoglobin (hmp) gene of Salmonella enterica
serovar Typhimurium include RamA, a transcriptional regulator conferring the multidrug resistance phenotype
Elizabeth Hernandez-Urzua et al.,
Laboratorio de Microbiologia y Genetica Molecular, Departamento de Biologia Molecular y Biotecnologia, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico, P.O. Box 70-228, Coyoacan, Mexico City, 04510, Mexico
... 1). Interestingly, a very recent and independent in silico study using theBacterial
PROMoter prediction program BPROM (http://www.softberry.com) arrived at the ...
Cellular Microbiology,
Volume 9, Number 4, April 2007 , pp. 1039-1049(11)
Bile salts induce expression of the afimbrial LDA adhesin of atypical enteropathogenic Escherichia coli
Torres, Alfredo G et al.,
Departments of Microbiology and Immunology, and 2: Pathology, University of Texas Medical Branch, Galveston, TX?77555-1070, USA.
... found within the lda locus using BPROM, which is a bacterial promoter recognition
program with about 80% accuracy and specificity (http://www.softberry.com). ...
Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753
Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture
Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States
... the sequences for bacterial promoters and rho-independent transcription termination
sites was performed using BPROM and FindTerm, available at www.softberry.com ...
Canadian Journal of Microbiology,
Volume 53, Number 3, 1 March 2007 , pp. 417-426(10)
Comparison of transformation protocols in Streptococcus gordonii
and evaluation of native promoter strength using a multiple-copy plasmid
Warren, Travis K.; Lund, S. A.; Jones, Kevin F.; Hruby, Dennis E.
... start (TIGR 2006). The internet program BPROM at www. softberry.com/berry.
phtml identified two sequences, TTGACA and ATATATAAT,
Environmental Microbiology
Volume 8 Issue 8 Page 1460-1470, August 2006
Diversity of polyketide synthase genes from bacteria associated with the marine sponge
Pseudoceratina clavata: culture-dependent and culture-independent approaches
Tae Kyung Kim and John A. Fuerst
School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Qld 4072, Australia
... at ?79 (AGTGACACT) and ?96 (TTCACG) positions using a bacterial promoter prediction
program BPROM (available at the web site http:/ / www.softberry.com ). ...
Extremophiles
Volume 10, Number 4 / August, 2006 301-310
Characterization of a b-glycosidase
from the thermoacidophilic bacterium Alicyclobacillus acidocaldarius
Barbara Di Lauro 1, Mose Rossi 1, 2 and Marco Moracci 1
(1) Institute of Protein Biochemistry, Consiglio Nazionale delle Ricerche, Via P. Castellino 111, 80131 Naples, Italy
(2) Dipartimento di Biologia Strutturale e Funzionale, Universita di Napoli “Federico II”, Complesso Universitario di Monte S. Angelo, Via Cinthia 4, 80126 Naples, Italy
... 2a). The program BPROM for the prediction of bacterial pro- moters (http://www.
softberry.com/berry.phtml) revealed only one possible cassette of A10 and A35 ...
Journal of Biochemistry
2006 140(3):429-438; doi:10.1093/jb/mvj168
Homologous Response Regulators KvgA, KvhA and KvhR
Regulate the Synthesis of Capsular Polysaccharide in
Klebsiella pneumoniae CG43 in a Coordinated Manner
Ching-Ting Lin, Teng-Yi Huang, Wan-Chun Liang and Hwei-Ling Peng*
Department of Biological Science and Technology, National Chiao Tung University, 75 Po-Ai Street, Hsin Chu 30050, Taiwan, Republic of China
... The BPROM program (http://www.softberry.com) used to analyze the sequences of the
P kvgAS , P kvhAS , and P kvhR did not identify any cis-element, indicating ...
BMC Microbiology
2006, 6:104 doi:10.1186/1471-2180-6-104
Identification of potential CepR regulated genes using a cep box
motif-based search of the Burkholderia cenocepacia genome
Catherine E Chambers, Erika I Lutter, Michelle B Visser, Peggy PY Law and
Pamela A Sokol*
Address: Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada
..Potential promoter
elements were identified using BPROM [44].
44. Softberry (www.softberry.com). .
...
Molecular Microbiology
Volume 62 Issue 3 Page 794-810, November 2006
Thiosulphate oxidation in the phototrophic sulphur bacterium Allochromatium vinosum
Daniela Hensen, Detlef Sperling, Hans G. Truper, Daniel C. Brune,
Christiane Dahl
1Institut fur Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Meckenheimer Allee 168, D-53115 Bonn, Germany.
2Department of Chemistry and Biochemistry, Arizona State University, PO Box 871604, Tempe, AZ 85287-1604, USA.
... Manager (SES central) software. Promoter prediction was
performed using bprom
at http:/ / www.softberry.com . Similarity searches were ...
Journal of Microbiological Methods
Volume 66, Issue 2, August 2006, Pages 276-285
Genomic flank-sequencing of plasposon insertion sites for rapid identification of functional genes
Johan H.J. Leveaua, Saskia Gerardsa, Kathrin Fritschea,
Gerben Zondagb and Johannes A. van Veena
Netherlands Institute of Ecology (NIOO-KNAW), Department of Terrestrial Microbial Ecology, Boterhoeksestraat 48, 6666 GA Heteren, The Netherlands
BaseClear, Leiden, The Netherlands
... DNA sequences were analyzed using Lasergene software (DNASTAR, Madison, WI). Promoter
searches were performed using Softberry's BPROM (www.softberry.com). ...
Infection and Immunity
November 2006, p. 6171-6178, Vol. 74, No. 11
Hierarchy of Iron Uptake Systems: Yfu and Yiu Are Functional in Yersinia pestis
Olga Kirillina, Alexander G. Bobrov, Jacqueline D. Fetherston, and Robert D. Perry*
Department of Microbiology, Immunology, and Molecular Genetics, University of Kentucky, Lexington, Kentucky
... Sequence analysis. Nucleotide sequences were analyzed for promoters using
the web-based program BPROM (www.softberry.com). Predictions ...
Applied and Environmental Microbiology,
November 2006, p. 6994-7002, Vol. 72, No. 11
Transcriptional Regulation of the pdt Gene Cluster of Pseudomonas stutzeri KC
Involves an AraC/XylS Family Transcriptional Activator (PdtC) and the Cognate Siderophore Pyridine-2,6-Bis(Thiocarboxylic Acid)
Sergio E. Morales and Thomas A. Lewis*
Department of Microbiology and Molecular Genetics, University of Vermont, Burlington, Vermont 05405
... The DNA and protein sequence analysis software used were Sequencher (Gene Codes,
Ann Arbor, MI), BPROM (Softberry, Inc., Mount Kisco, NY), GenomeMatScan (http ...
Journal of Bacteriology
,
July 2006, p. 5089-5100, Vol. 188, No. 14
Molecular Characterization of Pantoea stewartii subsp. stewartii HrpY, a
Conserved Response Regulator of the Hrp Type III Secretion System, and its Interaction with the hrpS Promoter
Massimo Merighi,1, Doris R. Majerczak,1 Michael Zianni,2
Kimberly Tessanne,2 and David L. Coplin1*
Department of Plant Pathology and the Plant Molecular Biology and Biotechnology Program,1
Plant-Microbe Genomic Facility, The Ohio State University, Columbus, Ohio 432102
... Promoter and DNA binding site predictions were determined with BPROM (http://www.
softberry.com/), PromScan (http://molbiol-tools.ca/mtoolwww-cgi/promscan.cgi ...
Appl Environ Microbiol.
,
2006 April; 72(4): 2539-2546
Cloning and Sequencing of the ompA Gene of Enterobacter sakazakii and Development of
an ompA-Targeted PCR for Rapid Detection of Enterobacter sakazakii in Infant Formula
Manoj Kumar Mohan Nair and Kumar S. Venkitanarayanan*
Department of Animal Science, Unit 4040, University of Connecticut, Storrs, Connecticut 06269
.... in Table 2. The sequences generated were analyzed by Sequencher 4.1.4 (Gene Codes
Corporation, Ann Arbor, Mich.), BPROM (http://www.softberry.com), SignalP ...
PNAS
,
August 22, 2006 vol. 103 no. 34 12897-12902
Deletion of TolC orthologs in Francisella tularensis identifies roles in multidrug resistance and virulence
Gil et al.,
Center for Infectious Diseases, Stony Brook University, Stony Brook, NY 11794-5120
... 42). The locations of promoters and operons were investigated by using the FGENESB
and BPROM programs available from Softberry (Mt. Kisco, NY). ...
Molecular Microbiology, Volume 59, Number 2, January 2006, pp. 541-550(10)
A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, Nicole A.1; Grieshaber, Scott S.1; Fischer,
Elizabeth R.2; Hackstadt, Ted
Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.
... promoter sequences and rho-independent terminators that could result in an ?120
bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...
Applied and Environmental Microbiology, January 2006, p. 368-377, Vol. 72, No. 1
Cloning and Expression of a Xylitol-4-Dehydrogenase Gene from Pantoea ananatis
J. S. Aarnikunnas,1* A. Pihlajaniemi,2 A. Palva,1 M. Leisola,2 and A. Nyyssola2
Division of Microbiology and Epidemiology, Department of Basic Veterinary Sciences, Faculty of Veterinary Medicine, P.O. Box 66, FIN-00014 University of Helsinki, Finland,1 Laboratory of Bioprocess Engineering, Department of Chemical Technology, Helsinki University of Technology, P.O. Box 6100, FIN-02015 Espoo, Finland2
... uk/blast2/]). The BPROM program (SoftBerry Inc.) was used to localize putative
promoter regions in the sequences. The protein sequences ...
Journal of Bacteriology,
January 2006, p. 789-793, Vol. 188, No. 2
Autorepression of RctB, an Initiator of Vibrio cholerae Chromosome II Replication
Elizabeth S. Egan, Stephane Duigou, and Matthew K. Waldor
Genetics Program and Department of Molecular Microbiology, Tufts University School of Medicine and Howard Hughes Medical Institute, 136 Harrison Ave., Boston, Massachusetts 02111
.. BPROM, a computer program designed to identify sigma 70-dependent promoters for
bacterial genes (SoftBerry, Mount Kisco, NY), predicted -10 and -35 sites ...
FEBS Journal Volume 272 Issue 24 Page 6324 - 6335. December 2005
Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath).
Odd A. Karlsen1 et al.,
1 Department of Molecular Biology, University of Bergen, Norway
2 Computational Biology Unit, Bergen Centre for Computational Science, Norway
... fruitfly.org/ seq_tools/ promoter.html ) and bprom available at http://www.softberry.com ... In Microbial Growth on C1 Compounds (Murrell JC &Kelley DP, eds), ...
Extremophiles
Issue: Volume 9, Number 2 Date: April 2005 Pages: 99 - 109
DOI: 10.1007/s00792-004-0425-0
The genome of BCJA1c: a bacteriophage active against the alkaliphilic bacterium, Bacillus clarkii
Andrew M. Kropinski1, Melissa Hayward1, M. Dorothy Agnew1 and Ken F. Jarrell1
(1) Department of Microbiology and Immunology, Queens University, Kingston, ON, K7L 3N6, Canada
... al. 2002). Promoters were predicted using Softberry's BPROM program at
http://www.softberry. com/berry. phtml?topic=promoter. ...
Journal of Bacteriology, February 2005, p. 1091-1104, Vol. 187, No. 3
0021-9193/05/$08.00+0 doi:10.1128/JB.187.3.1091-1104.2005
The Generalized Transducing Salmonella Bacteriophage ES18: Complete Genome Sequence and DNA Packaging Strategy
Sherwood R. Casjens et al.,
Department of Pathology, University of Utah Medical School, Salt Lake City,
Utah,1 Department of Biological Sciences,4 Pittsburgh Bacteriophage Institute,
University of Pittsburgh, Pittsburgh, Pennsylvania ,2 Institut fur Genetik und
Mikrobiologie, Universitat Munchen, Munich, Germany3
... The DNA sequence analysis software used was DNA Strider (24), GeneMark (5), Staden programs (78), BLAST (2), BPROM (http://www.softberry.com/berry.phtml?topic ...
Infection and Immunity, May 2005, p. 2899-2909, Vol. 73, No. 5
Characterization of the Major Secreted Zinc Metalloprotease- Dependent Glycerophospholipid:Cholesterol Acyltransferase, PlaC, of Legionella pneumophila
Sangeeta Banerji,1 Mayte Bewersdorff,1, Bjorn Hermes,1,
Nicholas P. Cianciotto,2 and Antje Flieger1*
Robert Koch-Institut, Berlin, Germany,1 Department of Microbiology-Immunology, Northwestern University Medical School, Chicago, Illinois2
... legion.) (12). Nucleotide sequences were also analyzed for promoters using
the web-based program BPROM (www.softberry.com). Sequence ...
Journal of Bacteriology, April 2005, p. 2458-2468, Vol. 187, No. 7
The Type III-Dependent Hrp Pilus Is Required for Productive Interaction of Xanthomonas campestris pv. vesicatoria with Pepper Host Plants
Ernst Weber et al.,
Institute of Genetics,1 Biozentrum, Martin Luther University, Halle, Germany,4 General Microbiology, Faculty of Biosciences, University of Helsinki, Helsinki, Finland,2 Institut des Sciences Vegetales, CNRS, Gif-sur-Yvette, France3
... The promoter recognition program BPROM (Softberry, Inc., Mt. Kisco, NY) was used
for prediction of bacterial sigma70 promoter motifs. RESULTS. ...
FEMS Microbiology Letters
2005, Volume 248 Issue 1, Pages 1 - 8
RelA alone appears essential for (p)ppGpp production when Neisseria gonorrhoeae encounters nutritional stress
Scott D. Fisher a , Andrew D. Reger a , Atalie Baum a , Stuart A. Hill* a
a Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA
... Puta- tive promoters and gene expression regulatory motif sequences were determined
using the BPROM analysis program housed at: http://www.softberry.com/berry. ...
FEMS Microbiol Lett.
2005 Jul 15;248(2):199-205
Characterization of IS1501 mutants of Leptospira interrogans serovar pomona
Zuerner RL, Trueba GA.
National Reference Center for Leptospirosis, Bacterial Diseases of Livestock Research Unit, National Animal Disease Center, USDA, ARS, P.O. Box 70, Ames, IA 50010, USA
... and the data analyzed using Clone Manager 7 and Primer Designer 5 (Scien- tific
and Educational Software), BLAST [24], and BPROM (http://www.softberry.com/).
Journal of Bacteriology
June 2005, p. 4005-4014, Vol. 187, No. 12
Characterization of the Small Untranslated RNA RyhB and Its Regulon in Vibrio cholerae
Davis et al.,
Howard Hughes Medical Institute,1 Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, Massachusetts 021112
... MacVector (Accelrys). Promoter prediction was done with BPROM (Softberry,
Inc., Mt. Kisco, NY). Microarray analyses. Paired cultures ...
Can J Microbiol.
2005 Oct;51(10):821-3
Characteristics of adjacent family 6 acetylxylan esterases from Fibrobacter succinogenes and the interaction with the Xyn10E xylanase in hydrolysis of acetylated xylan
Kam DK, Jun HS, Ha JK, Inglis GD, Forsberg CW.
Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON, Canada
... The putative -10 and -35 pro- moter sequences of axe6A and axe6B shown in Fig. 1
were predicted by using the program BPROM (http://www.softberry. ...
FEMS Microbiology Letters
2005, Volume 251 Issue 1, Pages 29 - 36
Transcriptional regulation of the S-layer protein type I secretion system in Caulobacter crescentus
Michael C. Toporowski a , John F. Nomellini a , Peter Awram a , Assaf Levi b , John Smit a, *
a University of British Columbia, Department of Microbiology and Immunology, Vancouver, B.C. Canada V6T 1Z3 b University of Basel, Division of Molecular Microbiology, Basel, Switzerland
... Fig. 1. In-silico predicted rsaD promoter orientation and binding sites: (a)
prediction of the rsaD promoter using the Softberry BPROM program. ...
Journal of Bacteriology, November 2004, p. 7411-7419, Vol. 186, No. 21
Use of In Vivo Expression Technology To Identify Genes Important in Growth and Survival of Pseudomonas fluorescens Pf0-1 in Soil: Discovery of Expressed Sequences with Novel Genetic Organization
Mark W. Silby and Stuart B. Levy*
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts
...Promoter searches were carried out by using SoftBerry software...
...An examination of the 1,486 bp of intergenic sequence upstream of the Pflu4867 gene with SoftBerry software suggests the presence of
two predicted promoters, both in the correct orientation to drive expression of Pflu4867 and both within the region contained in the iiv6 fusion...
... Candidate promoters were detected by SoftBerry software upstream of the iiv1, iiv5, iiv12, iiv14, and iiv19 ORFs....
J Bacteriol. 2004 September; 186(17): 5945-5949.
doi: 10.1128/JB.186.17.5945-5949.2004.
Identification of Operators and Promoters That Control SXT Conjugative Transfer
John W. Beaber and Matthew K. Waldor*
Department of Microbiology, Tufts University School of Medicine, and Howard Hughes Medical Institute, Boston, Massachusetts
...Computer algorithms and 5? random amplification of cDNA ends (RACE) were used to define the setR and s086 transcription start sites.
Software for the identification of bacterial promoters (http://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) identified
putative ?10 and ?35 elements for both PL and PR (Fig. 2) (23, 24)...
Antimicrobial Agents and Chemotherapy
October 2004, p. 4042-4046, Vol. 48, No. 10
CARB-9, a Carbenicillinase Encoded in the VCR Region of Vibrio cholerae Non-O1, Non-O139 Belongs to a Family of Cassette-Encoded b-Lactamases
Petroni et al.,
Servicio Antimicrobianos, Dpto. Bacteriologia, Instituto Nacional de Enfermedades Infecciosas-ANLIS "Dr. Carlos G. Malbran," Buenos Aires, Argentina,1 Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada2
... 35 and -10) and the RBS reported previously are shown in boldface, and those identified
in this work (the BPROM program, http://www.softberry.com/berry.phtml ...
JOURNAL OF BACTERIOLOGY, Mar. 2004, p. 1818-1832 Vol. 186, No. 6
The pKO2 Linear Plasmid Prophage of Klebsiella oxytoca
Sherwood R. Casjens,1,2* Eddie B. Gilcrease,1 Wai Mun Huang,1 Kim L. Bunny,3
Marisa L. Pedulla,2,4 Michael E. Ford,2,4 Jennifer M. Houtz,2,4
Graham F. Hatfull,2,4 and Roger W. Hendrix2,4
Department of Pathology, University of Utah Medical School, Salt Lake City, Utah 841321; Pittsburgh Bacteriophage Institute2 and Department of Biological Sciences,4 University of Pittsburgh, Pittsburgh, Pennsylvania 15260; and Section of Microbiology, University of California at Davis, Davis, California 956163
...The DNA sequence analysis software packages used were DNA Strider (27), GeneMark (8), the Staden programs (94), BLAST (3), BPROM http://www.softberry.com/berry.phtml?topic_gfindb), and DNA Master (J. Lawrence [http://cobamide2.bio.pitt.edu/])....
BMC Microbiology 2004, 4:4
Analysis of the lambdoid prophage element e14 in the E. coli K-12 genome
Preeti Mehta1, Sherwood Casjens2 and Sankaran Krishnaswamy*1
Bioinformatics Centre, School of Biotechnology, Madurai Kamaraj University, Madurai-625021, India and 2University of Utah Medical School, Department of Pathology, 90 North 1900 East, Salt Lake City UT 84132-2501, USA
... Putative promoters predicted using BPROM available at the website http://
www.softberry.com. Scores are as given by BPROM. Promoters ...
PNAS
July 27, 2004 vol. 101 no. 30 11013-11018
Transfer of photosynthesis genes to and from Prochlorococcus viruses
Lindell et al.,
Departments of *Civil and Environmental Engineering and ¶Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; ‡Joint Program in Biological Oceanography, Woods Hole Oceanographic Institution and Massachusetts Institute of Technology, Cambridge, MA 02139; and §Department of Biology, San Diego State University, San Diego, CA 92182
... 10 and a tail score of <-5. Potential bacterial ? 70 promoters were identified in
intergenic regions by using the program bprom (SoftBerry, Mount Kisco, NY ...
Plant Molecular Biology
53 (6): 865-876, December 2003
Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase
Allison E. McDonald, Sasan Amirsadeghi, Greg C. Vanlerberghe
Department of Life Sciences and Department of Botany, University of Toronto at Scarborough, 1265 Military Trail, Scarborough, Ontario, M1C 1A4 Canada
... The A. variabilis PTOX sequence was analyzed in the upstream region of the start codon with Softberry's BPROM software (http://www.softberry.com). ..
FindTerm
Microbiology
2014, 160(Pt 2), 287-295. DOI:10.1099/mic.0.073783-0
Expression of the six chromate ion transporter homologues of Burkholderia xenovorans LB400
Acosta-Navarrete Y. M. et al.,
1 Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico
2 Laboratorio Estatal de Salud Publica, Secretaria de Salud de Michoacan, Morelia, Michoacan, Mexico
... software (http://molbiol-tools.ca/promscan/). Rho-independent bacterial terminators
were searched using the program FindTerm (Softberry). Bacterial growth and
susceptibility tests. Bacteria were grown routinely by diluting 1 ...
Journal of virology
2014, 88(5), 2461-2480. DOI:10.1128/JVI.03363-13
Cluster M mycobacteriophages Bongo, PegLeg, and Rey with unusually large repertoires of tRNA isotypes
Pope W. H. et al.,
a Department of Biological Sciences, University of Pittsburgh, Pittsburgh, Pennsylvania, USA
b Department of Biology, Gonzaga University, Spokane, Washington, USA
... programs. Dot plots were constructed using the Gepard program (27), and further
bioinformatic analyses were performed using the DNA Master, FindTerm (Softberry),
Splitstree (28), GLAM2, GLAM2SCAN, and MEME (29) programs. ...
Microbiology
April 2013 vol. 159 no. Pt 4 665-677 DOI:10.1099/mic.0.063396-0
The regulatory mechanism of 2,4,6-trichlorophenol catabolic operon expression by HadR in Ralstonia pickettii DTP0602
Torii et al.,
1Department of System Science, Graduate School of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan
2Department of Biomedical Engineering, Faculty of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan
... The rho-independent terminator was predicted with FindTerm (Softberry; http://linux1.
softberry.com/berry.phtml). ... The presence of rho-independent terminator in the R1 and
R10 regions was sought using FindTerm (Softberry), but not located. ...
Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7
Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage
Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China
... DNASTAR software package was employed to detect direct and inverted repeats.
Putative promoter and terminator predictions were analyzed with BPROM and
FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...
Antonie van Leeuwenhoek
Volume 104, Issue 6 , pp 941-948 DOI:10.1007/s10482-013-0013-3
An Lrp-type transcriptional regulator controls expression of the Bacillus subtilis chromate transporter
Aguilar-Barajas et al.,
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Mich., Mexico
3. Genomica Alimentaria, Universidad de la Cienega, Sahuayo, Mich., Mexico
2. Depto. Bioquimica, Facultad de Medicina, Universidad Nacional Autonoma de Mexico, Mexico, D.F., Mexico
... bin/seq_tools/promoter.pl). Rho-independent bacterial terminators were searched
using the program FindTerm (Softberry Inc., New York, NY, USA). Cloning of the
ywrC-chr3N-chr3C gene cluster. The ywrC-chr3N-chr3C gene ...
Microbiology
November 2013 mic.0.073783-0 DOI:10.1099/mic.0.073783-0
Expression of the Six CHR Chromate Ion Transporter Homologues of Burkholderia xenovorans LB400
Acosta-Navarrete et al.,
1 Universidad Michoacana;
2 Laboratorio Estatal de Salud Publica
... Putative promoter sequences were identified employing PromScan software 109
(http://molbiol-tools.ca/promscan/). Rho-independent bacterial terminators were 110 searched
using the program FindTerm (Softberry Inc.). 111 112 Bacterial growth and susceptibility tests ...
Microbiology
April 2013 vol. 159 no. Pt 4 691-700 DOI:10.1099/mic.0.064741-0
A Q-like transcription factor regulates biofilm development in Escherichia coli by controlling expression of the DLP12 lysis cassette
Karl-Gustav Rueggeberg 1, Faustino A. Toba 1, Mitchell G. Thompson 1, Bryan R. Campbell 1 and Anthony G. Hay 1,2
1Department of Microbiology, Cornell University, Ithaca, NY 14853, USA
2Institute for Comparative and Environmental Toxicology, Cornell University, Ithaca, NY 14853, USA
... Antiterminator predictions. essDp sequence encompassing 400 bp upstream of the translation
start site was analysed for the presence of putative Rho-independent transcriptional terminators
using FindTerm software from Softberry (Hagen et al., 2010). ...
Research in Microbiology
Volume 164, Issue 10, December 2013, Pages 979–986 DOI:10.1016/j.resmic.2013.08.007
Characterization and complete genome sequence of the Shigella bacteriophage pSf-1
Jun et al.,
a Laboratory of Aquatic Biomedicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 151-742, Republic of Korea
b Korea Institute of Ocean Science & Technology, Ansan 426-744, Republic of Korea
... promoter.html) (minimum promoter score: 0.9). Rho-independent transcription
terminators were identified using FindTerm programs (http://www.softberry.ru) (energy
threshold value: ?11). Additional characteristics of the putative ...
Microbiology
May 2013 mic.0.063776-0 DOI:10.1099/mic.0.063776-0
Isolation, characterization and complete genome sequence of PhaxI: a phage of Escherichia coli O157:H7
Shahrbabak et al.,
1 Tehran University of Medical Sciences;
2 University of Helsinki;
3 Laval University
... 2004; Schattner et al., 2005). To find Rho-independent terminators, TransTerm 230 (Ermolaeva
et al., 2000) and FindTerm (SoftBerry) were used. PHIRE was also used 231 to find phage
regulatory elements (Lavigne et al., 2004). The genomic map was 232 ...
Current Microbiology
Volume 66, Issue 6 , pp 535-543 DOI:10.1007/s00284-013-0308-7
Characterization and Genome Sequencing of Phage Abp1, a New phiKMV-Like Virus Infecting Multidrug-Resistant Acinetobacter baumannii
Huang et al.,
1. Department of Microbiology, Third Military Medical University, Chongqing, 400038, China
2. Institute of Burn Research, Southwest Hospital, Third Military Medical University, Chongqing, China
... Bacte- riophage-specific promoters were determined using Neural Network Promoter
Prediction [29] and PHIRE [30]. Tran- scriptional termination sites were determined using
the FindTerm program (http://www.softberry.ru/berry.phtml). ...
PloS one
(2013). 8(5), e62933. DOI:10.1371/journal.pone.0062933
Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages
Lu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing, China
...Predicted promoter regions were identified using neural network promoter prediction [51],
and putative terminator structures were identified using the web tool FindTerm (http://linux1.softberry.com/berry.phtml)....
BMC genomics
(2013). 14(1), 849. DOI:10.1186/1471-2164-14-849
The Clostridium small RNome that responds to stress: the paradigm and importance of toxic metabolite stress in C. acetobutylicum
Venkataramanan et al.,
1 Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE, USA
2 Delaware Biotechnology Institute, University of Delaware, Newark, DE, USA
...Rho independent terminators were predicted using RNAmotif [90], Erpin [91] and Findterm (http://www.softberry.com webcite). ...
J. Virol.
August 2012 vol. 86 no. 16 8781-8792 doi: 10.1128/JVI.00446-12
Genome, Integration, and Transduction of a Novel Temperate Phage of Helicobacter pylori
Cheng-Hung Luo a, Pei-Yu Chiou a, Chiou-Ying Yang b and Nien-Tsung Lin c
aInstitute of Medical Sciences, Tzu Chi University, Hualien, Taiwan
bInstitute of Molecular Biology, National Chung Hsing University, Taichung, Taiwan
... Putative ?-independent transcriptional terminators were analyzed as a potential
stem-loop structure followed by a uracil-rich stretch with a stable secondary structure
(?G < ?10 kcal/mol) using the FindTerm program on the SoftBerry website. ...
Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 464-471 DOI: 10.1128/AAC.00602-11
Identification of Hopanoid Biosynthesis Genes Involved in Polymyxin Resistance in Burkholderia multivorans
Rebecca J. Malott, Barbara R. Steen-Kinnaird, Tracy D. Lee and David P. Speert
Centre for Understanding and Preventing Infection in Children, Department of Pediatrics, University of British Columbia, Vancouver, British Columbia, Canada
.. Lynnon Biosoft, Vaudreuil, Quebec, Canada). Additional in silico promoter and
terminator predictions were performed with BPROM and FindTerm (Softberry, Inc.,
Mount Kisco, NY). Sequence similarity searches were performed ...
PLoS ONE
7(5): e36709. doi:10.1371/journal.pone.0036709
The mbo Operon Is Specific and Essential for Biosynthesis of Mangotoxin in Pseudomonas syringae
Carrion VJ, Arrebola E, Cazorla FM, Murillo J, de Vicente A
Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” (IHSM-UMA-CSIC), Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Malaga, Spain
Laboratorio de Patologia Vegetal, ETS de Ingenieros Agronomos, Universidad Publica de Navarra, Pamplona, Spain
...The promoter (BPROM) and terminator (FindTerm and FoldRNA) prediction was performed using SoftBerry online programmes (http://www.softberry.com, Mount Kisco, NY, USA). ...
World Journal of Microbiology and Biotechnology
Volume 28, Issue 3 , pp 865-869 DOI
10.1007/s11274-011-0883-3
The ChrA homologue from a sulfur-regulated gene cluster in cyanobacterial plasmid pANL confers chromate resistance
Esther Aguilar-Barajas (1) (2)
Paulina Jeronimo-Rodriguez (1)
Martha I. Ramirez-Diaz (1)
Christopher Rensing (2)
Carlos Cervantes (1)
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Michoacan, Mexico
2. Department of Soil, Water, and Environmental Science, University of Arizona, Tucson, AZ, USA
... Promoter sequences were searched with the Neural Network Promoter Predic- tion
(http://www.fruitfly.org/cgi-bin/seq_tools/promoter.pl software. Rho-independent
terminators were predicted with the FindTerm (Softberry Inc.) program. ...
Archives of Virology
Volume 157, Issue 2 , pp 391-395 DOI
10.1007/s00705-011-1175-9
Complete genomic sequence of a T4-like bacteriophage, phiAS4, infecting Aeromonas salmonicida subsp. salmonicida
J. H. Kim et al.,
1. Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, 151-742, Korea
2. Basic Science Institute for Cell Damage Control, Sogang University, Seoul, 121-742, Korea
... 13]. Rho-independent transcription terminators were also pre- dicted using the
FindTerm program (http://www.softberry.ru/ berry.phtml?topic=findterm&group=
programs&subgroup= gfindb) (energy threshold value: -11). Additional ...
BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10
Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production
Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain
2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain
... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters
in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm
software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...
Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002
IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes
Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany
2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile
... to GenBank sequences. Additional searches for genes, operons, promoters, and
terminators were done using FGENESB, BPROM, and FindTerm at www.softberry.
com (Softberry, Mount Kisco, NY, USA). The sequence data ...
PLoS ONE
7(5): e38283. (2012) doi:10.1371/journal.pone.0038283
Molecular Characterization of Podoviral Bacteriophages Virulent for Clostridium perfringens and Their Comparison with Members of the Picovirinae.
Volozhantsev NV et al.,
1 State Research Center for Applied Microbiology and Biotechnology, Obolensk, Moscow region, Russian Federation, 2 Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, Athens, Georgia, United States of America,
...Protein-encoding genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology.gatech.edu/GeneMark) [73] and SoftBerry FGENESB (http://linux1.softberry.com/berry.phtml; Mount Kisco, NY, USA) programs.
...
Putative promoters were analyzed by using Martin Reese's neural network prediction program at http://www.fruitfly.org/seq_tools/promot?er.html and BPROM (Softberry, Inc., Mount Kisco, NY, USA) at its website http://linux1.softberry.com/berry.phtml. Potential transcriptional terminators were assessed using the software programs TransTerm at the Nano+Bio-Center (http://nbc3.biologie.uni-kl.de) and FindTerm (Softberry, Inc., Mount Kisco, NY, USA) at the web site http://linux1.softberry.com/berry.phtml.
...
Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002
Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes
M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico
b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico
... Rho-independent bacterial terminators were searched using the program FindTerm
(Softberry Inc.). ... Search for genomic islands was made using CpG finger program from
Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...
RNA Biology
Volume 8, Issue 1 January/February 2011 Pages 11 - 13 DOI: 10.4161/rna.8.1.13346
ARNold: A web tool for the prediction of Rho-independent transcription terminators
Magali Naville, Adrien Ghuillot-Gaudeffroy, Antonin Marchais and Daniel Gautheret
Univ. Paris-Sud, Institut de Genetique et Microbiologie, Orsay Cedex, France
... search to intergenic regions, which makes it unfit for certain applications, including detection
of transcriptional attenuators that occur after gene starts. Other available tools include com-
mercial programs such as Softberry's Findterm (www.softberry. ...
Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142
Complete genome sequence of the lytic
Pseudomonas fluorescens phage fjIBB-PF7A
Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological
Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga,
Portugal
... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/
tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly.
org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ...
...Terminators
were predicted using FindTerm http://linux1.softberry.
com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...
Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050
The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay
Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China
b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China
... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM
and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening
of serotype-specific gene. Cross-hybridization experiments ...
FEMS Microbiology Letters
(2011), 324: 117–124. doi: 10.1111/j.1574-6968.2011.02394.x
Genetic analysis of the capsular polysaccharide synthesis locus in 15 Streptococcus suis serotypes.
Wang, K., Fan, W., Cai, L., Huang, B. and Lu, C.
1Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, China
2College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China
... Sequence annotation and bioinformatic analysis. The promoters and terminators of the sequenced
cps locus were predicted using the bprom and findterm program (http://linux1.softberry.com/berry.
phtml), respectively. ORFs were analyzed using the vectornt? program. ...
International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019
Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus
Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
... Presence of putative promoters, terminators and operons was evaluated using BPROM
(http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter.
html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...
BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198
Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny
Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden
... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70-
promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were
identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...
Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166
Antisense RNA associated with biological regulation of a restriction–modification system
Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences
... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator
prediction were performed using the BPROM and FindTerm software, respectively
(http://www.softberry.com/all.htm). RNA secondary structure ...
Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921
The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1
YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture
... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the
& independent terminators were predicted using the BPROM and the FindTerm program
respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...
J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11
A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550
Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland
2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy
... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique
terminator region downstream of TTHA1327 were identified using BPROM and
FindTerm (Softberry), respectively. Those findings showed that ...
PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108
Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence
Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and
bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611
...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the
BProm and TermFind/RNAFold programs (Softberry)....
Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09
The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry
Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany
.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators
were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK
(21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...
Plasmid
Volume 63, Issue 2, March 2010, Pages 108-117
Sequence analysis of plasmid pIR52-1 from Lactobacillus helveticus R0052 and investigation of its origin of replication
Hagen et al.,
a Department of Research and Development, Institut Rosell Inc., 6100 Avenue Royalmount, Montreal, Que., Canada H4P 2R2
b Department of Biology, Utah State University, Logan, UT 84322-5305, USA
... To predict the presence of rho-independent terminators, the Softberry FindTerm program
(version 2.8) was used (http://www.softberry.ru/berry.phtml?group=programs&subgroup=
gfindb&topic=findterm). 2.7. Analysis of repA genes for repeat sequences. ...
Journal of Bacteriology
October 2010, p. 5441-5453, Vol. 192, No. 20 doi:10.1128/JB.00709-10
Brochothrix thermosphacta Bacteriophages Feature Heterogeneous and Highly Mosaic Genomes and Utilize Unique Prophage Insertion Sites
Samuel Kilcher, Martin J. Loessner, and Jochen Klumpp
Institute of Food, Nutrition and Health, ETH Zurich, 8092 Zurich, Switzerland
... Rho-independent bacterial transcription terminators were predicted by using Softberry
FindTerm (http://www.softberry.ru/berry.phtml?topic=findterm&group=programs&subgroup=
gfindb) using an energy threshold value of –11 (default setting). ...
Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10
Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9
Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2
... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc.,
234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator
236 sequences using BPROM and FindTerm programs (Softberry Inc.). ...
Genomics
Volume 96, Issue 3, September 2010, Pages 167-172 doi:10.1016/j.ygeno.2010.06.001
Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii
Zhu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing 400038, China
... Bacteriophage-specific promoters were determined using Neural Network Promoter
Prediction [32] and PHIRE [33]. Transcrptional termination sites were determined using
FindTerm programs (http://www.softberry.ru/berry.phtml). ...
Microbiology
156 (2010), 2305-2315; DOI 10.1099/mic.0.038760-0
Detection and quantification of intergenic transcription in Mycoplasma hyopneumoniae
Stuart W. Gardner 1,2 and F. Chris Minion 1
1 Department of Veterinary Microbiology and Preventive Medicine, Interdepartmental Microbiology Program, Iowa State University, Ames, IA 50011, USA
2 Department of Statistics, Iowa State University, Ames, IA 50011, USA
... To identify stem–loop structures in the ig-072, ig-106, ig-282, ig-682 and ig-684 IG regions,
SoftBerry FindTerm software was used. Heat-shock experimental design and data analysis. ...
putative stem–loop structure as predicted by SoftBerry FindTerm software. ...
BMC Microbiology
2010, 10:301doi:10.1186/1471-2180-10-301
Characterization of JG024, a pseudomonas aeruginosa PB1-like broad host range phage under simulated infection conditions
Garbe et al.,
1 Institute of Microbiology, Technische Universitat Braunschweig, Spielmannstr. 7, 38106 Braunschweig, Germany
2 DSMZ, German Collection of Microorganisms and Cell Cultures, Inhoffenstr. 7B, 38124 Braunschweig, Germany
... Two promoter regions were identified in this way. Rho-independent terminator structures were
identified using the TransTerm [46] and FindTerm (Softberry, Inc.) software tools. The program
MEME was used for identification of conserved intergenic motifs in phage JG024 [47]. ...
Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010
Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...
Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035
Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...
BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153
Transcriptome analysis of the mobile genome ICEclc in Pseudomonas knackmussii B13
Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland
... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were
predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map
of ICEclc was designed from SeqBuilder of the Lasergene software package ...
Food Microbiology
Volume 26, Issue 1, February 2009, Pages 52-57
Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis
Emmanuel Coton and Monika Coton
aADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France
... Prokaryotic promoter prediction was performed using the Internet site http://www.fruitfly.org/
seq_tools/promoter.html; while, transcription terminators were predicted using the FindTerm
program at http://www.softberry.ru. 3. Results and discussion. 3.1. ...
Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080
Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing
Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA
... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table
2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent
terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...
Research in Microbiology
Volume 160, Issue 6, July-August 2009, Pages 401-408
Characterization of salivaricin CRL 1328, a two-peptide bacteriocin produced by Lactobacillus salivarius CRL 1328 isolated from the human vagina
Esteban Vera Pingitore, Elvira Maria Hebert, Maria Elena Nader-Macias and Fernando Sesma
aCentro de Referencia para Lactobacilos (CERELA–CONICET), Chacabuco 145 (T4000ILC), San Miguel de Tucuman, Tucuman, Argentina
... The presence of putative promoter elements was predicted by Neural Network Promoter
Prediction (http://www.fruitfly.org/seq_tools/promoter.html). Transcriptional terminators were
predicted with the FindTerm algorithm (http://www.softberry.ru/berry.phtml). ...
Journal of Bacteriology
February 2009, p. 1056-1065, Vol. 191, No. 3
Transcription of clpP Is Enhanced by a Unique Tandem Repeat Sequence in Streptococcus mutans
Jiaqin Zhang 1,2, Anirban Banerjee 1, and Indranil Biswas 1*
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160,1 Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong 250012, China2
... 55). The intergenic region between clpP and SMU.1671, which is 115 bp long,
encodes a putative -independent terminator located between bp 85 and 109 that
was identified by the FindTerm program (Softberry, Inc.). Figure ...
Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10
Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii
Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504
... gordonii genome sequence were detected using the BProm and FindTerm modules of the
fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...
Journal of Bacteriology
doi:10.1128/JB.01436-08 JB Accepts, published online ahead of print on 1 December 2008
Transcription of clpP is enhanced by a unique tandem repeat sequence in Streptococcus mutans
Jiaqin Zhang, Anirban Banerjee, and Indranil Biswas
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160; Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong, 250012, P R China
... encodes a putative ?-independent terminator located between 85- and 109-bp that
was identified 18 by FindTerm program (Softberry Inc.). 19 ...
Food Microbiology
doi:10.1016/j.fm.2008.07.009
Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis
Emmanuel Coton and Monika Coton
ADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France
... site http://www.fruitfly.org/seq_tools/promoter.html; while, transcription terminators
were predicted using the FindTerm program at http://www.softberry.ru. ...
Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0
Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes
Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA
... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry.
com), were used for operon and gene predictions. RESULTS. ...
Nucleic Acids Research
doi:10.1093/nar/gkm836 published online on October 16, 2007
Characterization of bacterial operons consisting of two tubulins and a kinesin-like gene by the novel Two-Step Gene Walking method
Martin Pilhofer et al.,
Lehrstuhl fur Mikrobiologie, Technical University Munich, Am Hochanger 4, D-85354 Freising, Germany
... The prediction of Rho-independent terminators was performed with the
program FindTerm
(www.softberry.com/berry.phtml?topic=findterm&group=programs&subgroup ...
Microbiology
153 (2007), 2148-2158;
ss-Dependent carbon-starvation induction of pbpG (PBP 7) is required for the starvation-stress response in Salmonella enterica serovar Typhimurium
William J. Kenyon et al.,
Department of Biomedical Sciences, University of South Alabama, Mobile, AL 36688, USA
... Relevant nucleotide sequences were retrieved using the NCBI's Entrez server. Bacterial
terminator analysis was done using FindTerm (http://www.softberry.com/). ...
Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54
Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520
Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China
... Promoter and terminator predictions were performed using BPROM and FindTerm,
respectively (http://www.softberry.com/berry.phtml). ...
Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753
Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture
Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States
... the sequences for bacterial promoters and rho-independent transcription termination
sites was performed using BPROM and FindTerm, available at www.softberry.com ...
Journal of Bacteriology,
June 2006, p. 4362-4372, Vol. 188, No. 12
Characterization of a Novel Partition System
Encoded by the d and w Genes from the Streptococcal Plasmid pSM19035
Micha Dmowski,* Izabela Sitkiewicz, and Piotr Cegowski
Department of Microbial Biochemistry, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawiskiego 5A, 02-106 Warsaw, Poland
... Despite the presence of a putative rho-independent terminator (FindTerm; Softberry)
(positions 6281 to 6337 in pBT233), we wanted to confirm that and ...
Molecular Microbiology, Volume 59, Number 2, January 2006, pp. 541-550(10)
A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.
... promoter sequences and rho-independent terminators that could result in
an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...
Journal of Bacteriology, January 2006, p. 160-168, Vol. 188, No. 1
Identification of the syr-syp Box in the Promoter Regions of Genes Dedicated to Syringomycin and Syringopeptin Production by Pseudomonas syringae pv. syringae B301D
Nian Wang,1, Shi-En Lu,1, Qingwu Yang,2 Sing-Hoi Sze,3 and Dennis C. Gross1*
Department of Plant Pathology and Microbiology,1 Department of Computer Science,2 Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 778433
... typical rho-independent terminators, located after the syrP-syrD-sypA-sypB operon
and the syrC gene, were identified by the FindTerm program (Softberry) (Fig. ...
Journal of Bacteriology, January 2006, p. 202-210, Vol. 188, No. 1
Reconstruction and Regulation of the Central Catabolic Pathway in the Thermophilic Propionate-Oxidizing Syntroph Pelotomaculum thermopropionicum
Tomoyuki Kosaka,1 Taku Uchiyama,1 Shun-ichi Ishii,1 Miho Enoki,1,2 Hiroyuki Imachi,3 Yoichi Kamagata,2 Akiyoshi Ohashi,3 Hideki Harada,3 Hiroshi Ikenaga,1 and Kazuya Watanabe1*
Laboratory of Applied Microbiology, Marine Biotechnology Institute, Kamaishi, Iwate 026-0001,1 Japan3
... were manually checked. Terminator sequences were analyzed using the FindTerm
program (SoftBerry). Molecular weights and isoelectric ...
Molecular Microbiology, Volume 59, Number 2, January 2006, pp. 541-550(10)
A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.
... promoter sequences and rho-independent terminators that could result in an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...
Bacterial Genomes Explorer
Theoretical and Applied Genetics
February 2013, DOI: 10.1007/s00122-013-2052-6
Structure, transcription and post-transcriptional regulation of the bread wheat orthologs of the barley cleistogamy gene Cly1
Ning et al.,
1. Plant Genome Research Unit, National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki, 305-8602, Japan
2. Graduate school of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba, 271-8510, Japan
... cgi). Softberry Bacterial Genome Explorer (http://www.linux1.softberry.com/berry.
phtml) software was then used to allow the simultaneous comparison of distinct
annotated genomes. Phylogenetic analysis. Protein sequence ...
Various programs
Bioprocess and biosystems engineering
2014, 37(2), 245-260. DOI:10.1007/s00449-013-0991-6
Mevalonate production by engineered acetogen biocatalyst during continuous fermentation of syngas or CO2/H2 blend
Kiriukhin, M., Tyurin, M.
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
2. Ajinomoto-Genetika Research Institute, 1-st Dorozny pr. 1-1, Moscow, 117545, Russia
M Kiriukhin, M Tyurin - Bioprocess and biosystems engineering, 2014 - Springer
... Promoter and terminator sequences for the components of all vectors. Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://?linux1.?softberry.?com/?). RT-PCR. ...
Journal of industrial microbiology & biotechnology
2014, 41(5), 763-781. DOI:10.1007/s10295-014-1416-5
Genome tailoring powered production of isobutanol in continuous CO2/H2 blend fermentation using engineered acetogen biocatalyst
Gak E., Tyurin M., Kiriukhin M.
2. Prosp. Andropova 19, kv. 27, 115470, Moscow, Russia
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
... 1 3 Promoter and terminator sequences for the components of all vectors Promoter and terminator
sequences for the compo- nents of all vectors were identified using the softBerry Bacterial
Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). Rt-PcR ...
World Journal of Microbiology and Biotechnology
2014, 30(5), 1559-1574. DOI:10.1007/s11274-013-1579-7
UVC-mutagenesis in acetogens: resistance to methanol, ethanol, acetone, or n-butanol in recombinants with tailored genomes as the step in engineering of commercial biocatalysts for continuous CO2/H2 blend fermentations.
Kiriukhin M., Tyurin M., Gak E
State
... Promoter and terminator sequences for the components of all vectors. Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). ...
Proceedings of the National Academy of Sciences, India Section B: Biological Sciences,
2014, 84(1), 131-143. DOI:
Organization and classification of cytochrome P450 genes in Castor (Ricinus communis L.).
Kumar, M. S., Babu, P. R., Rao, K. V., & Reddy, V. D.
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500007, India
... The CYP proteins which are below 300 and above 600 amino acids were validated
by using Softberry gene prediction tool (http://linux1.softberry. com/berry.phtml) by
increasing the scaffold size to 2,000 bp upstream of 50 end. ...
Plant Systematics and Evolution
2014, 1-6. DOI: 10.1007/s00606-014-1066-0
Classification of cytochrome P450s in common bean (Phaseolus vulgaris L.)
Kumar, M. S., Chakravarthy, S. S., Babu, P. R., Rao, K. V., & Reddy, V. D.
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500 007, India
... The CYP proteins which are below 300 and above 600 amino acids were validated
using Soft- berry gene prediction tool (http://linux1.softberry.com/ berry.phtml) by
increasing the scaffold size to 2,000 bp upstream of 50 end. ...
Tree Genetics &: Genomes
2014, 10(2), 399-409. DOI: 10.1007/s11295-013-0695-8
Structural organization, classification and phylogenetic relationship of cytochrome P450 genes in Citrus clementina and Citrus sinensis
Mittapelli, S. R., Maryada, S. K., Khareedu, V. R., & Vudem, D. R.
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500 007, India
... Out-of- range CYP candidate proteins which are below 300 and above 600 amino acids
were validated by using Softberry gene prediction tool (http://linux1.softberry.com/berry.phtml)
by increasing the scaffold size to 2,000-bp upstream of 5? end. ...
Journal of Molecular Catalysis B: Enzymatic, 104, 23-28.
2014, 104, 23-28. DOI: 10.1016/j.molcatb.2014.03.001
Characterization of a novel cold-adapted phosphinothricin N-acetyltransferase from the marine bacterium Rhodococcus sp. strain YM12.
Wu G. et al.,
a State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China
b Key Laboratory of Protection and Utilization of Biological Resources in Tarim Basin of Xinjiang Production and Construction Corps, College of Life Science, Tarim University, Alar 843300, Xinjiang, China
... 2.4. Gene analysis and cloning. DNA sequences were analyzed using the Softberry Gene Finding
tool (http://linuxl.softberry.com/berry/). The DNA and protein sequence alignments were carried
out using the Blast program (http://blast.ncbi.nlm.nih.gov/Blast). ...
Enzyme and Microbial Technology.
Volume 63, September 2014, Pages 64–70 DOI: 10.1016/j.enzmictec.2014.02.010
Characterization and site-directed mutagenesis of a novel class II 5-enopyruvylshikimate-3-phosphate (EPSP) synthase from the deep-sea bacterium Alcanivorax sp L27
Zhang Y. et al.,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, People's Republic of China
b National Key Laboratory of Crop Genetic Improvement, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, People's Republic of China
... 2.4. Gene Analysis. The recombinant plasmid pUC-3.66k was sequenced by
Genscript. (Nanjing, China), and the nucleotide sequences were analyzed using
the Softberry Gene Finding tool (http://linuxl.softberry.com/berry/). ...
Microbiology
2014, mic.0.077818-0 DOI: 10.1099/mic.0.077818-0
Calcineurin phosphatase and phospholipase C are required for developmental and pathological functions in the citrus fungal pathogen Alternaria alternata.
Tsai H. C., Chung K. R.
Institute of Food and Agricultural Sciences, University of Florida, USA
... Open reading 23 Page 8. Microbiology 8 frame (ORF) and exon/intron positions were
predicted using Softberry gene-finding software 1 (http://www.softberry.com). Fungal
RNA was purified with Trizol reagent (Molecular Research 2 ...
Journal of Plant Biochemistry and Biotechnology
2014, , 1-5. DOI: 10.1007/s13562-014-0266-6
Development of intron-containing barnase gene (barnase-int) encoding a toxic protein to facilitate its cloning in bacterial cells
Mehrotra, A. K., Bhullar, S., Burma, P. K.
1. Department of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi, 110021, India
... Analysis of the promoter AEG1 using SOFTBERRY (www. softberry.com) showed that it contained
sequences similar to ?10 and ?35 regions of prokaryotic promoters (Table 1). These putative
bacterial promoters could possibly have been activated in E. coli cells. ...
Journal of experimental botany
2014, eru164. DOI: 10.1093/jxb/eru164
A novel gene, MdSSK1, as a component of the SCF complex rather than MdSBP1 can mediate the ubiquitination of S-RNase in apple
Yuan H et al.,
1 Laboratory of Fruit Cell and Molecular Breeding, College of Agronomy and Bio-tech, China Agricultural University, Beijing 100193, China
2 College of Horticulture, Shenyang Agricultural University, Shenyang 110866, China
... Mixtures were immunoblotted with anti-S-RNase. Sequence analysis. The gene analysis
and chromosomal locations were searched using the apple genome database
(http://genomics.research.iasma.it/, http://linux1.softberry.com/berry.phtml). ...
...and then the contig was annotated using Softberry (http://linuxl.softberry.com/berry.phtml). ...
Food chemistry
2014, 162, 229-234. DOI: 10.1016/j.foodchem.2014.04.069
A novel low-temperature-active pectin methylesterase from Penicillium chrysogenum F46 with high efficiency in fruit firming.
Pan X. et al.,
a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, People’s Republic of China
b National Animal Husbandry Extension Service, Beijing 100125, People’s Republic of China
... BLAST/). The promoter was predicted by the online eukaryote promoter prediction
programme (http://www.fruitfly.org/seq_tools/promoter.html). The introns were
predicted by softberry software (http://linux1.softberry.com/). The ...
World Journal of Microbiology and Biotechnology
2014, 30(1), 181-189. DOI: 10.1007/s11274-013-1436-8
Cloning and characterization of two allelic glyceraldehyde-3-phosphate dehydrogenase genes in Auricularia auricula-judae.
Fan X. et al.,
1. Institute of Applied Mycology, Huazhong Agricultural University, No. 1 Shizishan Rd., Wuhan, 430070, Hubei, China
2. Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, China
... The SoftBerry program (http://?linux1.?softberry.?com) was used to predict the amino acid
sequence. Southern blot analysis. Approximately 20 ?g genomic DNA was digested separately
using HindIII, EcoRI, BssHII, or MaeI, and fractionated on 0.8 % (w/v) agarose gels. ...
FEMS microbiology letters
16 APR 2014 DOI: 10.1111/1574-6968.12435
Genomic analysis of Pseudomonas aeruginosa PA96, the host of carbapenem resistance plasmid pOZ176.
Deraspe, M. et al.,
1 Centre de Recherche en Infectiologie, CHU de Quebec, Quebec, QC, Canada
2 Departement de Biochimie, de microbiologie, et de bio-informatique, Universite Laval, Quebec, QC, Canada
... Additional software, including is finder (http://www-is.biotoul.fr), gcg (Version 11.1; Accelrys Inc.,
San Diego, CA), and various Softberry programs (http://linux1.softberry.com/berry.phtml), were
used for analysis of features such as IS elements and genomic islands. ...
PloS one
2014, 9(4), e94430. DOI: 10.1371/journal.pone.0094430
Cloning and Characterization of TaPP2AbB"-a, a Member of the PP2A Regulatory Subunit in Wheat
Liu D. et al.,
State National Key Facility for Crop Gene Resources and Genetic Improvement/Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China
... Sequence alignments and comparisons were implemented by the MegAlign program
in DNAStar and DNAman. Protein predictions were performed using Softberry
(http://www.softberry.com). Subcellular localization of TaPP2AbB"-? protein. ...
PloS one
2014, 9(7), e101033. DOI: 10.1371/journal.pone.0101033
Impact of Acinetobacter baumannii Superoxide Dismutase on Motility, Virulence, Oxidative Stress Resistance and Susceptibility to Antibiotics
Heindorf, M., Kadari, M., Heider, C., Skiebe, E., & Wilharm, G.
Robert Koch-Institute, Wernigerode Branch, Wernigerode, Germany
... 2714817 to 2715729. This region includes A1S_2343 as well as the putative promotor
and terminator region of the gene as identified using the softberry package available
online (http://linux1.softberry.com/berry.phtml). The PCR ...
Molecular Genetics and Genomics
2014, 289(3), 361-372. DOI: 10.1007/s00438-014-0815-7
Comparative analysis of alternative splicing, alternative polyadenylation and the expression of the two KIN genes from cytoplasmic male sterility cabbage (Brassica oleracea L. var. capitata L.)
Tao P. et al.,
1. Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
2. College of Horticulture, Nanjing Agricultural University, Nanjing, 210095, China
... l. The transcription start site (TSS) of each KIN gene was predicted using SoftBerry
(http://linux1.softberry.com/ berry.phtml). ... expression. at first, we used SoftBerry to
predict the transcription start site (TSS) of the two KIN genes. ...
Microbiological research
2014, 169(5), 453-462 DOI: 10.1016/j.micres.2013.08.004
Cloning, expression and phylogenetic analysis of a divergent laccase multigene family in Auricularia auricula-judae
Fan X. Z. et al.,
a Institute of Applied Mycology, Huazhong Agricultural University, No. 1 Shizishan Rd., Wuhan 430070, Hubei, China
b Key Laboratory of Agro-Microbial Resource and Development, Ministry of Agriculture, Wuhan, China
... Corporation (Nanjing, China). DNAMAN version 5.2.2 software was used for sequences
analysis and assembly. The SoftBerry program (http://linux1.softberry.com) was used
to predict the amino acid sequence. The deduced amino ...
Plant molecular biology
July 2014, Volume 85, Issue 4-5, pp 333-347 DOI: 10.1007/s11103-014-0192-y
RcLEA, a late embryogenesis abundant protein gene isolated from Rosa chinensis, confers tolerance to Escherichia coli and Arabidopsis thaliana and stabilizes enzyme activity under diverse stresses.
Zhang X. et al.,
1. State Key Laboratory of Genetic Engineering, Institute of Genetics, Fudan University, 220 Handan Road, Shanghai, 200433, China
2. Institute of Plant Biology, School of Life Science, Fudan University, 220 Handan Road, Shanghai, 200433, China
... (GRAVY) analysis of deduced amino acid sequence was performed by using the ExPasy
(http://www.expasy.org/ tools), PSORT (http://psort.ims.u-tokyo.ac.jp), and Soft- Berry
(http://www.softberry.com) programs. RNA isolation and expression analysis ...
Journal of Agricultural Science and Technology
2014, 16(1), 191-202. DOI:
Isolation and Characterization of DBR2 Gene Promoter from Iranian Artemisia annua
Sarvestani, R., Peyghambary, S. A., Abbasi, A.
Department of Agronomy and Plant Breeding, Agricultural College, University of Tehran, Karaj, Islamic Republic of Iran
... DNA sequencing was performed on an ABI 373A automated sequence. Then, promoter prediction,
characterization, and search for the putative cis-acting elements were carried out using different
databases: Softberry, PlantCARE [23] and PLACE [24]. Page 4. ...
Plant molecular biology
2014, 84(3), 243-257. DOI: 10.1007/s11103-013-0129-x
The maize d2003, a novel allele of VP8, is required for maize internode elongation.
Lv H. et al.,
1. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Zhongguancun South Street 12, Beijing, 100081, China
2. College of Agriculture and Biotechnology, China Agricultural University, Yuanmingyuan West Road 2, Beijing, 100193, China
... that the d2003 gene was located within the AC210968 BAC clone (Fig. 4A, c and e). The
Softberry program (http://linux1.softberry.com/ berry.phtml), the genome annotation software,
was used to predict the candidate genes within the AC210968 BAC clone. ...
FEMS microbiology letters
2014, 354(1), 19-26. DOI: 10.1111/1574-6968.12431
Antibacterial enzymes from the functional screening of metagenomic libraries hosted in Ralstonia metallidurans
Iqbal, H. A., Craig, J. W., Brady, S. F.
Laboratory of Genetically Encoded Small Molecules, Howard Hughes Medical Institute, The Rockefeller University, New York, NY, USA
... Sequences were annotated using the online tool softberry to predict open-reading frames
(ORFs), and alignments to blast and PFAM databases were used to predict gene function
(Altschul et al., 1990; Solovyev & Salamov, 2011; Punta et al., 2012). ...
Archives of virology
2014, 1-3. DOI: 10.1007/s00705-014-2005-7
Complete genome sequence of the Pectobacterium carotovorum subsp. carotovorum virulent bacteriophage PM1.
Lim J. A. et al.,
1. Microbial Safety Division, National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Korea
2. Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, Seoul National University, Seoul, 151-921, Korea
... Page 2. software (Softberry Inc., Mount Kisco, NY), and the function of the predicted ORFs
was assessed using BLASTP [1] and Pfam domain prediction. Prediction of the tRNA coding
region was performed using the tRNAscan- SE software [14]. ...
Journal of integrative plant biology
2014, 56(3), 315-332. DOI:10.1111/jipb.12144
SbHKT1; 4, a member of the high?affinity potassium transporter gene family from Sorghum bicolor, functions to maintain optimal Na+/K+ balance under Na+ stress
Wang T. T. et al.,
1 Key Laboratory of Plant Resources, Institute of Botany, the Chinese Academy of Sciences, Beijing, China
2 College of Life Sciences, Capital Normal University, Beijing, China
... protein (GFP) in the control was observed in the border and the cell nucleus, but cells expressing
the SbHKT1;4::GFP displayed a bright border fluorescence, which was consistent with the cell
membrane-localized prediction by TMHMM server and the softberry online database ...
Gene
2014, 538(1), 12-22. DOI: 10.1016/j.gene.2014.01.029
Characterization of three Arabidopsis thaliana immunophilin genes involved in the plant defense response against Pseudomonas syringae.
Pogorelko G. V. et al.,
a 219 Bessey Hall, Department of Plant Pathology and Microbiology, Iowa State University, Ames 50014, IA, USA
b NI Vavilov Institute of General Genetics, Russian Academy of Sciences, Moscow 119991, Russia
... Using the Softberry online bioinformatics tools (http://linux1.softberry.com/berry.phtml) allowed
us to identify endogenous promoter elements 58 nucleotides upstream of AtCYP19 start codon,
214 nucleotides upstream AtCYP57 and 303 nucleotides upstream AtFKBP65. ...
Environmental microbiology
2014 DOI: 10.1111/1462-2920.12409
Degradation of oxalic acid by the mycoparasite Coniothyrium minitans plays an important role in interacting with Sclerotinia sclerotiorum
Zeng L. M. et al.,
1 State Key Laboratory of Agricultural Microbiology, Key Laboratory of Plant Pathology of Hubei Province, Huazhong Agricultural University, Wuhan, China
2 United States Department of Agriculture, Agricultural Research Service, Washington State University, Pullman, WA, USA
... Analysis using the Softberry program (Softberry Inc., New York, USA) predicted that the open
reading frame (ORF) of Cmoxdc2 is 1227 bp long and is interrupted by five introns varying
in length from 48 to 70 bp long (Supporting Information Fig. S3). ...
World Journal of Microbiology and Biotechnology
2014, 30(2), 613-620. DOI: 10.1007/s11274-013-1477-z
Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate
Wang J. R. et al.,
1. Department of Bioengineering, College of Food Science, South China Agricultural University, 482 Wu-Shan Road, Tian-He District, Guangzhou, 510642, Guangdong, China
3. Guangdong VTR Bio-Tech Co., Ltd., Zhuhai, China
... Further analyses of the sequences were performed by using Recognition of Regulatory Motifs
with statistics in the softberry software (http://www.softberry.rn/berry.html) and PLACE Web
Signal Scan (http://www.dna.affrc.go.jp/PLACE/signalscan.html). ...
PloS one
2014, 9(6), e98873. DOI: 10.1371/journal.pone.0098873
High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes
Catone M. V. et al.,
Departamento de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina
Universidad de Buenos Aires, Buenos Aires, Argentina, Instituto de Investigaciones en Biociencias Agricolas y Ambientales, CONICET, Buenos Aires, Argentina
... fr/cap3.php), ORFfinder (http://www.ncbi.nlm.nih.gov/projects/gor?f/), and ClustalW
(http://www.ebi.ac.uk/Tools/clustalw/). Promoters were predicted using Softberry
program (http://linux1.softberry.com/berry.phtml). thumbnail. ...
3 Biotech
September 2013, DOI:10.1007/s13205-013-0164-y
Siderophore biosynthesis genes of Rhizobium sp. isolated from Cicer arietinum L.
Bejoysekhar Datta, Pran K. Chakrabartty
1. Department of Botany, University of Kalyani, Nadia, Kalyani, West Bengal, 741 235, India
2. Acharya J.C. Bose Biotechnology Innovation Centre, Madhyamgram Experimental Farm, Madhyamgram, Kolkata, West Bengal, 700 129, India
... an operon. In the sequence of 4,921 bp, a probable ribosome-binding site (AGGAGG)
was identified six bp upstream of the ATG start codon of sidC of BICC 651 using Promoter
prediction search tool (www.softberry.com). A presumable ...
Applied Microbiology and Biotechnology
Volume 97, Issue 5 , pp 1941-1952 DOI:10.1007/s00253-012-4044-x
Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen
Sun et al.,
1. State Key Laboratory of Microbial Technology, Shandong University, Jinan, 250100, People’s Republic of China
2. Scientific Research Center, Tsingtao Brewery Co.LTD, Qingdao, People’s Republic of China
... Predictions of the open-reading frames (ORF), prokaryotic promoters, and terminators were
performed at http://opal.biology.gatech.edu/ GeneMark/gmhmm2_prok.cgi and http://www.softberry.
com/ berry.phtml. Transcription analysis of the S-layer proteins by qRT-PCR ...
Journal of Industrial Microbiology & Biotechnology
Volume 40, Issue 7 , pp 749-758 DOI:10.1007/s10295-013-1279-1
Gene replacement and elimination using ?Red- and FLP-based tool to re-direct carbon flux in acetogen biocatalyst during continuous CO2/H2 blend fermentation
Michael Tyurin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
... Promoter and terminator sequences. Promoter and terminator sequences used in both vectors
were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool
(http://linux1.softberry.com/). Primers for the synthetic genes used in this project are listed in Table ...
World Journal of Microbiology and Biotechnology
Volume 29, Issue 9 , pp 1611-1623 DOI:10.1007/s11274-013-1324-2
Selective methanol or formate production during continuous CO2 fermentation by the acetogen biocatalysts engineered via integration of synthetic pathways using Tn7-tool
Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
2. Ajinomoto-Genetika Research Institute, 1st Dorozhny Pr. 1-1, 117545, Moscow, Russia
... early sporulation gene. Promoter and terminator sequences for the components of
all vectors used were identified using SoftBerry Bacterial Promoter, Operon and Gene
Finding tool (http://linux1.softberry.com/). The confirmation ...
Bioprocess Biosyst Eng.
2013 Jun 18. DOI:
Mevalonate production by engineered acetogen biocatalyst during continuous fermentation of syngas or CO2/H 2 blend.
Kiriukhin M, Tyurin M.
Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA.
... Promoter and terminator sequences for the components of all vectors. Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR. ...
Journal of Applied Microbiology
Volume 114, Issue 4, pages 1033–1045, April 2013 DOI:10.1111/jam.12123
Expression of amplified synthetic ethanol pathway integrated using Tn7-tool and powered at the expense of eliminated pta, ack, spo0A and spo0J during continuous syngas or CO2/H2 blend fermentation
M. Kiriukhin 1, M. Tyurin 2,
1Ajinomoto-Genetika Research Institute, Moscow, Russia
2Syngas Biofuels Energy, Inc, Houston, TX, USA
... Promoter and terminator sequences for the components of all vectors. Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). rtPCR. ...
Applied Biochemistry and Biotechnology
Volume 170, Issue 6 , pp 1503-1524 DOI:10.1007/s12010-013-0285-0
Synthetic 2,3-Butanediol Pathway Integrated Using Tn7-tool and Powered Via Elimination of Sporulation and Acetate Production in Acetogen Biocatalyst
Michael Tyurin, Michael Kiriukhin
State
... Promoter and Terminator Sequences for the Components of All Vectors Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR ...
Theoretical and Applied Genetics
Volume 126, Issue 5 , pp 1273-1283 DOI:10.1007/s00122-013-2052-6
Structure, transcription and post-transcriptional regulation of the bread wheat orthologs of the barley cleistogamy gene Cly1
Ning et al.,
1. Plant Genome Research Unit, National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki, 305-8602, Japan
2. Graduate school of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba, 271-8510, Japan
... cgi). Softberry Bacterial Genome Explorer (http://www.linux1.softberry.com/berry.
phtml) software was then used to allow the simultaneous comparison of distinct
annotated genomes. Phylogenetic analysis. Protein sequence ...
Applied Biochemistry and Biotechnology
Volume 169, Issue 3 , pp 950-959 DOI: 10.1007/s12010-012-0060-7
Selective n-Butanol Production by Clostridium sp. MTButOH1365 During Continuous Synthesis Gas Fermentation Due to Expression of Synthetic Thiolase, 3-Hydroxy Butyryl-CoA Dehydrogenase, Crotonase, Butyryl-CoA Dehydrogenase, Butyraldehyde Dehydrogenase, and NAD-Dependent Butanol Dehydrogenase
Vel Berzin, Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA
2. Ajinomoto–Genetika Research Institute, 1st Dorozhny pr. 1-1, 117545, Moscow, Russia
... Promoter and terminator sequences for the components of all vectors were identified using
SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/).
Electrotransformation procedure [7] was used in modification. ...
FGENESV, FGENESV0
Archives of Virology
2016, 1-4. doi:10.1007/s00705-016-3005-6
The complete genome sequence of PE3-1, a novel E. coli O153 phage
Liu, H. et al.,
College of Resources and Environmen tUniversity of Chinese Academy of Sciences
... Potential ORFs were predicted using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html),
and ORFs were further identified using GLIMMER (ver.3.02) [15] and the ''Gene Finding in Viral
Genomes'' function in Softberry (http://linux1.softberry.com/all.htm). ...
Genome Announcements
2016, 4(3), e00536-16. doi: 10.1128/genomeA.00536-16
Genome sequence of Vaccinia virus strain Lister-Butantan, a Lister vaccine variant used during a smallpox eradication campaign in Brazil
Assis, F. et al.,
aLaboratorio de Virus do Instituto de Ciencias Biologicas da Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais, Brazil
bNational Center for Emerging and Zoonotic Infectious Diseases (NCEZID), Centers for Disease Control and Prevention, Atlanta, Georgia, USA
... Chromatogram data were assembled using SeqMerge (Accelrys, Inc., Madison, WI), Phred/Phrap
was used for base-calling and assembly software, and Consed was used for sequence editing.
The FgenesV tool was used for gene prediction (http://www.softberry.com/). ...
Genome Announcements
2016, 4(3), e00601-16. doi: 10.1128/genomeA.00601-16
Complete genome sequences of T1-like phages JMPW1 and JMPW2
Shen, M. et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing, People’s Republic of China
... Genome annotations of the phages were revealed using fgenesV (http://linux1.softberry.com/
berry.phtml?topic=virus&group=programs&subgroup=gfindv) and manually verified by screening
all the predicted proteins against the NCBI protein database using BLASTp (6). Then ...
Evolutionary Bioinformatics Online
2016, 12(Suppl 2), 1. doi: 10.4137/EBO.S38518
Bioinformatic Characterization of Mosquito Viromes within the Eastern United States and Puerto Rico: Discovery of Novel Viruses
Frey, K. G. et al.,
1Naval Medical Research Center – Frederick, Fort Detrick, MD, USA.
2Henry M. Jackson Foundation, Bethesda, MD, USA.
3Hood College, Frederick, MD, USA
... A second in silico gene finder, FGENESV (linux1.softberry.com), confirmed the four ORFs. ...
Viruses
2016, 8(3), 76; doi:10.3390/v8030076
A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae
Dornas, F. P. et al.,
1 Laboratorio de Virus, Departamento de Microbiologia, Instituto de Ciencias Biologicas, Universidade Federal de Minas Gerais, Belo Horizonte, Minas Gerais 31270-901, Brazil
2 Unite de Recherche sur les Maladies Infectieuses et Tropicales Emergentes (URMITE) UM63 CNRS 7278 IRD 198 INSERM U1095, Aix-Marseille Univ., 27 boulevard Jean Moulin, Faculte de Medecine, Marseille 13385, France
... Gene predictions were performed using FgenesV [31], RAST (Rapid Annotation using Subsystem Technology) [32] and GeneMarkS [33] tools, and merged. ...
Journal of Invertebrate Pathology
2016, 139, 56-66. doi:10.1016/j.jip.2016.07.011
An alphabaculovirus isolated from dead Lymantria dispar larvae shows high genetic similarity to baculovirus previously isolated from Lymantria monacha–An example of adaptation to a new host
Rabalski, L., Krejmer-Rabalska, M., Skrzecz, I., Wasag, B., Szewczyk, B.
a Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Laboratory of Recombinant Vaccines, Abrahama Str. 58, 80-307 Gdansk, Poland
b Forest Research Institute, Department of Forest Protection, Raszyn Braci Lesnej Str. 3, 05-090 Sekocin Stary, Poland
... ORFs were identified using Glimmer3 (gene model pre-computed on RefSeq LdMNPV genome (NC_001973)) (Delcher et al., 2007),
GeneMarkS (parameter: intron less eukaryotic-virus) (Borodovsky and McIninch, 1993)
(http://linux1.softberry.com/berry.phtml?topic=virus0&group=programs&subgroup=gfindv), and tcode EMBOSS 6.5.7 (Rice et al., 2000)....
PloS one
2016, 11(7), e0160389. doi: 10.1371/journal.pone.0160389
The Complete Genome Sequence of Plodia Interpunctella Granulovirus: Evidence for Horizontal Gene Transfer and Discovery of an Unusual Inhibitor-of-Apoptosis Gene
Harrison, R. L., Rowley, D. L., Funk, C. J.
Invasive Insect Biocontrol and Behavior Laboratory, Beltsville Agricultural Research Center, USDA Agricultural Research Service, Beltsville, Maryland, United States of America
Department of Biology, John Brown University, Siloam Springs, Arkansas, United States of America
.. eg no matches with
e-values <0.010) were annotated if they did not overlap a larger ORF by >75 bp and if they were
predicted to be protein-encoding by both the fgenesV (http://linux1.softberry.com/berry ...
BULLETIN OF THE EUROPEAN ASSOCIATION OF FISH PATHOLOGISTS
2016, 36(1), 11-23.
Novel viral infections threatening Cyprinid fish
Haenen, O. et al.,
1 Central Veterinary Institute of Wageningen UR, The Netherlands; 2 Centre for Environment, Fisheries
and Aquaculture Science (CEFAS), Weymouth DT4 8UB, England
... Fish Pathol., 36(1) 2016, 19 sembler), (Hunt et al., 2015). Surprisingly a 16 kb putative viral
sequence was generated and subsequently annotated using a selection of bioinformatics tools
including FGENESV0 (htp://linux1.softberry.com), Prokka (Seemann, 2014) and BLAST. ...
PloS one
2016, 11(5), e0155134 doi: 10.1371/journal.pone.0155134
Genome Sequencing and Analysis of Catopsilia pomona nucleopolyhedrovirus: A Distinct Species in Group I Alphabaculovirus
Wang, J. et al.,
State Key Laboratory of Virology and China Center for Virus Culture Collection, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
...Putative ORFs were analyzed
using the FGENESV0 program (http://www.softberry.com/berry.phtml) [48] and the
NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). ...
J. Gen. Virol.
March 2016 97: 706-714, doi: 10.1099/jgv.0.000394
A Cripavirus in the brown planthopper, Nilaparvata lugens
Wang, S. L., Cheng, R. L., Lu, J. B., Yu, X. P., Zhang, C. X.
1? State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Science, Zhejiang University, Hangzhou, Zhejiang 310058, PR China 2? College of Life Science, China Jiliang University, Hangzhou, Zhejiang 310018, PR China
... The NlCV genome sequence comprised 9144 nt, excluding the 3! poly(A) tail, with 37.8 %
GC content. The coding sequence (CDS) of the virus genome was predicted through
the FGENESV0 program in SoftBerry (http://linux1.softberry. ...
Genome Announcements
2016, 4(3), e00115-16. doi: 10.1128/genomeA.00115-16
Complete genome sequence of bacteriophage Deep-Blue infecting emetic Bacillus cereus
Hock, L., Gillis, A., Mahillon, J.
Laboratory of Food and Environmental Microbiology, Universite Catholique de Louvain, Louvain-la-Neuve, Belgium
... Genome Announc 4(3):e00115-16. doi:10.1128/genomeA.00115-16. Copyright © 2016 Hock
et al. ... The potential coding sequences (CDSs) were pre- dicted using Glimmer v3.02 (5), RAST
2.0 (6), GenMarkS 2.5p (7), and FgenesV (http://www.softberry.com/). ...
Veterinary microbiology
2016, 182, 135-140. doi:10.1016/j.vetmic.2015.11.015
Genomic characterisation of canine papillomavirus type 17, a possible rare cause of canine oral squamous cell carcinoma
Munday, J. S., Dunowska, M., Laurie, R. E., Hills, S.
a College of Science, Massey University, Palmerston North, New Zealand
b Otago Genomics and Bioinformatics Facility, Otago University, Dunedin, New Zealand
... 8.04 software (Drummond et al., 2010). 2.3. DNA and protein sequence analysis.
The putative coding regions in the PV sequence were predicted using FGENESV0
(http://linux1.softberry.com). The characteristics of the putative ...
Virus genes
2016, 1-7. DOI: 10.1007/s11262-016-1340-z
Genomic characterization of a novel Epsilonpapillomavirus associated with pigmented papillomas in a red deer (Cervus elaphus)
Munday, J. S. et al.,
1. College of Science, Massey University, Palmerston North, New Zealand
2. Gribbles Veterinary Pathology, Palmerston North, New Zealand
... Geneious version 8.04 software [12]. DNA and protein sequence analysis The
putative coding regions in the PV sequence were predicted using FGENESV0
(http://linux1.softberry.com). The characteristics of the putative viral ...
Archives of virology
2016, 161(1), 209-212. DOI: 10.1007/s00705-015-2608-7
Genome sequence of a cluster A13 mycobacteriophage detected in Mycobacterium phlei over a half century ago
Marton, S. et al.,
1. Institute for Veterinary Medical Research, Centre for Agricultural Research, Hungarian Academy of Sciences, Hungaria krt 21, 1143, Budapest, Hungary
2. Biological Research Centre, Hungarian Academy of Sciences, Temesvari krt. 62, 6726, Szeged, Hungary
... with MIRA 4.0. GeneMarkS, FGENESV [http://www.softberry.com/], Glimmer 3.02
and DNA Master 5.22.9 software were applied for genome annotation and gene
prediction [1–3, 15; http:// phagesdb.org/]. Protein homology was ...
Virologica Sinica
2015, 30(6), 417-424. DOI: 10.1007/s12250-015-3658-4
Genome sequencing and analysis of a granulovirus isolated from the Asiatic rice leafroller, Cnaphalocrocis medinalis
Zhang et al.,
1. State Key Laboratory of Biocontrol, Sun Yat-sen University, Guangzhou, 510275, China
2. State Key Laboratory of Virology and China Center for Virus Culture Collection, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, 430071, China
... nih.gov/genbank). Hypothetical ORFs were predicted by soft berry FGENESV program
(http://www.softberry.com/berry. phtml) (Solovyev and Salamov, 1999) and defined by the standard
ATG start, and a stop codon and potentially en- code at least 50 amino acids. ...
Genome announcements
2015, 3(6), e01192-15. doi: 10.1128/genomeA.01192-15
First complete genome sequence of Felis catus gammaherpesvirus 1
Troyer, R. M. et al.,
aDepartment of Biomedical Sciences, Oregon State University, Corvallis, Oregon, USA
bDepartment of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, USA
... We verified the final sequence by reassembly of the MiSeq reads to the consensus genome using
Bowtie2 (8). We defined open reading frames (ORFs) by prediction with GeneMarkS (9) and
FGENESV (SoftBerry) and comparison to herpesvirus and cellular genes using NCBI ...
PloS one
2014, 9(1), e86450. DOI:10.1371/journal.pone.0086450
Genome Sequence and Analysis of Buzura suppressaria Nucleopolyhedrovirus: A Group II Alphabaculovirus
Zhu Z. et al.,
State State Key Laboratory of Virology and China Center for Virus Culture Collection, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Canadian Forest Service, Great Lakes Forestry Centre, Sault Ste Marie, Ontario, Canada
... KF611977). Hypothetical ORFs were predicted by softberry FGENESV program
(http://www.softberry.com/berry.phtml) [58] to contain the standard ATG start, and a
stop codon and potentially encode at least 50 amino acids. Gene ...
Virus research
2014, 185, 110-113 DOI:10.1016/j.virusres.2014.02.019
The genomic RNA1 and RNA2 sequences of the tobacco rattle virus isolates found in Polish potato fields
Yin Z. et al.,
a Mlochow Research Center, Plant Breeding and Acclimatization Institute – National Research Institute, Platanowa Street 19, PL-05-831 Mlochow, Poland
b Department of Plant Genetics, Breeding & Biotechnology, Faculty of Horticulture, Biotechnology and Landscape Architecture, Warsaw University of Life Sciences – SGGW, Nowoursynowska Street 159, PL-02-776 Warsaw, Poland
... SeqMan Pro. Version 9.1.0 (109) 418. Gene structure annotation was predicted by
two software packages, GenMark (Besemer and Borodovsky, 1999, http://exon.gatech.
edu/) and fgenesV0 (http://linuxl.softberry.com). The models ...
Archives of virology
2014, 1-5. DOI:10.1007/s00705-014-2128-x
Single-nucleotide polymorphisms and reading frame shifts in RNA2 recombinant regions of tobacco rattle virus isolates Slu24 and Deb57
Yin, Z., Pawelkowicz, M., Michalak, K., Chrzanowska, M., & Zimnoch-Guzowska, E.
1. Mlochow Research Center, Plant Breeding and Acclimatization Institute - National Research Institute, Platanowa Street 19, 05-831, Mlochow, Poland
2. Department of Plant Genetics, Breeding and Biotechnology, Faculty of Horticulture, Biotechnology and Landscape Architecture, Warsaw University of Life Sciences-SGGW, Nowoursynowska Street 159, 02-776, Warsaw, Poland
... The corresponding bands were purified using a QIAquick Gel Extraction Kit (QIAGEN) and
sequenced directly. Gene structure annotation was done using two software packages, GenMark
[4, http:// exon.gatech.edu/] and fgenesV0 [http://linuxl.softberry. com]. ...
Applied and environmental microbiology
2014, 80(1), 374-384. DOI:10.1128/AEM.02279-13
Genomic Investigation of Lysogen Formation and Host Lysis Systems of the Salmonella Temperate Bacteriophage SPN9CC
Shin, H., Lee, J. H., Yoon, H., Kang, D. H., Ryu, S.
a Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, South Korea
b Department of Food Science and Biotechnology, Graduate School of Biotechnology, Kyung Hee University, Yongin, South Korea
... The prediction of open reading frames (ORFs) was conducted with Glimmer 3.02 (33), GeneMarkS
(34), and FgenesV (Softberry, Inc., Mount Kisco, NY). The prediction of ribosomal binding sites
of ORFs was performed with RBSfinder (J. Craig Venter Institute, Rockville, MD). ...
Virus Genes
November 2013 DOI:10.1007/s11262-013-1002-3
Genomic characterisation of Felis catus papillomavirus 4, a novel papillomavirus detected in the oral cavity of a domestic cat
Magdalena Dunowska, John S. Munday, Rebecca E. Laurie, Simon F. K. Hills
1. Institute of Veterinary, Animal and Biomedical Sciences, Massey University, Tennent Drive, Palmerston North, 4474, New Zealand
2. Biochemistry Department, Otago University, Dunedin, New Zealand
... Sequence analysis The putative coding regions in the PV sequence were predicted
using FGENESV0 (http://linux1.softberry.com). The characteristics of the putative
viral proteins, the pre- sence of conserved protein domains ...
Virus Genes.
2013 Aug;47(1):133-51. doi: 10.1007/s11262-013-0922-2. Epub 2013 May 28.
Complete genomic sequences and comparative analysis of Mamestra brassicae nucleopolyhedrovirus isolated in Korea
Choi et al.,
Department of Agricultural Biology, College of Agriculture, Life and Environment Sciences, Chungbuk National University, Cheongju, Republic of Korea.
... Sequence data were assembled and analysed using Lasergene7 software (DNASTAR). Putative
open reading frames (ORFs) were analysed using the FGENESV0 (http://linux1.softberry.com/
berry.phtml) and the NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). ...
Veterinary Microbiology
Volume 165, Issues 3–4, 30 August 2013, Pages 319–325 DOI:10.1016/j.vetmic.2013.04.006
Genomic characterization of Felis catus papillomavirus-3: A novel papillomavirus detected in a feline Bowenoid in situ carcinoma
John S. Munday a, Magda Dunowska a, Simon F. Hills a, Rebecca E. Laurie b
a College of Sciences, Massey University, Palmerston North, New Zealand
b Biochemistry Department, Otago University, 710 Cumberland Street, Dunedin, New Zealand
... primer sequences available on request). 138 2.3 DNA and protein sequence analysis
The putative coding regions in the PV sequence were predicted using FGENESV0
141 (http://linux1.softberry.com). The characteristics of the ...
Appl. Environ. Microbiol.
March 2013 vol. 79 no. 6 1956-1968 doi: 10.1128/?AEM.02793-12
wksl3, a New Biocontrol Agent for Salmonella enterica Serovars Enteritidis and Typhimurium in Foods: Characterization, Application, Sequence Analysis, and Oral Acute Toxicity Study
Hyun-Wol Kang a, Jae-Won Kim b, Tae-Sung Jung c and Gun-Jo Woo a
aFood Safety and Evaluation Laboratory, Department of Food Bioscience and Technology, Korea University, Anam-dong 5-ga, Seongbuk-gu, Seoul, Republic of Korea
bCJ Research Institute of Biotechnology, CJ CheilJedang, Seoul, Republic of Korea
... with SeqMan II sequence analysis software (DNASTAR). Possible open reading frames (ORFs)
were predicted with the genome annotation software GeneMarkS (28) and confirmed with FgenesV
(SoftBerry) and Glimmer 3.02 (29) by submitting the whole genome of wksl3. ...
PLoS ONE
7(5): e37557. doi:10.1371/journal.pone.0037557
Genome Characteristics of a Novel Phage from Bacillus thuringiensis Showing High Similarity with Phage from Bacillus cereus
Yihui Yuan,
Meiying Gao,
Dandan Wu,
Pengming Liu,
Yan Wu
Key Laboratory of Agricultural and Environmental Microbiology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, People's Republic of China
... Each base had at least five-fold coverage. Open reading frames (ORFs) were predicted
with FGENESV software (http://linux1.softberry.com/berry.phtml??topic=virus&group=
programs&subgroup=gfin?dv) and by visual inspection. ...
J. Virol.
August 2012 vol. 86 no. 15 8014-8030 DOI: 10.1128/JVI.00723-12
A Novel Bat Herpesvirus Encodes Homologues of Major Histocompatibility Complex Classes I and II, C-Type Lectin, and a Unique Family of Immune-Related Genes
Huajun Zhang et al.,
aCSIRO Livestock Industries, Australian Animal Health Laboratory, Geelong, Victoria, Australia
bWuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, Hubei, China
... Computer-assisted analysis.Open reading frames (ORFs) were initially predicted with the software
programs FgenesV (Softberry) and GeneMarkS (5). ORFs that contained canonical start and
stop codons were BLASTed against the local protein database of betaherpesviruses ...
PLoS One;
2011 May Journal Volume: 5; Journal Issue: 1;
Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community
Reddy et al.,
... the BLAST scores. After manual frameshift correction, genes were called using fgenesb
(http:// www.softberry.com). For phylogenetic ... to Iodobacteriophage. Genes were
predicted using fgenesV (www. softberry.com). Found at: doi ...
J. Virol.
May 2012 vol. 86 no. 9 5039-5054 DOI: 10.1128/JVI.07162-11
Biological Characterization and Next-Generation Genome Sequencing of the Unclassified Cotia Virus SPAn232 (Poxviridae)
Afonso et al.,
aLaboratorio de Biologia Molecular de Virus
bLaboratorio de Ultraestrutura Hertha Meyer, Instituto de Biofisica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Rio de Janeiro, Brazil
... with default parameters. Open reading frames (ORFs) longer than 30 amino acids
were detected by FGENESV (Softberry), Vector NTI (Invitrogen), and CLC DNA
Workbench (CLC bio, Aarhus, Denmark). Predicted ORFs containing ...
Aquat Biol
Vol. 14: 223–232, 2012
doi: 10.3354/ab00395
Genetic diversity of the Caribbean spiny lobster
virus, Panulirus argus virus 1 (PaV1), and the
discovery of PaV1 in lobster postlarvae
Jessica Moss
1,
*, Mark J. Butler IV 2, Donald C. Behringer 3, Jeffrey D. Shields 1
1
Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, Greate Road,
Gloucester Point, Virginia 23062, USA
2
Department of Biological Sciences, Old Dominion University, Norfolk, Virginia 23529, USA
... FgenesV (http:// linux1. softberry. com/), a trained pattern/Markov chain-based viral gene
prediction program, was used to translate the sequenced region and to identify ORFs or
possible viral genes. RESULTS PaV1 detection by PCR Postlarvae ...
PLoS ONE
7(8): e43106. doi:10.1371/journal.pone.0043106
Isolation and Characterization of Three Mammalian Orthoreoviruses from European Bats
Kohl et al.,
Robert Koch Institute, Centre for Biological Security 1, Berlin, Germany
... Pro package. The sequence was also analyzed by the FGENESV Trained
Pattern/Markov chain-based viral gene prediction program (http://www.softberry.com).
Phylogenetic Tree Reconstruction. Multiple alignments (ClustalW ...
Appl. Environ. Microbiol.
January 2012 vol. 78 no. 1 58-69 DOI: 10.1128/AEM.06231-11
Characterization and Comparative Genomic Analysis of a Novel Bacteriophage, SFP10, Simultaneously Inhibiting both Salmonella enterica and Escherichia coli O157:H7
Park et al.,
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
bLaboratory of Food Microbiology and Functional Genomics, Department of Food Science and Biotechnology, CHA University, Seongnam, South Korea
... Prediction of all open reading frames (ORFs) was carried out using the Glimmer by
GAMOLA automatic annotation program (1) and confirmed using GeneMark (5) and
FgenesV software (Softberry, Inc., Mount Kisco, NY). Annotation ...
BMC Microbiology
2012, 12:297
http://www.biomedcentral.com/1471-2180/12/297
Characteristics of a broad lytic spectrum
endolysin from phage BtCS33 of Bacillus thuringiensis
Yihui Yuan, Qin Peng and Meiying Gao *
Key Laboratory of Agricultural and Environmental Microbiology, Wuhan
Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, P.R.
China
...Open reading frames (ORFs) of the phage BtCS33 genome
(GenBank: JN191664) were predicted using FGENESV
software (http://linux1.softberry.com/berry.phtml?topic=-
virus&group=programs&subgroup=gfindv) and by visual
inspection. ...
Environmental Microbiology
Special Issue: Microbial Communities - Structure, Behaviour, Evolution
Volume 14, Issue 9, pages 2564–2576, September 2012 DOI: 10.1111/j.1462-2920.2012.02775.x
Comparisons of clustered regularly interspaced short palindromic repeats and viromes in human saliva reveal bacterial adaptations to salivary viruses
David T. Pride 1,*, Julia Salzman 2, David A. Relman 3,4,5
1 Departments of Pathology and Medicine, University of California, San Diego, 9500 Gilman Drive, MC 0612, La Jolla, CA 92093-0612, USA
2Departments of Biochemistry and Statistics
3 Microbiology & Immunology, Stanford University School of Medicine, Stanford, CA, USA
... spacers. Viral contigs were analysed using FGenesV (Softberry, Mount Kisco, NY)
for open reading frame prediction, and individual open reading frames analysed using
blastX analysis against the NCBI non-redundant database. ...
Research in Microbiology
Volume 163, Issue 3, April 2012, Pages 233–241 http://dx.doi.org/10.1016/j.resmic.2012.01.002,
Characterization of endolysin from a Salmonella Typhimurium-infecting bacteriophage SPN1S
Jeong-A. Lim ,
Hakdong Shin ,
Dong-Hyun Kang ,
Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Agricultural Biomaterials, and Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul 151-921, Republic of Korea
... 2. Materials and methods. 2.1. Bioinformatic analysis. Prediction of ORFs in the lysis cluster of
the SPN1S genome was done using Glimmer 3.02 (Delcher et al., 2007), GeneMark.hmm
(Lukashin and Borodovsky, 1998) and FgenesV software (http://www.softberry.com). ...
Archives of Virology
August 2012, Volume 157, Issue 8 , pp 1559-1564 DOI
10.1007/s00705-012-1316-9
Sequencing and analysis of the complete genome of Rana grylio virus (RGV)
Xiao-Ying Lei (1)
Tong Ou (1)
Ruo-Lin Zhu (1)
Qi-Ya Zhang zhangqy@ihb.ac.cn (1)
1. State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, Wuhan, 430072, China
... Madison, WI, USA). The ORFs were predicted using Gene Finding in the virus genome
program at the website http://www.softberry.com and NCBI ORF Finder (http://www.
ncbi.nlm.nih.gov/gorf/ gorf.html). Comparisons of homologous ...
J. Virol.
doi: 10.1128/?JVI.01796-12 October 2012 vol. 86 no. 19 10894
Complete Genome Sequence of Bacteriophage SSU5 Specific for Salmonella enterica serovar Typhimurium Rough Strains
Minsik Kim,
Sujin Kim and
Sangryeol Ryu
Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Research Institute for Agriculture and Life Sciences, and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
... GS De Novo assembler (v. 2.60) was used to assemble quality filtered reads, and GeneMarkS
(2), Glimmer 3.02 (4), and FgenesV (Softberry, Inc., Mount Kisco, NY) were used to predict open
reading frames (ORFs) that encode proteins of more than 40 amino acids. ...
J. Virol.
doi: 10.1128/?JVI.01579-12 September 2012 vol. 86 no. 18 10234-10235
Complete Genome Sequence of Caulobacter crescentus Bacteriophage phiCbK
Gael Panis a,
Christophe Lambert b and
Patrick H. Viollier a
aDepartment of Microbiology and Molecular Medicine, Faculty of Medicine, University of Geneva, Geneva, Switzerland
bProgenus S.A., Gembloux, Belgium
.. of ?CbK genomic DNA (extracted using the Norgen Biotek phage DNA extraction kit), we
assembled quality-filtered reads (Velvet 01.01.04 software), predicted coding sequences (pCDS),
and transfer RNAs (tRNAs) using Glimmer3.02 (4), FgenesV (Softberry, Inc., Mount Kisco ...
J. Virol.
doi: 10.1128/?JVI.01529-12 September 2012 vol. 86 no. 17 9552
Genome Sequence of a Novel Actinophage PIS136 Isolated from a Strain of Saccharomonospora sp.
Richa Bajpai et al.,
aInstitute of Microbial Technology, CSIR, Chandigarh, India
bInstitute of Genomics and Integrative Biology, CSIR, Delhi, India
... The open reading frames (ORFs) were predicted using FGENESV (SoftBerry, Inc., Mount Kisco,
NY) and GeneMark (1). After manual curation, a total of 132 ORFs (61 ORFs on the positive strand
and 71 on the negative strand) were annotated by using homology search at the ...
J. Virol.
doi: 10.1128/?JVI.00636-12 June 2012 vol. 86 no. 11 6367-6368
Complete Genome Sequence of Cronobacter sakazakii Bacteriophage CR3
Hakdong Shin a,
Ju-Hoon Lee b,
Yeran Kim a and
Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
bDepartment of Food Science and Biotechnology, Kyung Hee University, Yongin, South Korea
... Korea. The quality-filtered reads were assembled using Newbler 2.3, and the prediction
of open reading frames (ORFs) was performed using GeneMarkS (1), Glimmer3 (2),
and FgenesV (Softberry, Inc., Mount Kisco, NY). Transfer ...
Nucl. Acids Res.
(2012) 40 (W1): W186-W192. doi: 10.1093/nar/gks528
VIGOR extended to annotate genomes for additional 12 different viruses
Shiliang Wang 1,*,
Jaideep P. Sundaram 2 and
Timothy B. Stockwell 1
1J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850 and 2Genomics Department, BioReliance Corporation, 14920 Broschart Rd, Rockville, MD 20850, USA
... These complex gene features must be accurately defined in order to correctly
understand these genomes. Universal gene prediction programs, such as FgenesV
(www.softberry.com) and Zcurve_V (1), are available for public use. ...
J. Virol.
doi: 10.1128/?JVI.07226-11 March 2012 vol. 86 no. 6 3404-3405
Complete Genome Sequence of Salmonella enterica Serovar Typhimurium Bacteriophage SPN3UB
Ju-Hoon Lee b,
Hakdong Shin a and
Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology and Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, South Korea
bDepartment of Food Science and Biotechnology, CHA University, Seongnam, South Korea
... Assembly of quality filtered reads was performed using a 454 Newbler 2.3 assembler,
and open reading frames (ORFs) were predicted using GeneMarkS (5), Glimmer
3.02 (9), and FgenesV (Softberry, Inc., Mount Kisco, NY). ...
J. Virol.
doi: 10.1128/?JVI.06696-11 January 2012 vol. 86 no. 2 1284-1285
Complete Genome Sequence of Salmonella enterica Serovar Typhimurium Bacteriophage SPN1S
Hakdong Shin a,
Ju-Hoon Lee b,
Jeong-A Lim a,
Hyeryen Kim a and
Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul, Korea
bDepartment of Food Science and Biotechnology, CHA University, Seongnam, Korea
... From the complete genome sequence of phage SPN1S, open reading frames (ORFs)
were predicted using the GAMOLA automatic annotation program (1) and confirmed
using GeneMarkS (3), Glimmer 3.02 (6), and FgenesV (SoftBerry). ...
J. Virol.
January 2012 vol. 86 no. 1 637-638 doi: 10.1128/?JVI.06520-11
Complete Genome Sequence of Bacillus cereus Bacteriophage BCP78
Ju-Hoon Lee b,
Hakdong Shin a,
Bokyung Son a and
Sangryeol Ryu a
aDepartment of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921, South Korea
bDepartment of Food Science and Biotechnology, CHA University, Seongnam 463-836, South Korea
... The assembly of quality filtered reads was performed using 454 Newbler 2.3 assembler, and
the prediction of open reading frames (ORFs) and their confirmation were conducted using the
Glimmer 3.02 (3), GeneMark.hmm (10), and FgenesV softwares (Softberry, Inc., Mount ...
Extremophiles
September 2012, Volume 16, Issue 5, pp 715-726 DOI
10.1007/s00792-012-0467-7
Genome sequence of temperate bacteriophage Psymv2 from Antarctic Dry Valley soil isolate Psychrobacter sp. MV2
Tracy L. Meiring (1)
I. Marla Tuffin (1)
Craig Cary (2)
Don A. Cowan (1)
1. Institute for Microbial Biotechnology and Metagenomics, University of the Western Cape, Office 2117, Level 2 Life Sciences Building, Modderdam Rd, Bellville, 7535, South Africa
2. Department of Biological Sciences, University of Waikato, Hamilton, New Zealand
... Ab initio gene predictions were performed using GeneMark.hmm 2.0 (http://www.exon.biology.
gatech.edu/heuristic_hmm2.cgi) (Besemer and Borodovsky 1999), fgenesv and fgenesb
(http://www.linux1.softberry.com/berry.phtml) (Softberry, Mount Kisco, NY, USA) using the ...
Australasian Plant Disease Notes
April 2012 DOI
10.1007/s13314-012-0048-8
Clitoria yellow mottle virus: a tobamovirus from Northern Australia
Kejun Wei (1)
Adrian Gibbs (2)
Anne Mackenzie (3)
1. Faculty of Applied Science, University of Canberra, Canberra, ACT, 2617, Australia
2. Australian National University Emeritus Faculty, Canberra, ACT, 0200, Australia
3. CSIRO Division of Plant Industry, Canberra, ACT, 2601, Australia
... The genome of CYMV has the same structure as most other tobamoviruses (Stobbe
et al. 2011). The MolQuest- Softberry viral gene detector (http://www.softberry.com)
found four open reading frames (ORFs) in the CYMV sequence. ...
J. Virol.
March 2011 vol. 85 no. 6 2642-2656 DOI: 10.1128/JVI.01661-10
Identification and Sequencing of a Novel Rodent Gammaherpesvirus That Establishes Acute and Latent Infection in Laboratory Mice
Loh et al.,
1Department of Pathology and Immunology
2Department of Molecular Microbiology
3Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St. Louis, Missouri
... Viral genome and phylogenetic analyses.Predicted ORFs were identified using Geneious (see
above), fgenesV (SoftBerry, Mount Kisco, NY) (13, 69), and GeneMark (6) and were analyzed
using BLAST algorithms (3). ORFs that were predicted by both fgenesV and GeneMark ...
J. Virol.
October 2011 vol. 85 no. 19 10230-10238 DOI: 10.1128/JVI.00637-11
The Genome of Yoka Poxvirus
Zhao et al.,
1 Departments of Pathology and Immunology and Molecular Microbiology, Washington University School of Medicine, and the Midwest Regional Center of Excellence for Biodefense and Emerging Infectious Diseases Research, St. Louis, Missouri
2 Department of Pathology, University of Texas Medical Branch, Galveston, Texas
... described for other recently sequenced poxviruses (1, 2, 23). Briefly, ORFs were
predicted using FgenesV (SoftBerry, Inc.; www.softberry.com/) and Getorf (Emboss
package). All predicted ORFs of more than 90 nucleotides with ...
J. Virol.
December 2011 vol. 85 no. 24 13470-13471 doi: 10.1128/JVI.06344-11
Complete Genome Sequence of Salmonella Bacteriophage SPN3US
Ju-Hoon Lee 1, Hakdong Shin 2, Hyeryen Kim 2 and Sangryeol Ryu 2
1Department of Food Science and Biotechnology, CHA University, Seongnam 463-836, South Korea
2Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology and Center for Agricultural Biomaterials, Seoul National University, Seoul 151-921, South Korea
... Prediction of open reading frames (ORFs) was performed using the GAMOLA automatic
annotation program (1), and predicted ORFs were confirmed using the Glimmer 3.02 (5),
GeneMark.hmm (7), and FgenesV (Softberry, Inc., Mount Kisco, NY) software. ...
Virus Research
Volume 160, Issues 1–2, September 2011, Pages 128–135 DOI: 10.1016/j.virusres.2011.05.023
Genomic and phylogenetic analyses of murine adenovirus 2
Hemmi et al.,
a Institute of Molecular Life Sciences, University of Zurich, Switzerland
b Veterinary Medical Research Institute, Hungarian Academy of Sciences, Budapest, Hungary
... annular.org/sdbrown/dna/translator.html). The sequence was also analyzed by the
FGENESV Trained Pattern/Markov chain-based viral gene prediction program
(http://www.softberry.com). Splice sites were determined manually ...
The ISME Journal
6, 915-926 (May 2012) | doi:10.1038/ismej.2011.169
Evidence of a robust resident bacteriophage population revealed through analysis of the human salivary virome
Pride et al.,
... Viral contigs were analyzed using FGenesV (Softberry Inc., Mount Kisco, NY, USA) for open
reading frame prediction, and individual Open reading frames were analyzed using blastX analysis
against the NCBI non-redundant database (E-score <10 ?5 ). If the best hit was to a ...
Virology Journal
2011, 8:331
http://www.virologyj.com/content/8/1/331
The complete genome sequence and genetic
analysis of fFCA82 a novel uncultured
microphage from the turkey gastrointestinal
system
Zsak et al.,
1
Southeast Poultry Research Laboratory, Agricultural Research Service, United
States Department of Agriculture, 934 College Station Road, Athens, GA
30605 USA
...Putative ORFs
within the FCA82 genome were predicted using the FGENESV Trained Pattern/Markov chain-based viral gene prediction method from the Softberry website [27]....
Aquat Biol
Vol. 14: 223–232, 2012 doi: 10.3354/ab00395
Genetic diversity of the Caribbean spiny lobster virus, Panulirus argus virus 1 (PaV1), and the discovery of PaV1 in lobster postlarvae
Jessica Moss 1, *, Mark J. Butler IV 2 , Donald C. Behringer 3 , Jeffrey D. Shields 1
1
Department of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, Greate Road,
Gloucester Point, Virginia 23062, USA
2
Department of Biological Sciences, Old Dominion University, Norfolk, Virginia 23529, USA
... FgenesV (http:// linux1. softberry. com/), a trained pattern/Markov chain-based viral gene
prediction program, was used to translate the sequenced region and to identify ORFs or
possible viral genes. RESULTS PaV1 detection by PCR Postlarvae ...
PLoS ONE
(2011), 6(11): e28163. doi:10.1371/journal.pone.0028163
Genomic Sequence Analysis of Granulovirus Isolated from the Tobacco Cutworm, Spodoptera litura.
Wang et al.,
Department of Agricultural Biotechnology, College of Agriculture and Life Sciences, Seoul National University, Seoul, Korea
...Putative coding regions of the SpliGV genome were predicted using FGENESV0 (http://www.softberry.com/berry.phtml) [70] and the ...
Virology
Volume 414, Issue 1, 25 May 2011, Pages 42–50 DOI: 10.1016/j.virol.2011.03.009
Deep sequencing of Cotesia vestalis bracovirus reveals the complexity of a polydnavirus genome
Chen et al.,
a State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Molecular Biology of Crop Pathogens and Insects, Institute of Insect Sciences, Zhejiang University, Hangzhou 310029, China
b Shanghai-MOST Key Laboratory of Health and Disease Genomics, Chinese National Human Genome Center at Shanghai, Shanghai 201203, China
...Putative open reading frames (ORFs) were predicted using FGENESV (http://linux1.softberry.com/berry.phtml) and GENSCAN...
J Gen Virol
November 2011 vol. 92 no. 11 2679-2690 DOI: 10.1099/vir.0.033852-0
The enigmatic genome of Chara australis virus
Gibbs et al.,
Research School of Biological Science, Australian National University, Canberra, ACT 0200, Australia
...ORFs were predicted by using the MolQuest-Softberry viral gene detector, ...
PLoS ONE
5(1): e8812. doi:10.1371/journal.pone.0008812
Targeted Discovery of Glycoside Hydrolases from a Switchgrass-Adapted Compost Community
Allgaier et al.,
1 Deconstruction Division, Joint BioEnergy Institute, Emeryville, California, United States of America, 2 Department of Biological and Agricultural Engineering, University of California Davis, Davis, California, United States of America
.. scores. After manual frameshift correction, genes were called using fgenesb
(http://www.softberry.com). For ... Iodobacteriophage. Genes were predicted using fgenesV
(www.softberry.com). (1.12 MB EPS). Figure S2. Correspondence ...
Journal of Insect Physiology
Volume 56, Issue 6, June 2010, Pages 650-658 doi:10.1016/j.jinsphys.2010.01.013
Transient expression of specific Cotesia plutellae bracoviral segments induces prolonged larval development of the diamondback moth, Plutella xylostella
Bowon Kwon a, c, Seongbaeck Song a, Jae Young Choi b, Yeon Ho Je b and Yonggyun Kim a
a Department of Bioresource Sciences, Andong National University, Andong 760-749, Republic of Korea
b Department of Entomology, Seoul National University, Seoul 151-742, Republic of Korea
... Putative genes encoded in the CpBV genome segments were analyzed by FGENESV ORF Finder
(http://linux1.softberry.com/berry.phtml?topic=index&group=programs&subgroup=gfindv) and
NCBI-BLAST searching programs, in which genes were predicted by two criteria that ...
PLoS Pathog
2010 6(5): e1000923. doi:10.1371/journal.ppat.1000923
Analysis of Virion Structural Components Reveals Vestiges of the Ancestral Ichnovirus Genome
Volkoff et al.,
1 UMR 1231 INRA - Universite Montpellier 2, Biologie Integrative et Virologie des Insectes, Place Eugene Bataillon, Montpellier, France, 2 Institut de Genomique Fonctionnelle, Plate-forme Proteomique, CNRS UMR 5203, INSERM U661, Universite Montpellier 1, Universite Montpellier 2, Montpellier, France
... Five related sequences, showing more than 65% nucleotide identity, are highlighted. Arrows
represent the predicted coding sequences in IVSPER-2 (names as per Figure 1) and CsIV
SH-C (as determined using FGENESV0 at http://linux1.softberry.com/berry.phtml). ...
Archives of Virology
Volume 154, Number 8 / August 2009, pp. 1313-1327
Sequence and gene organization of 24 circles from the Cotesia plutellae bracovirus genome
Jae Young Choi et al.,
(1) Research Institute for Agriculture and Life Sciences, Seoul National University, Seoul, 151-742, Korea
... specific primers. For each genomic segment, putative coding genes were predicted
using FGENESV0 (http://www.softberry.com/berry.phtml) [48] and GENSCAN
(http://genes.mit.edu/GENSCAN.html). Sequence comparisons ...
Virus Research
Volume 132, Issues 1-2, March 2008, Pages 132-139 doi:10.1016/j.virusres.2007.11.009
Completion of the genome analysis of snake adenovirus type 1, a representative of the reptilian lineage within the novel genus Atadenovirus
SL Farkas, B Harrach, M Benko
Veterinary Medical Research Institute, Hungarian Academy of Sciences, H-1581, Budapest, P.O. Box 18, Hungary
... The complete genome sequence was also submitted to the FGENESV program at
www.softberry.com (Softberry Inc.) for putative gene prediction. ...
Entomological Research
Volume 38 Issue 1 Page 77-86, March 2008
Differential expression profile of genes encoded in a genome segment of Cotesia plutellae bracovirus in a parasitized host, Plutella xylostella
Wael GAD, Jae Young, Yeon Ho JE, Yonggyun KIM
1 Department of Bioresource Sciences, Andong National University, Andong, Korea
2 School of Agricultural Biotechnology, Seoul National University, Seoul, Korea
... Putative open reading frames (ORF) were predicted using fgenesv0 (Solovyev & Salamov
1999; http://www.softberry.com/berry.phtml) and genescan (http://genes.mit ...
Archives of Virology
Volume 152, Number 11 / October 2007 p. 2027-2033
Identification, detection and transmission of a new vitivirus from Mentha
I. E. Tzanetakis, J. D. Postman and R. R. Martin
Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR, U.S.A.
... Genome analysis The open reading frames (ORF) encoded by MV-2 were identified with
the FGENESV0 and ORF finder programs (http:==www.softberry.com and http:==www ...
Journal of Virology
July 2007, p. 6920-6926, Vol. 81, No. 13
Detection of a Novel and Highly Divergent Coronavirus from Asian Leopard Cats and Chinese Ferret Badgers in Southern China
B. Q. Dong et al.,
Guangxi Center for Disease Control and Prevention
... Open reading frames (ORFs) of the partial genome of the novel CoV were identified
with the program fgenesV (Softberry Inc., Mount Kisco, NY) and mapped with ...
J Gen Virol
87 (2006), 1531-1541;
Comparative genomic analysis of two strains of human adenovirus
type 3 isolated from children with acute respiratory infection in southern China
Qiwei Zhang et al.,
State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, China
... or 'hypothetical proteins' were also identified by using FGENESV, software for
predicting potential genes in viral genomes (http://www.softberry.com/berry ...
Journal of Virology
March 2006, p. 2127-2140, Vol. 80, No. 5
Vaccinia Virus Proteome: Identification of Proteins in Vaccinia Virus Intracellular Mature Virion Particles
Che-Sheng Chung,1, Chein-Hung Chen,2, Ming-Yi Ho,2 Cheng-Yen Huang,1 Chung-Lin Liao,2* and Wen Chang1*
Institute of Molecular Biology,1 The Genomics Research Center, Academia Sinica, Taipei, Taiwan, Republic of China2
... predicted from WR viral genome sequences using two programs, GeneMarkS
(http://opal.biology.gatech.edu/GeneMark/) and fgenesV (http://softberry.com; 17). ...
Biochem Biophys Res Commun.
2005 Jul 1;332(2):487-93.
Genomic segments cloning and analysis of Cotesia plutellae polydnavirus using plasmid capture system
Choi et al.,
School of Agricultural Biotechnology, Seoul National University, Seoul 151-742, Republic of Korea.
... Putative coding regions were predicted using FGENESV0 ([21]; http://www.softberry.
com/berry.phtml) and GENSCAN (http://genes.mit.edu/GENSCAN.html). ...
Journal of Asia-Pacific Entomology
2005, v. 8(4) p. 359-366
Structure and Expression Profiles of Two Putative Cotesia plutellae Bracovirus Genes (CpBV-H4 and CpBV-E94?) in Parasitized Plutella xylostella
MA Ibrahim Ahmed, et al.,
Andong National University, Andong, Republic of Korea
... Puta- tive ORFs were predicted using FGENESV0 (Solovyev and Salamov, 1999:
http://www.softberry. com/berry. phtml) and GENSCAN (http://genes.mit. edu/ GENSCAN. ...
Journal of Asia-Pacific Entomology
2005, v. v. 8(3) p. 249-255
Gene Expression of Cotesia plutellae Bracovirus EP1-like Protein (CpBV-ELP1) in Parasitized Diamondback Moth, Plutellae xylostella
Lee, et al.,
Andong National University, Andong, Republic of Korea
... Puta- tive ORFs were predicted using FGENESV0 (Solovyev and Salamov, 1999:
http://www.softberry. com/berry. phtml) and GENSCAN (http://genes.mit. edu/ GENSCAN. ...
Virus Research
Volume 112, Issues 1-2, September 2005, Pages 32-37
New features in the genus Ilarvirus revealed by the nucleotide sequence of Fragaria chiloensis latent virus
Ioannis E. Tzanetakis a and Robert R. Martin a, b,
aDepartment of Botany and Plant Pathology, Center for Gene Research and Biotechnology, Oregon State University, Corvallis, OR 97331, USA
bHorticultural Crops Research Laboratory, USDA-ARS, Corvallis, OR 97330, USA
... that position of FClLV RNA 2. An ORF at an alternative reading frame was identified
(Pattern/Markov chain-based viral gene prediction at softberry.com) between ...
Archives of Virology
Volume 149, Number 10 / October, 2004 pp. 2001-2011
Strawberry necrotic shock virus is a distinct virus and not a strain of Tobacco streak virus
I. E. Tzanetakis, I. C. Mackey and R. R. Martin
Molecular and Cellular Biology Program and Department of Botany and Plant Pathology,
Oregon State University, Corvallis, OR, U.S.A.
USDA-ARS, HCRL, Corvallis, OR, U.S.A.
... similarity to any gene in the database and this was predicted not to be
a virus-encoding gene sequence (Virus gene identification, www.softberry.com ...
Journal of Virology
November 2004, p. 12576-12590, Vol. 78, No. 22
Functional Genomics Analysis of Singapore Grouper Iridovirus: Complete Sequence Determination and Proteomic Analysis
Wen Jun Song,1 Qi Wei Qin,2 Jin Qiu,1 Can Hua Huang,1 Fan Wang,1 and Choy Leong Hew1*
Department of Biological Sciences,1 Tropical Marine Science Institute, National University of Singapore, Singapore2
... A total of 162 ORFs, predicted by the FGENESV program (available through:
http://www.softberry.com), supplemented with Vector NTI suite 7.1, are indicated ...
Virus Genes
28 (3): 239-246, April 2004
Article ID: 5269250
Complete Nucleotide Sequence of a Strawberry Isolate of Beet Pseudoyellows Virus
Ioannis E. Tzanetakis
Molecular and Cellular Biology Program, Department of Botany and Plant Pathology,
Oregon State University, Corvallis 97331, USA
Robert R. Martin
Horticultural Crops Research Laboratory, USDA-ARS, Corvallis OR 97330, USA;
... http://www.ncbi.nlm.nih. gov/gorf/gorf.html) and the gene finder in viruses at http://www.softberry.com. The amino acid comparisons ...
Geno., Prot. & Bioinfo.
Vol. 1 No. 3 August 2003 226-235
Genome Organization of the SARS-CoV
Jing Xu1* et al
1 Beijing Genomics Institute, Chinese Academy of Sciences, Beijing 101300, China
...FGENESV, a program for gene prediction provided by Softberry Inc. (Mount Kisco, USA) through a web-based interface, has been specially modi?ed and trained with parameters for virus (http://www.softberry.com/berry.phtml?topic= gfindv).
...
The hypothetical minus sense ORF iden-ti?ed by FGENESV (from 48 to 203 nt on the minus strand or 29,523 to 29,678 nt on the plus strand) may be fake, but we should not absolutely deny the prob-ability of the existence of minus ORFs.
...Furthermore, we employed FGENESV to explore the sequences of MHV (NC 001846 in NCBI) and AIBV (NC 001451 in NCBI), and compared the re-sults with their previous annotations, respectively.
Rapport de stage de DEA Juin 2003
Analyse du genome du virus de l'archee Pyrococcus abyssi (PAV1)
ROUAULT Karen
Laboratoire de Microbiologie et Biotechnologie des Extremophiles IFREMER- Centre de Brest et Equipe Microbiologie LEMAR - Institut Universitaire Europeen de la Mer
... [14]. FGENESV http://www.softberry.com/berry. phtml?topic=gfindv Virus ( >10
kb) Modeles de Markov Forme du genome Code genetique [40]. ...
PROT_MAP
PLoS ONE
(2013), 8(1): e53525. doi:10.1371/journal.pone.0053525
A Genome-Wide Association Study Identifies Genomic Regions for Virulence in the Non-Model Organism Heterobasidion annosum s.s.
Dalman et al.,
Uppsala BioCenter, Department of Forest Mycology and Plant Pathology, Swedish University of Agricultural Sciences, Uppsala, Sweden
...he gene annotations found in TC32-1 were transferred to the reference sequence using PROT_MAP, FGENESH-2 (SoftBerry, Mount Kisco, NY) and Artemis ...
PLoS ONE
(2011) 6(8): e22046. doi:10.1371/journal.pone.0022046
Spliceosomal Intron Insertions in Genome Compacted Ray-Finned Fishes as Evident from Phylogeny of MC Receptors, Also Supported by a Few Other GPCRs.
Zhang et al.,
Department of Biology, University of Padua, Padova, Italy, Abteilung fur Botanische Genetik und Molekularbiologie, Botanisches Institut und Botanischer Garten, Christian-Albrechts-Universitat zu Kiel, Kiel, Germany
...To ensure correct gene structures of all putative GPCR genes, we predicted gene structures using
GENSCAN [97], [98] and predictions were repeated using GENOMESCAN [97], [98], GENEWISE [99] and
FGENESH/FGENESH+ [31]. Intron-exon structures were determined with the aid of GENEWISE [99]
and/or PROT_MAP module of the Softberry software suite (website: www.softberry.org). ...
J Gen Virol
July 2011 vol. 92 no. 7 1500-1507 doi: 10.1099/vir.0.027706-0
Genotypic characterization of two bacterial artificial chromosome clones derived from a single DNA source of the very virulent gallid herpesvirus-2 strain C12/130
Stephen J. Spatz 1, Lorraine P. Smith 2, Susan J. Baigent 2, Lawrence Petherbridge 2 and Venugopal Nair 2
1Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA 30605, USA
2Institute for Animal Health, Compton, Berkshire RG20 7NN, UK
... 1988; Peng et al. 1995; Peng & Shirazi 1996a, b) were compared to pC12/130-10 and
pC12/130-15 genomes using PROT_Map (SoftBerry, Mount Kisco, NY). Transcription
factor-binding sites were investigated by using the TFsearch program (Maray et al. 1988; Peng ...
Virus Genes
2008 37:69–80 DOI 10.1007/s11262-008-0242-0
Clustering of mutations within the inverted repeat regions
of a serially passaged attenuated gallid herpesvirus
type 2 strain
Stephen J. Spatz, Cary Rue, Daniel Schumacher,
Nikolaus Osterrieder
Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, 934 College Station Rd., Athens, GA 30605, USA
Department of Microbiology and Immunology,
Cornell University, Ithaca, NY 14853, USA
Institut fu.r Virologie, Philippstra.e 13, 10115 Berlin, Germany
... Published mRNA [20] and cDNA [28–30] data were compared
to the 584Ap80 genome using PROT_MAP
(SoftBerry, Mount Kisco, NY). ...
Virus Genes
Volume 35, Number 3 / December 2007 p. 753-766
Comparative sequence analysis of a highly oncogenic but horizontal spread-defective clone of Marek’s disease virus
Stephen J. Spatz et al.,
Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, 934 College Station Rd., Athens, GA 30605, USA
... PairwiseFLAG. Published mRNA and cDNA data were compared to the pRB-1B-5
genome using PROT_MAP (SoftBerry, Mount Kisco, NY). Multiple ...
Virus Genes
Volume 35, Number 1 / August 2007 p. 41-53
Polymorphisms in the repeat long regions of oncogenic and attenuated pathotypes of Marek’s disease virus 1
Stephen J. Spatz and Robert F. Silva
US Department of Agriculture, Southeast Poultry Research Laboratory, Agricultural Research Service, 934 College Station Rd, Athens, GA 30605, USA
, US Department of Agriculture, Avian Disease and Oncology Laboratory, Agricultural Research Service, 3606 East Mount Hope Rd, East Lansing, MI 48823, USA
... Pub- lished mRNA and cDNA data were compared to the genomes of attenuated and
nonattenuated strains of MDV using PROT_MAP (SoftBerry, Mount Kisco, NY). ...
Genetics
Vol. 176, 599-609, May 2007
The FLOWERING LOCUS T-Like Gene Family in Barley (Hordeum vulgare)
Sebastien Faure, Janet Higgins, Adrian Turner and David A. Laurie
John Innes Centre, Norwich Research Park, Colney, Norwich NR4 7UH, United Kingdom
... New gene predictions were made using FGENESH+ and PROT_MAP (http://sun1.softberry.
com) for FT-like genes showing incorrect alignment within the PEBP domain and ...
J Gen Virol
88 (2007), 1080-1096
Comparative full-length sequence analysis of oncogenic and vaccine (Rispens) strains of Marek's disease virus
Stephen J. Spatz1, Lawrence Petherbridge2, Yuguang Zhao2 and Venugopal Nair2
1 Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA 30605, USA
2 Institute for Animal Health, Compton, Berkshire RG20 7NN, UK
... BMEC/ITRI). Published mRNA and cDNA data were compared with the CVI988
genome by using PROT_MAP (SoftBerry). Multiple protein ...
MaliN
Journal of Experimental Botany
2007 58(3):439-451;
Factors involved in root formation in Medicago truncatula
Nijat Imin*, Mahira Nizamidin, Tina Wu and Barry G. Rolfe
Australian Research Council Centre of Excellence for Integrative Legume Research, Genomic Interactions Group, Research School of Biological Sciences, Australian National University, Canberra City, ACT 2601, Australia
... Then the PLETHORA genes were aligned using the program MaliN (Softberry Inc., NY,
USA) and the forward degenerative primer, PLTconsF (CAACAYGGRAGRTGGCAAGCAAG ...
MaliP
MPMI
Vol. 24, No. 9, 2011, pp. 1051–1060. doi:10.1094/ MPMI -12-10-0281
A Dual-Targeted Soybean Protein Is Involved in Bradyrhizobium japonicum Infection of Soybean Root Hair and Cortical Cells
Libault et al.,
1
Division of Plant Sciences, National Center for Soybean Biotechnology, C.S. Bond Life Sciences Center, University of Missouri, Columbia 65211 U.S.A.; 2 Donald Danforth Plant Science Center, 975 North Warson Road, St. Louis 63132 U.S.A.;
...Given the lack of functional annotation for GmNMNa, we used MaliP software to identify conserved domains. T...
EST_map
PLoS genetics
(2013). 9(1), e1003233. DOI:10.1371/journal.pgen.1003233
Comparative Genome Structure, Secondary Metabolite, and Effector Coding Capacity across Cochliobolus Pathogens
Condon et al.,
Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca, New York, United States of America
Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon, United States of America
... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com) using raw ESTs and assembled EST contigs for each genome; homology-based predictions
with Fgenesh+ [103] and Genewise ....
International Journal of Food Microbiology
Volume 157, Issue 2, 2 July 2012, Pages 202–209 DOI: 10.1016/j.ijfoodmicro.2012.05.008,
The genome of wine yeast Dekkera bruxellensis provides a tool to explore its food-related properties
Jure Piskur et al.,
a Wine Research Centre, University of Nova Gorica, Slovenia
b Department of Biology, Lund University, Sweden
... 2) homology-based — FGENESH+; Genewise (Birney and Durbin, 2000) seeded by BLASTx
alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm.
nih.gov/BLAST/), and 3) EST-based — EST_map (http://www.softberry.com/) seeded by ...
Fungal Genetics and Biology
Volume 49, Issue 3, March 2012, Pages 217–226 DOI: 10.1016/j.fgb.2012.01.007
The genome of the xerotolerant mold Wallemia sebi reveals adaptations to osmotic stress and suggests cryptic sexual reproduction
Mahajabeen Padamsee et al.,
a Department of Plant Pathology and Crop Physiology, Louisiana State University Agricultural Center, Baton Rouge, LA 70803, United States
b Department of Plant Biology, University of Minnesota, Saint Paul, MN 55108, United States
... 2) homology-based – FGENESH +; Genewise (Birney and Durbin, 2000) seeded by BLASTx
alignments against GenBank's database of non-redundant proteins (NR: http://www.ncbi.nlm.
nih.gov/BLAST/), and (3) EST-based – EST_map (http://www.softberry.com/) seeded by ...
New Phytologist
Volume 194, Issue 4, pages 1001–1013, June 2012 DOI: 10.1111/j.1469-8137.2012.04128.x
Insight into trade-off between wood decay and parasitism from the genome of a fungal forest pathogen
Olson et al.,
1 Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, Box 7026, Ullsvag 26, 750 05 Uppsala, Sweden
2 US DOE Joint Genome Institute, Walnut Creek, CA 94598, USA
... based – FGENESH+, Genewise (Birney & Durbin, 2000) seeded by BLASTx (Altschul et al., 1990)
alignments against GenBank's database of nonredundant proteins (NR: http://www.ncbi.nlm.nih.
gov/BLAST/); and EST-based – EST_map (http://www.softberry.com/) seeded by ...
PLoS Pathog
8(12): e1003037. doi:10.1371/journal.ppat.1003037
Diverse Lifestyles and Strategies of Plant Pathogenesis Encoded in the Genomes of Eighteen Dothideomycetes Fungi
Ohm et al.,
United States Department of Energy (DOE) Joint Genome Institute (JGI), Walnut Creek, California, United States of America
... The gene-prediction methods were: EST-based predictions with EST map (http://softberry.com)
using raw ESTs and assembled EST contigs for each genome; homology-based predictions with Fgenesh+ [87] and Genewise...
Nature Biotechnology
29, 922–927 (2011) doi:10.1038/nbt.1976
Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris.
Berka et al.,
Novozymes, Inc., Davis, California, USA.
US Department of Energy Joint Genome Institute, Walnut Creek, California, USA.
Centre for Structural and Functional Genomics, Concordia University, Montreal, Quebec, Canada.
... was performed using ab initio Fgenesh 32 and Genemark-ES 33 ; homology-based Fgenesh+ 32 and
Genewise 34 seeded by BLASTx alignments of NCBI's nr (nonredundant) protein database against the assembly;
cDNA-based EST_map (http://www.softberry.com/) seeded ...
SCAN2
Annals of Translational Medicine
Vol 1, No 3 (October 2013) DOI:10.3978/j.issn.2305-5839.2012.12.01
The physiological roles of secretin and its receptor
Afroze et al.,
1Department of Medicine, Division Gastroenterology, 2Research, Central Texas Veterans Health Care System, 3Scott & White Digestive Disease Research Center, Scott & White, and Texas A&M Health Science Center, College of Medicine, Temple, TX 76504, USA;
... gene. Homology was analyzed using SCAN2 software from Softberry, http://linux1.
softberry.com/berry.phtml?topic=scan2&group=programs&subgroup=scanh
subsequently, % homology was calculated independently. Secretin ...
Folia Biologica
Volume 61, Numbers 3-4, August 2013 , pp. 149-153(5) DOI:10.3409/fb61_3-4.149
The Use of Primed in situ Synthesis (PRINS) to Analyze Nucleolar Organizer Regions (NORs) and Telomeric DNA Sequences in the Domestic Chicken Genome
Bugno-Poniewierska et al.,
... Comparative alignment analysis performed by SCAN2 software by Softberry (http://linux1.soft-
berry.com/berry.phtml) for aligning two multi- megabyte-size nucleotide sequences revealed
that our set of primers is partially complementary to 18S and 28S rDNA sequences (SHAO ...
Virus Genes
April 2012, Volume 44, Issue 2, pp 273-285 DOI: 10.1007/s11262-011-0696-3
Comparative full genome analysis of four infectious laryngotracheitis virus (Gallid herpesvirus-1) virulent isolates from the United States
S. J. Spatz et al.,
1. United States Department of Agriculture, Southeast Poultry Research Laboratory, Agricultural Research Service, Athens, GA, 30605, USA
2. BASE2BIO, Madison, WI, 53714, USA
... Homology searches were con- ducted using the NCBI program blastP with default settings.
Multiple alignments of proteins and nucleotide sequences were generated using MAFFT
[28], Multalin [3] and SCAN2 (Softberry.com). Results and discussion ...
Virus Genes
Volume 42, Issue 3 , pp 331-338 DOI: 10.1007/s11262-011-0573-0
Comparative genomic sequence analysis of the Marek’s disease vaccine strain SB-1
Stephen J. Spatz, Karel A. Schat
1. Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA, 30605, USA
2. Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY, 14853, USA
... Homology searches were con- ducted using the NCBI program blastP with default set- tings.
Multiple alignments of proteins and nucleotide sequences were generated using MAFFT [12]
and SCAN2 (Softberry.com). Results and discussion Phylogenetic relatedness ...
African Journal of Biotechnology
Vol. 2 (12), pp. 714-718, December 2003
Available online at http://www.academicjournals.org/AJB
Minireview
Web-based bioinformatic resources for protein and nucleic acids sequence alignment
Kamel A. Abd-Elsalam
Molecular Markers Lab., Plant Pathology Research Institute, Agricultural Research Center, Orman 12619, Giza, Egypt.
... 16-SCAN2:: program for aligning two multimegabyte-size sequences.
http://www.softberry.com/berry.phtml?topic=scanh&prg= SCAN2. derived ...
Nucleic Acids Research, 2003, Vol. 31, No. 13 3540-3545
PromH: promoters identification using orthologous genomic sequences
V. V. Solovyev* and I. A. Shahmuradov
Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA 1 Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
*To whom correspondence should be addressed. Tel: +1 914 242 3592; Fax: +1 914 242 3593; Email: victor@softberry.com
Present address: I. A. Shahmuradov, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
... The full-length sequences of gene pairs have been aligned by the SCAN2 program
(http://softberry.com/berry.phtml?topic=scanh&prg=SCAN2), which can align ...
Genome Comparison Browser
The Plant Journal
,
2008 Volume 53 Issue 1, Pages 124 - 132
Low X/Y divergence in four pairs of papaya sex-linked genes
Qingyi Yu et al.,
Hawaii Agriculture Research Center, Aiea, HI 96701, USA
... The predicted transcripts were tested by RT-PCR, and the BAC sequences were aligned
using a genome comparison browser (http://sun1.softberry.com). ...
Molecular Genetics and Genomics
,
Volume 278, Number 2 / August 2007 p. 177-185
Chromosomal location and gene paucity of the male specific region on papaya Y chromosome
Qingyi Yu et al.,
Hawaii Agriculture Research Center, Aiea, HI 96701, USA
... The predicted transcripts were tested by RT-PCR. Genome comparison browser
(http://www.sun1.softberry.com) was used for comparative sequence analysis. RT-PCR ...
PROTCOMP
Int. J. Mol. Sci.
2016, 17(8), 1211; doi:10.3390/ijms17081211
Glutathione Transferases Superfamily: Cold-Inducible Expression of Distinct GST Genes in Brassica oleracea
Vijayakumar, H. et al.,
1 Department of Horticulture, Sunchon National University, 255, Jungang-ro, Suncheon 57922, Korea
2 Plant Systems Engineering Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahangno, Daejeon 34141, Korea
... Subcellular localization prediction of predicted BoGST proteins was performed using Protcomp 9.0 from Softberry [96]. ...
Journal of Plant Biochemistry and Biotechnology
2016, 25(2), 155-167. DOI: 10.1007/s13562-015-0321-y
Molecular cloning, characterization and three-dimensional structure prediction of Lipoxygenase from Finger millet [Eleusine coracana (L.) Gaertn.] germinating seedlings
Kotapati, K. V. et al.,
Centre for Bioinformatics, School of Life SciencesPondicherry University; Department of BiochemistryYogi Vemana University
... The sub cellular localization of EcLOX was predicted
by utilizing different publicly available programs, Plant-mPLoc, EpiLoc, YLoc, ProtComp
(http://linux1.softberry.com), TargetP (http://www.cbs.dtu.dk/services/TargetP/), ChloroP ...
Fungal Genetics and Biology
2016, 90, 12-22 http://dx.doi.org/10.1016/j.fgb.2016.03.002
Chasing stress signals–Exposure to extracellular stimuli differentially affects the redox state of cell compartments in the wild type and signaling mutants of Botrytis cinerea
Marschall, R., Schumacher, J., Siegmund, U., Tudzynski, P.
Institut fur Biologie und Biotechnologie der Pflanzen, Westfalische Wilhelms-Universitat, Schlossplatz 8, D-48143 Munster, Germany
... Subcellular localization patterns of proteins were predicted by ProtComp v.9.0
(http://linux1.softberry.com/berry.phtml?topic=protcompan&group=help&subgroup=proloc ...
Journal of Experimental Botany
2016, erw297. doi: 10.1093/jxb/erw297
Rice putative methyltransferase gene OsTSD2 is required for root development involving pectin modification
Qu, L. et al.,
1 National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
2 College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
... OsTSD2 is predicted to be localized in the Golgi body (http://www.softberry.com/berry.phtml?topic=
protcompan&group=programs&subgroup=proloc; Integral Prediction of protein location:
Membrane-bound Golgi with score 7.4), which is consistent with its putative role at the site ...
Fish & shellfish immunology
2016, 50, 297-309. http://dx.doi.org/10.1016/j.fsi.2016.02.009
Abundant members of Scavenger receptors family and their identification, characterization and expression against Vibrio alginolyticus infection in juvenile Larimichthys crocea
He, J., Liu, H., Yang, J., Dong, X., & Wu, C
National Engineering Research Center of Marine Facilities Aquaculture, Zhejiang Ocean University, Zhoushan 316022, PR China
... The sub-cellular localization was predicated by tool ProtComp 9.0 (http://www.softberry.com/). ...
PLoS Genet
2016, 12(7), e1006152. http://dx.doi.org/10.1371/journal.pgen.1006152
A High Temperature-Dependent Mitochondrial Lipase EXTRA GLUME1 Promotes Floral Phenotypic Robustness against Temperature Fluctuation in Rice (i>Oryza sativa L.)
Zhang, B. et al.,
State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences and National Center for Plant Gene Research, Beijing, the People’s Republic of China, University of Chinese Academy of Sciences, Beijing, the People’s Republic of China
... Among them, TargetP [88] (http://www.cbs.dtu.dk/services/TargetP/) has the best consistency compared with MitoProt II-v1.101 [80] (https://ihg.gsf.de/ihg/mitoprot.html), iPSORT [89] (http://ipsort.hgc.jp/),
ProtComp 9.0 (http://linux1.softberry.com/berry.phtmtopic=protcompan&group=help&subgroup=proloc) and WoLF PSORT ...
Journal
2016 http://dx.doi.org/10.1371/journal.pone.0157783
De Novo Transcriptome Analysis of the Common New Zealand Stick Insect Clitarchus hookeri (Phasmatodea) Reveals Genes Involved in Olfaction, Digestion and Sexual Reproduction
Wu C. et al.,
Landcare Research, Auckland, New Zealand, School of Biological Sciences, The University of Auckland, Auckland, New Zealand; New Zealand Institute for Plant & Food Research Ltd, Auckland, New Zealand
... Signal peptides and sub-cellular locations were identified using SignalP (v4.1) [54] and
ProtComp (v9.0) (http://linux1.softberry.com), respectively. ...
Genome biology and evolution
2016, 8(3), 681-704. doi: 10.1093/gbe/evw026
A tale of genome compartmentalization: the evolution of virulence clusters in smut fungi
Dutheil, J. Y. et al.,
1Department of Organismic Interactions, Max Planck Institute for Terrestrial Microbiology, Marburg, Germany
2German Research Center for Environmental Health (GmbH), Institute of Bioinformatics and Systems Biology, Helmholtz Zentrum Munchen, Neuherberg, Germany
... 2004). Annotation of CSEPs. SignalP version
4.1 was used for signal peptide prediction and ProtComp 9.0 (online version) for localization
prediction (http://linux1.softberry.com/berry.phtml). We used two prediction schemes. ...
Journal of Agricultural Science and Technology
2016, 18(4), 1129-1141.
Characterization of a Desiccation Stress Induced Lipase Gene from Brassica napusL
Zhang, H. et al.,
1Institute of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu, People’s Republic of China.
2Institute of Edible Fungi, Shanghai Academy of Agricultural Sciences, National Engineering Research Center of Edible Fungi; Key Laboratory of Edible Fungi Resources and Utilization (South),Ministry of Agriculture, Shanghai 201403, People’s Republic of China.
... Molecular weight and pI of the deduced protein were detected with DNAStar. Subcellular
localization prediction was performed with SoftBerry (http://linux1.softberry.com/berry.phtml)
and ChloroP Server (http://www.cbs.dtu.dk/services/ChloroP- 1.1/). ...
Planta
August 2016, Volume 244, Issue 2, pp 505–515 DOI: 10.1007/s00425-016-2520-8
Xyloglucan endo-transglycosylase/hydrolase (XET/H) gene is expressed during the seed germination in Podophyllum hexandrum: a high altitude Himalayan plant
Dogra, V., Sharma, R., Yelam, S.
Biotechnology DivisionCSIR-Institute of Himalayan Bioresource Technology
Laboratory of Photosynthesis and Stress SignalingShanghai Center for Plant Stress Biology, CAS
...Subcellular localization was predicted using ProCompv9.0
(http://?linux1.?softberry.?com/?berry.?phtml). Secondary structure ...
Algal Research
2016, 17, 236-243. doi:10.1016/j.algal.2016.05.015
Transcriptome analysis of Chlorella zofingiensis to identify genes and their expressions involved in astaxanthin and triacylglycerol biosynthesis
Huang, W., Ye, J., Zhang, J., Lin, Y., He, M., Huang, J.
a Kunming Institute of Botany, Chinese Academic of Sciences, Kunming, Yunnan Province, PR China
b University of Chinese Academic of Sciences, Beijing, PR China
... Protein location prediction by ProtComp (http://linux1.softberry.
com) suggested that one of these isoforms, namely T1_Unigene_BMK.22394, may ...
BMC biotechnology
2016, 16(Suppl 1):35 DOI: 10.1186/s12896-016-0261-1
Over-expression of a NAC 67 transcription factor from finger millet (Eleusine coracana L.) confers tolerance against salinity and drought stress in rice
Rahman, H., Ramanathan, V., Nallathambi, J., Duraialagaraja, S., Muthurajan, R.
Department of Plant Biotechnology, Centre for Plant Molecular Biology and Biotechnology, Tamil Nadu Agricultural University
... structure (PSIPHRED; http://bioinf.cs.ucl.ac.uk/psipred/);
pI/Mw (Compute pI/Mw; http://web.expasy.org/compute_pi/); functional region (PROSITE;
http://www.expasy.org/) and subcellular localization (ProtCompv9.0; http://www.softberry.com/ ...
Front Plant Sci.
2016; 7: 215. doi: 10.3389/fpls.2016.00215
Identification and Characterization of the Glucose-6-Phosphate Dehydrogenase Gene Family in the Para Rubber Tree, Hevea brasiliensis
Xiangyu Long, Bin He, Yongjun Fang, and Chaorong Tang
Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences Danzhou, China.
... Online software, ProtComp 9.02, was used to evaluate the presence of a transit peptide, which suggested the localization of HbG6PDH3 in the cytosol, and HbG6PDH1, 2 and 4 in the chloroplast (Table ?Table22)....
Applied microbiology and biotechnology
2016, Volume 100, Issue 16 , pp 7125-7136 DOI: 10.1007/s00253-016-7579-4
SILAC and LC-MS/MS identification of Streptococcus equi ssp. zooepidemicus proteins that contribute to mouse brain microvascular endothelial cell infection
Zhe, M. et al.,
1. College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, 210095, China
2. Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009, China
... Softberry ProtComp Neural Nets identification showed that 22 of these 25 proteins were
cytoplasmic and the other three were membrane proteins (Table 1). Structural analysis of
these three membrane proteins is shown in Fig. ... 2013b; Sun et al. 2016). ...
Gene
2016, 588(2), 173-179. doi:10.1016/j.gene.2016.05.024
Identification and expression of a novel carbonic anhydrase isozyme in the pufferfish Takifugu vermicularis
Sumi, K. R., Nou, I. S., Kho, K. H.
a Department of Fisheries Science, College of Fisheries and Ocean Sciences, Chonnam National University, 50, Daehak-ro, Yeosu, Jeonnam 59626, Republic of Korea
b Department of Horticulture, College of Life Science and Natural Resources, Sunchon National University, 255, Jungang-ro, Suncheon-Si, Jeollanam-do, 67922, Republic of Korea
.. were analyzed using ProtParam (http://expasy.org/tools/protparam.html) and the protein
location within the cell determined by using Protcomp (http://linux1.softberry.com/berry ...
Front Plant Sci.
2016; 7: 1011. doi: 10.3389/fpls.2016.01011
Group 3 LEA Protein, ZmLEA3, Is Involved in Protection from Low Temperature Stress
Liu, Y., Liang, J., Sun, L., Yang, X., Li, D.
1State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an, China
2Faculty of Chemistry and Chemical Engineering, Taishan Medical University, Tai’an, China
... 3 http://linux1.softberry.com/
berry.phtml?topic=protcomppl\&group=Programs\&subgroup=proloc. ...
Frontiers in Plant Science
2016, 7: 936. doi: 10.3389/fpls.2016.00936
A Genome-Wide Analysis Reveals Stress and Hormone Responsive Patterns of TIFY Family Genes in Brassica rapa
Saha, G., Park, J. I., Kayum, M. A., Nou, I. S.
Department of Horticulture, Sunchon National University, Suncheon, South Korea
.. The subcellular location of TIFY proteins
in B. rapa was determined using ProtComp 9.0 from Softberry (http://linux1.softberry.com/
berry.phtml) and Blast2GO software (http://www.blast2go.de). ...
Plant biotechnology journal
2016, 14(2), 699-708. DOI: 10.1111/pbi.12418
Interspecies gene transfer provides soybean resistance to a fungal pathogen
Langenbach, C. et al.,
Department of Plant Physiology, RWTH Aachen University, Aachen, Germany, BASF Plant Science Company GmbH, Agricultural Center, Limburgerhof, Germany
... Analysis with the subcellular
localization tool for plant proteins 'softberry Protcomp 9.0' (http://linux1.softberry.com), correctly
predicting 86% of extracellular proteins (Klee and Ellis, 2005), even assigned eight ...
Plant Molecular Biology Reporter
2016, 34(2), 512-523. DOI: 10.1007/s11105-015-0943-1
A Comprehensive Analysis of Carotenoid Cleavage Dioxygenases Genes in Solanum Lycopersicum
Wei, Y. et al.,
1. State key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
2. Institute of Economic Crop, Hebei Academy of Agriculture and Forestry Sciences, Shijiazhuang, 050051, China
... An N-terminal sorting signal of the SlCCD genes was inves- tigated using online tool iPSORT
(http://ipsort.hgc.jp/). The subcellular localization of the SlCCD family was performed by Wolf
PSORT (http://wolfpsort.org/) and ProtComp (http:// linux1.softberry.com/all.htm). ...
Journal of cancer research and therapeutics
2016, 12(1), 58-61. DOI: 10.4103/0973-1482.146083
Bioinformatic analysis of c-Myc target from laryngeal cancer cell gene of laryngeal cancer
Zhang, W. D. et al.,
1 Department of Otorhinolaryngology, People's Hospital of Zhengzhou, Henan, Henan Province, China
2 Department of Otorhinolaryngology, The First Affiliated Hospital, Sun Yat Sen University, Guangdong, China
... Table 1: Predictive analysis of secondary structure of MTLC protein Click here to view.
Sub-cellular localization of c-Myc target from laryngeal cancer cell protein Sub-cellular
localization analysis of ProtComp v. 9.0 (Softberry, Inc. ...
Folia biologica
2016, 64(1), 23-29. DOI: http://dx.doi.org/10.3409/fb64_1.23
Identification and characterization of pathogen-response genes (repat) in Spodoptera frugiperda (Lepidoptera: Noctuidae)
Machado, V., Serrano, J., Galian, J.
... www.cbs.dtu.dk/services/ SignalP/). The potential subcellular localization of proteins
was V. MACHADO et al. 24 Page 3. predicted using ProtComp Version 9.0 (http://
www.softberry.com). The frequency of each repat EST in ...
American Journal of Potato Research
2016, 1-12. DOI: 10.1007/s12230-016-9525-5
Genome-Wide Analyses of Subtilisin-Like Serine Proteases on Solanum tuberosum
Norero, N. S., Castellote, M. A., de la Canal, L., Feingold, S. E.
1. Laboratorio de Agrobiotecnologia, Instituto Nacional de Tecnologia Agropecuaria (INTA) EEA - Balcarce, Ruta 226, Km 73,5. C.C. 276, (7620), Balcarce, Argentina
2. Instituto de Investigaciones Biologicas (IIB), Universidad Nacional de Mar del Plata (UNMdP), Dean Funes 3350. C.C. 722, (7600), Mar del Plata, Argentina
... 2007). PredoTar V1.3 (https://urgi.versailles.inra.fr/Tools/ Predotar) and ProtComp V9.0
(http://www.softberry.com/berry. phtml?topic=protcompplandgroup=programsandsubgroup= proloc)
were used to predict signal sequences to organelles and other subcellular localizations. ...
Frontiers in plant science
2016, 7: 310. doi: 10.3389/fpls.2016.00310
AtHD2D Gene Plays a Role in Plant Growth, Development, and Response to Abiotic Stresses in Arabidopsis thaliana
Han, Z. et al.,
1College of Life Science, Northwest A & F University, Yangling, China
2Department of E-A Information Engineering, Liaoning Institute of Science and Technology, Benxi, China
... In addition, the tool for transmembrane regions and signal peptide sequence analysis, ProtComp
9.0 tool (http://linux1.softberry.com/berry.phtml?topic=protcomppl& group=programs&subgroup=
proloc) fuzzy k-nearest neighbors (k-NN) algorithm (version 41.0), and TMHMM ...
Biotechnology & Biotechnological Equipment
2016, 1-8. DOI: 10.1080/13102818.2016.1184588
Molecular characterization, expression pattern and function analysis of the OsHSP90 family in rice
Zhang, H. et al.,
a Key Laboratory of Southwest Crop Genetic Resources and Improvement, Ministry of Education, Rice Institute of Sichuan Agricultural University, Chengdu, China
... We further examined the subcellular localization of the nine rice OsHSP90 members with Softberry ProtComp (http://linux1.softberry.com/berry.phtmL). ...
Plant Biotechnology Journal
Volume 14, Issue 7 July 2016 Pages 1563–1577 DOI: 10.1111/pbi.12520
Genome-wide dissection of AP2/ERF and HSP90 gene families in five legumes and expression profiles in chickpea and pigeonpea
Agarwal, G. et al.,
International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India School of Plant Biology, Institute of Agriculture, The University of Western Australia, Crawley, WA, Australia
... Supplementary information. Phylogeny of HSP90 proteins. HSP90 proteins from all
five legumes were analysed in silico for their location in cellular milieu using ProtComp
v9.0 of Softberry (http://www.softberry.com/berry.phtml). In ...
Scientific reports
2016; 6: 26323. doi: 10.1038/srep26323
Evolutionary origin of the NCSI gene subfamily encoding norcoclaurine synthase is associated with the biosynthesis of benzylisoquinoline alkaloids in plants
Vimolmangkang, S. et al.,
1Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden of the Chinese Academy of Sciences, Wuhan, 430074, P. R. China
2Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Bangkok 10330, Thailand
... alignment was performed using web-based MUSCLE program (http://www.ebi.ac.uk/Tools/msa/
muscle/) and prediction of signal peptide was carried out using SignalP4.1 (http://www.cbs.dtu.
dk/services/), WoLF PSORT 24 , and Protcomp 9.0 (http://linux1.softberry.com/berry ...
Parasitology research
2016, 1-13. DOI: 10.1007/s00436-016-5114-2
Bioinformatics analysis and construction of phylogenetic tree of aquaporins from Echinococcus granulosus
Wang, F., Ye, B.
1. Department of Pathogenic Biology, Chongqing Medical University, Chongqing, 400016, People’s Republic of China
2. Research Center for Molecule Medicine and Tumor, Chongqing Medical University, Chongqing, People’s Republic of China
... The conservative structural domain was predicted by Conserved Domain (http://www.ncbi.nlm.
nih.gov/cdd/). The subcellular localization was predicted by ProtCompv. 9.0 (http://linux1.
softberry.com/berry.phtml?topic=protcompan&group= programs&subgroup=proloc/). ...
Parasitology Research
2016, 1-8. DOI: 10.1007/s00436-016-5166-3
In silico cloning and B/T cell epitope prediction of triosephosphate isomerase from Echinococcus granulosus
Wang, F., Ye, B.
1. Department of Pathogenic Biology, Chongqing Medical University, Chongqing, 400016, China
2. Research Center for Molecule Medicine and Tumor, Chongqing Medical University, Chongqing, China
... The structural domain was predicted by SMART (http://smart.embl-heidelberg. de/). The
subcellular localization was predicted by ProtComp v. 9.0 (http://linux1.softberry.com/berry.
phtml? topic=protcompan&group=programs&subgroup=proloc/). ...
The Journal of Horticultural Science and Biotechnology
2016, 91(2), 203-209. doi: 10.1080/14620316.2015.1133608
Cloning and expression analysis of three genes encoding ubiquitins in papaya (Carica papaya L.).
Geng, J. J., Shen, Y. H., Yang, F. Y., Li, K., Chen, X. J.
a College of Horticulture Fujian Agriculture and Forestry University, Up and Down Road, Fuzhou 350002, P. R. China
b Institute of Genetics and Breeding in Horticultural Plants, Fujian Agriculture and Forestry University, Up and Down Road, Fuzhou 350002, P. R. China
... program (http://us.expasy.org/tools/peptide-mass.html). Sub-cellular localisation
was predicted using Softberry software (http://linux1.softberry.com/berry.phtml). The
secondary structures and three-dimensional structures of the ...
International journal of molecular sciences
2016, 17(4), 441. doi:10.3390/ijms17040441
Molecular Characterization of MaCCS, a Novel Copper Chaperone Gene Involved in Abiotic and Hormonal Stress Responses in Musa acuminata cv. Tianbaojiao
Feng, X. et al.,
Institute of Horticultural Biotechnology, Fujian Agriculture and Forestry University, Fuzhou 350002, China
... Signal peptide analysis using ChloroP1.1 software showed that the deduced MaCCS protein
contains a chloroplast-targeting peptide like other plant CCSs (Figure 1), which agrees with the
prediction results of subcellular localization obtained using the SoftBerry website. ...
Molecular biology reports
2016, 1-12. DOI: 10.1007/s11033-016-4008-9
Molecular cloning and characterization of the MsHSP17.7 gene from Medicago sativa L.
Li, Z. Y. et al.,
Institute of Animal SciencesChinese Academy of Agricultural Sciences
... motif prediction (TMHMM, http://?www.?cbs.?dtu.?dk/?services/?TMHMM-2.?0/?), protein
secondary structure analysis (Garnier [v6.0.1]; William Pearson, European Bioinformatics Institute,
UK), subcellular location prediction (ProtComp, http://?www.?softberry.?com) and ...
Genome
2016, 59(6), 379-391. doi: 10.1139/gen-2016-0018
Expression of salicylic acid-related genes in Brassica oleracea var. capitata during Plasmodiophora brassicae infection
Manoharan, R. K., Shanmugam, A., Hwang, I., Park, J. I., Nou, I. S.
Department of Horticulture, Sunchon National University, 255 Jungang-ro, Suncheon, Jeonam 57922, Republic of Korea.
... Further, N-glycosylation sites were predicted using the NetNGlyc 1.0 server (Gupta and Jung
2004). Subcellular localization prediction of predicted MES proteins was performed using
Protcomp 9.0 from Softberry (http://linux1.softberry.com/berry.phtml). ...
PlantOmics Journal
2016 DOI:10.21475/poj.160902.p7778x
Isolation, cloning and bioinformatics analysis of ?-amyrin 11-oxidase coding sequence from licorice
Shirazi, Z., Aalami, A., Tohidfar, M., & Sohani, M. M.
1 Department of Plant Biotechnology, Faculty of Agricultural Sciences, University of Guilan, Rasht, Iran
2 Department of Biotechnology, Shahid Beheshti University, Tehran, Iran
... Subcellular studies using Softberry and Psort software showed that the activity of this protein
is in endoplasmic reticulum. ... The Softberry and TargetP softwares showed the protein has
a signal peptide and is located in the secretory pathway (Fig. ...
Biologia Plantarum
2016, 1-9. DOI 10.1007/s10535-016-0618-2
CsWRKY2, a novel WRKY gene from Camellia sinensis, is involved in cold and drought stress responses
Wang, Y. et al.,
1. Tea Science Research Institute, Nanjing Agricultural University, Nanjing, 210095, P.R. China
... CsWRKY2 and other WRKY proteins were subjected to phylogenetic analysis using MEGA 5.05.
The online tool WoLF PSORT (http:// wolfpsort.org/) and Softberry ProComp v. 9.0 (http://
linux1.softberry.com/berry) were used to predict CsWRKY2 protein localization. ...
Genetics and molecular research: GMR
2014, 13(1), 117-126. DOI: 10.4238/2014.January.10.2
Molecular cloning, expression, and regulation of the ovalbumin gene in pigeon oviduct epithelial cells
Zhang H. et al.,
1College of Animal Sciences and Technology, Nanjing Agriculture University, Nanjing, Jiangsu, China
2Institute of Animal Husbandry and Veterinary Science
... Pigeon OVA amino acid sequences were predicted based on the open reading frames of the
cDNA sequences (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). The transmembrane seg- ments
were detected using the Softberry program (http://linux1.softberry.com/berry.phtml). ...
...According to
our computational analysis (ProtComp Version 9.0, Softberry), it is an extracellular secretory
protein with 3 transmembrane segment residues: 27-47, 233-252, and 292-309....
Developmental & Comparative Immunology
2014, 42(2), 148-158. DOI: 10.1016/j.dci.2013.08.025
Identification and functional analysis of the peptidoglycan recognition protein LD gene in the mosquito, Armigeres subalbatus
Wang S., Beerntsen B. T
Department of Veterinary Pathobiology, University of Missouri, Columbia, MO 65211, United States
... services/SignalP) and transmembrane domain using ProtComp Ver. 8.0 on SoftBerry
(http://www.softberry.com). 2.4. Sequence alignments and evolutionary analysis.
The predicted AsPGRP-LD protein sequences were aligned ...
Journal of Tropical Crop Science
2014, 1(1). www.j-tropical-crops.com
Cloning and Characterization of P5CS1 and P5CS2 Genes from Saccharum officinarum L. under Drought Stress
Iskandar, H. M., Widyaningrum, D., Suhandono, S.
A Biotechnology Research Institute for Estate Crop, Jalan Taman Kencana No. 1, Bogor, Indonesia
Genetics and Molecular Biology Division, School of Life Science and Technology, Institut Teknologi Bandung,
... J Amino acid sequence of protein were s SoP5CS predicted using Bioedit. In order to predict
SoP5CS proteins celular localization, we used TargetP and ProtComp from Softberry
(www.softberry.com). Realtimeq PCR(RT- PCR)analysis uantitative q ...
BMR BIOLOGY
2014; Volume:1; Article ID: 1; www.bmrjournals.com
In-Silico characterization of New Delhi Metallo-beta-lactamase-1
Vishwakarma S., Sahu S. K., Mishra S. K.
1 Study Center for Biotechnology, Govt. M. S. Golwalkar College, Rewa (M.P.)
... The tool ProtComp Identifying sub- cellular location of protein [22]. (http://linux1.softberry.
com/berry.phtml? ... 2010; 38(Database issue):D161-6. 22. http://linux1.softberry.com/berry.
phtml ?topic=pcompb&group=programs&sub group=proloc 23. ...
Molecular Breeding
2014, 1-9. DOI:10.1007/s11032-014-0130-3
Molecular cloning and functional analysis of a salt-induced gene encoding an RNA-binding protein in alfalfa
Long R. et al.,
1. Institute of Animal Science, Chinese Academy of Agriculture Science, Beijing, 100193, China
3. College of Prataculture Science, Nanjing Agriculture University, Nanjing, 210095, China
... pl??page=?/?NPSA/?npsa_?hnn.?html). The subcellular localization of MsRBP
was analyzed by ProtComp version 9.0 software (http://?linux1.?softberry.?com/?
berry.?phtml). Amino acid sequence alignment was carried ...
PloS one
2014, 9(1), e84359 DOI:10.1371/journal.pone.0084359
Novel NAC transcription factor TaNAC67 confers enhanced multi-abiotic stress tolerances in Arabidopsis
Mao, X. et al.,
The Key Laboratory for Crop Gene Resources and Germplasm Enhancement, Ministry of Agriculture, The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China
... with PREDATOR (http://bioweb.pasteur.fr/seqanal/protein?/intro-uk.html), and the functional region
was identified using PROSITE (http://expasy.hcuge.ch/sprot/prosite.htm?l). Subcellular localization
was predicted with ProtComp v9.0 software (http://linux1.softberry.com/berry ...
Journal of chemical ecology
2014, 40(1), 63-70. DOI:10.1007/s10886-013-0373-1
A novel fatty acyl desaturase from the pheromone glands of Ctenopseustis obliquana and C. herana with specific Z5-Desaturase activity on myristic acid
Hagstrom, A. K. et al.,
1. Pheromone Group, Department of Biology, Lund University, Solvegatan 37, 223 62, Lund, Sweden
2. The New Zealand Institute for Plant & Food Research Limited, Auckland, New Zealand
... The C. obliquana and C. herana desaturase sequences were analyzed with the
subcellular localization prediction tools Euk- mPLoc 2.0 (Chou and Shen 2010) and
ProtComp 9.0 (Softberry, USA). Quantitative RT-PCR and Analysis ...
Archiv Tierzucht
57 (2014) 15, 1-12 DOI:10.7482/0003-9438-57-015
Molecular cloning, sequence characterization, and gene expression profile of a novel water buffalo
(Bubalus bubalis) gene: Na+, K+-ATPase b -subunit (ATP1B2)
Song, S. et al.,
1Faculty of Animal Science and Technology, Yunnan Agricultural University, Kunming, China, 2Domestic Animal Breeding
and Crossbreed-improvement Station of Yunnan Province, Kunming, China
... 2004). ProtComp 9.0 (http://www.softberry.com) was employed to predict protein sorting signals
and intracellular localization. Secondary structures of deduced AA sequences were predicted
by SOPMA (Geourjon & Deleage 1995). TMHMM version 2.0 (Krogh et al. ...
Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 113, Issue 1 , pp 91-101 DOI:10.1007/s11240-012-0254-2
Transcript profiling identifies novel transcripts with unknown functions as primary response components to osmotic stress in wheat (Triticum aestivum L.)
Garg et al.,
1. Department of Bioscience and Biotechnology, Banasthali University, Banasthali, 304022, Rajasthan, India
2. Department of Biotechnology, Faculty of Science, Jamia Hamdard, New Delhi, 110062, India
... al. 2007 ) and ProtComp v. 9.0 from Softberry Inc. (http://linux1.softberry.com/berry.
phtml?topic=protcomppl&group=programs&subgroup=proloc) were utilized to predict
the sub-cellular localization of the proteins. Prediction ...
Journal of General Plant Pathology
Volume 79, Issue 2 , pp 96-104 DOI:10.1007/s10327-013-0428-8
Analysis of selected singleton transposable elements (SSTEs) and their application for the development of land PATE markers in Magnaporthe oryzae
Zhang et al.,
1. State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China
2. Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, China
4. Interdisciplinary Graduate Program in Genetic Engineering, Graduate School, Kasetsart University, Bangkok, 10900, Thailand
... The non-SSTE sequence was analyzed for predicting genes using the prediction program
Fgenesh (http://www.softberry.com). ... 2004 ) and Protcomp (http://www.softberry.com). Analysis
of P/A polymorphisms of SSTEs at each locus among different isolates. ...
PloS one
October 15, 2013DOI: 10.1371/journal.pone.0077275
The Scutellaria baicalensis R2R3-MYB Transcription Factors Modulates Flavonoid Biosynthesis by Regulating GA Metabolism in Transgenic Tobacco Plants
Yuan Yuan, Chong Wu, Yunjun Liu, Jian Yang, Luqi Huang
National Resource Center for Chinese Materia Medica, Academy of Chinese Medical Sciences, Beijing, China
Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, China
... is present in the NtPAL gene [25]. The box L sequence in the promoter sequence
of NtPAL (GenBank:AB008199) was predicted as ACTTTG using Softberry
(linux1.softberry.com). The sequence contains ACTTTG, which has ...
...The localizations of the deduced proteins were predicted on the
ProtComp Version 9.0 (http://linux1.softberry.com/berry.phtml??topic=protcompan&group=programs&subgroup=proloc) as well as SubLoc v1.0 ...
Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics
Volume 1834, Issue 11, November 2013, Pages 2360–2371 DOI:10.1016/j.bbapap.2013.01.030
Sieving through the cancer secretome
Qifeng Lin a, Hwee Tong Tan a, Hannah Soo Rei Lim b, Maxey C.M. Chung a, b
a Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, 8 Medical Drive, 117597 Singapore
b Department of Biological Sciences, Faculty of Science, National University of Singapore, 14 Science Drive 4, 117543 Singapore
... Other programs such as Softberry ProtComp 9.0 (http://linux1.softberry.com/berry.phtml?topic=
protcompan&group=programs&subgroup=proloc) and KnowPredsite (http://bio-cluster.iis.sinica.
edu.tw/kbloc) [29] are reportedly capable of predicting multiple localizations. ...
Plant Cell Reports
Volume 32, Issue 1 , pp 161-171 DOI:10.1007/s00299-012-1350-9
Over-expression of a subgroup 4 R2R3 type MYB transcription factor gene from Leucaena leucocephala reduces lignin content in transgenic tobacco
Sumita Omer, Santosh Kumar, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India
... 2). In silico sub-cellular localization of LlMYB1 protein was predicted to be nuclear using the
program ProtComp ver- sion 9.0 (http://www.linux1.softberry.com/berry.phtml? topic=
protcomppl&group=programs&subgroup=proloc) accessed from softberry server. ...
Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics
Volume 1834, Issue 11, November 2013, Pages 2442–2453 DOI:0.1016/j.bbapap.2013.01.039
Bioinformatics tools for secretome analysis
Dario Caccia a, Matteo Dugo b, Maurizio Callari b, c, Italia Bongarzone a,
a Proteomics Laboratory, Department of Experimental Oncology and Molecular Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy
b Functional Genomics Core Facility, Department of Experimental Oncology and Molecular Medicine, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, Italy
... org/tools/PRED-TAT. ProtComp, Subcellular localization prediction, +++, FASTA seq
(one at a time), HTML, text, http://linux1.softberry.com/berry.phtml?topic=index&group=
programs&subgroup=proloc. PSORTb v3.0, Subcellular ...
PloS one
July 23, 2013DOI: 10.1371/journal.pone.007029
Proteomic and Phytohormone Analysis of the Response of Maize (Zea mays L.) Seedlings to Sugarcane Mosaic Virus
Liuji Wu et al.,
Henan Agricultural University and Synergetic Innovation Center of Henan Grain Crops, Zhengzhou, China, Key Laboratory of Physiological Ecology and Genetic Improvement of Food Crops in Henan Province, Zhengzhou, China
... The subcellular locations of the unique proteins identified in this study were
determined using Softberry bioinformatics software. Genetic map positions were
determined in silico using the Maize GDB http://www.maizegdb.org/. ...
Appl. Environ. Microbiol.
December 2013 vol. 79 no. 24 7646-7653 DOI:10.1128/AEM.02905-13
Glycerol-3-Phosphate Acyltransferase Contributes to Triacylglycerol Biosynthesis, Lipid Droplet Formation, and Host Invasion in Metarhizium robertsii
Qiang Gao, Yanfang Shang, Wei Huang and Chengshu Wang
Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China
.. or gaps, and 1,000 bootstrap replicates. Prediction of mrGAT subcellular localization
was performed with the program ProtComp (ver. 9.0, Softberry) and TargetP (ver.
1.1) (22). Gene deletion and complementation.For functional ...
Insect Biochemistry and Molecular Biology
Volume 43, Issue 6, June 2013, Pages 510–521 DOI:10.1016/j.ibmb.2013.03.006
Subcellular localization of the fatty acyl reductase involved in pheromone biosynthesis in the tobacco budworm, Heliothis virescens (Noctuidae: Lepidoptera)
Asa K. Hagstrom a, Andrea Walther b, Jurgen Wendland b, Christer Lofstedt a
a Pheromone Group, Department of Biology, Lund University, Solvegatan 37, SE-223 62 Lund, Sweden
b Carlsberg Laboratory, Yeast Biology, Gamle Carlsberg Vej 10, DK-1799 Copenhagen V, Denmark
... on known N-terminal signal sequences (Emanuelsson et al., 2000; Emanuelsson et al., 2007),
ProtComp that combines several methods of protein localization prediction of sequences
containing signal sequences, anchors and other functional peptides (Softberry, USA), PTS1 ...
Environ. Sci. Technol.,
2013, 47 (10), pp 5327–5335 DOI:10.1021/es400113y
Effects of Deficiency and Excess of Zinc on Morphophysiological Traits and Spatiotemporal Regulation of Zinc-Responsive Genes Reveal Incidence of Cross Talk between Micro- and Macronutrients
Ajay Jain †, Bhaskaran Sinilal ‡, Gurusamy Dhandapani †, Richard B. Meagher §, and Shivendra V. Sahi *‡
† National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi-110012, India
‡ Department of Biology, Western Kentucky University, Bowling Green, Kentucky 42101-1080, United States
§ Department of Genetics, University of Georgia, Fred C. Davison Life Sciences Complex, Athens, Georgia 30602, United States
... Server, were analyzed in databases AtcisDB for identifying transcription factor binding sites(29,
30) and PlantCare for cis-regulatory elements, respectively.(31) Protein level subcellular
localization of the ZIPs was predicted by amino acid sequence analysis at softberry.com. ...
Postharvest Biology and Technology
Volume 75, January 2013, Pages 106–113 DOI:10.1016/j.postharvbio.2012.08.005
Catabolism of GABA in apple fruit: Subcellular localization and biochemical characterization of two g-aminobutyrate transaminases
Trobacher et al.,
a Department of Plant Agriculture, University of Guelph, Guelph, Ontario, Canada N1G 2W1
b Department of Molecular and Cellular Biology, University of Guelph, Guelph, Ontario, Canada N1G 2W1
... Several web-based subcellular localization programs were used to assess the potential targeting
of the apple GABA-Ts including TargetP (v1.1; http://www.cbs.dtu.dk/services/TargetP/;
Emanuelsson et al., 2000), ProtComp (http://linux1.softberry.com/berry.phtml?topic ...
BMC Plant Biology
2013, 13:156 doi:10.1186/1471-2229-13-156
Functional characterisation of three members of the Vitis vinifera L. carotenoid cleavage dioxygenase gene family
Justin G Lashbrooke 1, Philip R Young 1, Samantha J Dockrall 1, Krishnan Vasanth1 2 and Melane A Vivier 1
1 Institute for Wine Biotechnology, Department of Viticulture and Oenology, Stellenbosch University, Private Bag X1, Matieland, 7602, South Africa
2 Current address: Department of Botany, Bharathiar University, Coimbatore, TN, 641 046, India
... bioinformatics.psb.ugent.be/plaza/) [27]. The putative sub-cellular localisation of
protein sequences were predicted using ProtComp Version 8.0 (http://www.softberry.
com/berry.phtml). V. vinifera expressed sequence tags (ESTs ...
mcp
M113.028480. DOI:10.1074/mcp.M113.028480
Linkage of oxidative stress and mitochondrial dysfunctions to spontaneous culture degeneration in Aspergillus nidulans
Li et al.,
Shanghai Institutes for Biological Sciences, CAS, China
... ver. 9.0, http://linux1.softberry.com/ ) and WoLF PSORT (http://wolfpsort.org/) to predict
subcellular localizations and InterProScan analysis (www.ebi.ac.uk/Tools/pfa/iprscan/)
to classify individual proteins to protein families. Functional ...
Advanced Science, Engineering and Medicine
Volume 5, Number 8, August 2013 , pp. 777-782(6) DOI:10.1166/asem.2013.1358
Cloning of Alcohol Dehydrogenase Gene from Rapeseeds and Correlation with Waterlogging Tolerance Index
Xu et al.,
... Software TargetP 1.1 could not predict a definite subcellular localization of BnADH-1, only pre-
dicted other protein. PSORT predicted a weak subcellular localization of BnADH-1 at mitochondrial
matrix space. WoLFPSORT20 and Softberry-ProtComp 21 predicted a Adv. Sci. ...
International Journal of Biotechnology and Biochemistry
Volume 9, Number 3 (2013) pp. 293-312 DOI:
Molecular Cloning, Characterization and Expression Analysis of Stress Responsive Dehydrin Genes from Drought Tolerant Horsegram (Macrotyloma uniflorum (Lam.) Verdc.)
Ramya et al.,
Department of Botany, Sri Krishnadevaraya University, Anantapuram, 515 003, India.
?Center for Honeybee Disease Control, Animal and Plant Quarantine Agency, 175 Anyang ro, Anyang City, 430-757, Gyeonggi-do, South Korea.
... 71, 79 and 65 respectively. 4.3 Localization of MuDHN1, MuDHN2 and MuDHN3
genes Integral prediction of protein location was analyzed by ProtComp v9.0
(http://linux1.softberry. com/berry). In this study, predicted localization ...
BMC Genomics
2013, 14:343 doi:10.1186/1471-2164-14-343
An integrative “omics” approach identifies new candidate genes to impact aroma volatiles in peach fruit
Sanchez et al.,
1 Instituto de Biologia Molecular y Celular de Plantas (IBMCP), Ingeniero Fausto Elio s/n, Valencia 46022, Spain
2 Instituto Nacional de Tecnologia Agropecuaria (INTA), Ruta N°9 Km 170, San Pedro 2930, Argentine
... Protein sequences were aligned by the clustalW method using the MegAlign software (DNAStar).
Transmembrane domains were predicted with TMpred (http://www.ch.embnet.org) and protein
localization with ProtComp v9.0 (http://linux1.softberry.com/berry.phtml). ...
Plant Cell Reports
Volume 32, Issue 8 , pp 1289-1298 DOI:10.1007/s00299-013-1443-0
Overexpression of a novel salt stress-induced glycine-rich protein gene from alfalfa causes salt and ABA sensitivity in Arabidopsis
Long et al.,
1. School of Life Science, Chongqing University, Chongqing, China
2. Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing, China
... Subcellular localization of MsGRP. The online ProtComp version 9.0 program (http://www.softberry.
com) was used to predict the subcellular localization. The result predicted by the integral prediction
method showed that MsGRP is most likely localized in the extracellular space. ...
Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 115, Issue 3 , pp 443-455 DOI:10.1007/s11240-013-0375-2
Expression of SbSNAC1, a NAC transcription factor from sorghum, confers drought tolerance to transgenic Arabidopsis
Lu et al.,
1. Institute of Crop Science, Chinese Academy of Agricultural Sciences/The National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI), Beijing, 100081, China
2. Plant Science and Technology College, Beijing University of Agriculture, Beijing, China
... Subcellular localization of the SbSNAC1 protein. A nucleus-localization signal (NLS) was
found in the N-terminal region of the SbSNAC1 protein using the online subcellular
localization analysis software (http://linux1.softberry.com/berry.phtml). ...
Plant Molecular Biology
Volume 81, Issue 1-2 , pp 41-56 DOI:10.1007/s11103-012-9981-3
Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea
Sun et al.,
1. National Key Laboratory for Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, Zhejiang, China
2. Samuel Roberts Noble Foundation, Inc., 2510 Sam Noble Parkway, Ardmore, OK, 73401, USA
... 2007; Kaneda et al. 2009; Jensen et al. 2008; Wang et al. 2009; Bu et al. 2008; Takasaki et al.
2010). Subcellular localization of ONAC122 and ONAC131 ONAC122 and ONAC131 were
predicted to localize in nucleus using ProtComp v9.0 (http://linux1.softberry. com/berry). ...
Malaria Journal
2013, 12:66 http://www.malariajournal.com/content/12/1/66
Expression profile of the Plasmodium falciparum intra-erythrocytic stage protein, PF3D7_1363700
Roberts1 et al.,
1
Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA. 2
Molecular Microbiology and Immunology and Veterinary Pathobiology Joint Graduate Program, University of Missouri, Columbia, MO, USA.
... enter the se- cretory pathway. In support of this prediction, Softberry and PSORTII,
two localization programs, predicted PF3D7_1363700 to be either a secreted or plasma
mem- brane protein. Based on topology predictions, there ...
The Plant Cell Online
(2013). 25(6), 1946-1959. DOI:10.?1105/?tpc.?113.?113969
The transition from a phytopathogenic smut ancestor to an anamorphic biocontrol agent deciphered by comparative whole-genome analysis
Lefebvre et al.,
aDepartement de Phytologie, Universite Laval, Quebec G1V 0A6, Canada
bAgriculture and Agri-Food Canada, Pacific Agri-Food Research Centre, Summerland V0H 1Z0, Canada
...TMHMM v2.0 (Krogh et al., 2001) predicted number of transmembrane domains and position according to cleavage site, and finally, correlation to LocDB or
PotLocDB ProtComp v9.0 (http://www.softberry.com) databases....
PloS one
(2013). 8(2), e55879. DOI:10.1371/journal.pone.0055879
The NADPH Oxidase Complexes in Botrytis cinerea: Evidence for a Close Association with the ER and the Tetraspanin Pls1
Siegmund, U., Heller, J., van Kann, J. A., & Tudzynski, P.
Institut fuer Biologie und Biotechnologie der Pflanzen, Westfaelische Wilhelms Universitaet Muenster, Muenster, Germany
Laboratory of Phytopathology, Wageningen University, Wageningen, The Netherlands
...as well as Nox1, Nox2 and Nox4 from Homo sapiens were used to predict their cellular localization using ProtComp v. 9.0 (http://linux1.softberry.com/berry.phtml??topic=protcompan&group=programs&subgroup?=proloc)....
Molecular Microbiology
(2013),89: 29–51. DOI:10.1111/mmi.12254
Ustilago maydis natural antisense transcript expression alters mRNA stability and pathogenesis.
Donaldson, M. E. and Saville, B. J.
1Environmental and Life Sciences Graduate Program
2Forensic Science Program, Trent University, Peterborough, ON, Canada
...Furthermore, putative proteins were inspected for N-terminal secretion signals using SignalP v4.0 (Petersen et?al., 2011), TargetP v1.1 (Emanuelsson et?al., 2000),
and ProtComp v9.0 (Softberry)...
Journal of Plant Physiology
Volume 169, Issue 10, 1 July 2012, Pages 992–998 DOI: 10.1016/j.jplph.2012.02.018
The AP2-like gene NsAP2 from water lily is involved in floral organogenesis and plant height
Luo et al.,
College of Horticulture, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People's Republic of China
... The bar = 200 ?m. View thumbnail images. Subcellular localization of NsAP2 protein. The NsAP2
protein was predicted to be localized at the nucleus through sequence prediction analysis
(http://linux1.softberry.com/berry.phtml?topic=proteinloc&prg=ProtComP). ...
Plant Molecular Biology Reporter
December 2012, Volume 30, Issue 6, pp 1283-1290DOI
Molecular Cloning and Characterization of Two 9-Lipoxygenase Genes from Taxus chinensis
Li et al.,
1. Institute of Resource Biology and Biotechnology, Department of Biotechnology, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, 430074, People’s Republic of China
2. Key Laboratory of Molecular Biophysics Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China
... Three different programs, Plant- mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/), SignalP
(http://www.cbs.dtu.dk/services/SignalP/), and ProtComp (www.softberry.com/berry.phtml), were
used for sub- cellular localization prediction based on the identification of ...
Malaria Journal
2012, 11:80 DOI: 10.1186/1475-2875-11-80
Transcript and protein expression profile of PF11_0394, a Plasmodium falciparum protein expressed in salivary gland sporozoites
Schlarman et al.,
1 Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA
2 Molecular Microbiology and Immunology and Veterinary Pathobiology Joint Graduate Program, University of Missouri, Columbia, MO, USA
... Next, additional sequence analysis programs available on the ExPASy Bioinformatics Resource
Portal and SoftBerry, such as PSORT and ProtComp, were used to verify that the proteins encoded
by the genes were predicted to either be located on the surface and/or secreted ...
Plant growth regulation
2012, vol. 67, no2, pp. 171-184
CsPDR8 and CsPDR12, two of the 16 pleiotropic drug resistance genes in cucumber, are transcriptionally regulated by phytohormones and auxin herbicide in roots
Migocka M. (1) ; Papierniak A. (1) ; Warzybok A. (1) ; Klobus G. (1)
(1) Department of Plant Physiology, Institute of Plant Biology, Wroclaw University, 50-328, Wroclaw, Poland
... 0 software (Tamura et al. 2011) with bootstraps 1,000. The prediction of subcellular
localization was performed using ProtComp v8.0 (softberry.com), whereas TMHMM
method (Sonnhammer et al. 1998), based on a hidden ...
Plant Cell Reports
September 2012, Volume 31, Issue 9, pp 1737-1746 DOI: 10.1007/s00299-012-1287-z
An alfalfa (Medicago sativa L.) ethylene response factor gene, MsERF11, enhances salt tolerance in transgenic Arabidopsis
Tingting Chen et al.,
1. Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, 100193, People’s Republic of China
2. Department of Grassland Science, Animal Science and Technology College, Sichuan Agricultural University, Ya’an, 625014, People’s Republic of China
... Subcellular localization of the MsERF11 protein Subcellular localization of the
MsERF11 protein was first carried out in silico using an online prediction program
ProtComp Version 9.0 (http://linux1.softberry.com/berry.phtml). ...
Advanced Science Letters
Volume 10, Number 1, May 2012 , pp. 191-195(5) DOI: 10.1166/asl.2012.3742
A New Member of PAL Family Initiating Secondary Metabolism During Fatty Acid Biosynthesis in Camellia Oleifera Seeds
X Tan, H Chen, D Zhang, F Hu
... 281, and three transmembrane regions distributed at N-terminal of the protein. The
sub-cellular location result predicted by Softberry revealed Co-PAL deposit in
cytoplasmid. As shown as in Figure 3, it could be found that -helix ...
Journal of Integrative Agriculture
Volume 11, Issue 1, January 2012, Pages 31–42 DOI: 10.1016/S1671-2927(12)60780-9,
Molecular Characterization and Expression Analysis of TaZFP15, a C2H2-Type Zinc Finger Transcription Factor Gene in Wheat (Triticum aestivum L.)
Zhao-hua SUN a, Chang-huan DING a, Xiao-juan LI a, , , Kai XIAO b,
a College of Life Science, Agricultural University of Hebei, Baoding 071001, P.R. China
b College of Agronomy, Agricultural University of Hebei, Baoding 071001, P.R. China
... 2). Based on analysis by SubLoc v1.0 www Server.url program and online analy- sis
(http://linux1.softberry.com/berry.phtml), the sub- cellular location of TaZFP15 was predicted to
be tar- geted onto the nucleus. ... 1.0 program (http://linux1. softberry.com/berry.phtml). ...
Molecular Biology Reports
September 2012, Volume 39, Issue 9, pp 9167-9177 DOI: 10.1007/s11033-012-1789-3
Analysis on DNA sequence of goat RFRP gene and its possible association with average daily sunshine duration
D. W. Huang et al.,
1. Key Laboratory of Farm Animal Genetic Resources and Germplasm Innovation of Ministry of Agriculture, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, 100193, People’s Republic of China
2. State Key Laboratory of Agricultural Biotechnology, China Agricultural University, Beijing, 100193, People’s Republic of China
... Protein struc- ture and function prediction were performed using Pep- stats (http://www.ebi.ac.
uk/Tools/emboss/pepinfo/), PSO RT II Prediction (http://psort.hgc.jp/form2.html), ProtComp 9.0
(http://linux1.softberry.com/berry.phtml?topic= protcompan&group=programs&subgroup ...
Molecular Biology Reports
DOI: 10.1007/s11033-012-1577-0
Isolation and characterization of two hydroperoxide lyase genes from grape berries
Bao-Qing Zhu et al.,
1. Centre for Viticulture and Enology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083, China
... Sal I (for reverse primer) Mol Biol Rep 123 Page 4. PSORT (http://psort.ims.u-tokyo.
ac.jp/), ChloroP 1.1 (http: //www.cbs.dtu.dk) and ProtComp (http://linux1.softberry.
com/berry.phtml). The multiple sequence alignments of plant ...
PLoS ONE
7(4): e33731. doi:10.1371/journal.pone.0033731
The Predicted Secretome of the Plant Pathogenic Fungus Fusarium graminearum: A Refined Comparative Analysis
Brown NA, Antoniw J, Hammond-Kosack KE
Centre for Sustainable Pest and Disease Management, Department of Plant Pathology and Microbiology, Rothamsted Research, Harpenden, Hertfordshire, United Kingdom
... GPI-anchor proteins were predicted by big-PI (http://mendel.imp.ac.at/gpi/cgi-bin/gpi_?pred_fungi.
cgi) [48]. ProtComp was also used to predict localization of the remaining proteins using the LocDB
and PotLocDB databases (ProtComp v8.0; http://www.softberry.com). ...
Fungal diversity
2012, vol. 54, no 1, pp. 87-99 DOI: 10.1007/s13225-012-0169-6
First characterization of endophytic Corynespora cassiicola isolates with variant cassiicolin genes recovered from rubber trees in Brazil
Deon et al.,
(1) CIRAD, UMR AGAP, 63000, Clermont-Ferrand, France
(2) Clermont Universite, Universite Blaise Pascal, UMR 547 PIAF, 63000, Clermont-Ferrand, France
... protein (Krogh et al. 2001). The ProtComp program (version 9.0; http://www.softberry.
com) was used to predict the subcellular localization of the protein. Gene expression
analyses by real-time PCR RNA extraction and cDNA ...
Plant Cell Reports
Volume 31, Issue 8 , pp 1473-1484 DOI: 10.1007/s00299-012-1262-8
ZmHSP16.9, a cytosolic class I small heat shock protein in maize (Zea mays), confers heat tolerance in transgenic tobacco
Liping Sun et al.,
1. State Key Laboratory of Crop Biology, Shandong Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, 61 Daizong Street, Tai’an, 271018, Shandong, China
2. Taishan Medical University, Tai’an, 271000, Shandong, China
... 2). In order to further confirm that ZmHSP16.9 belongs to cytosolic sHSP family, the amino acid
sequence of ZmHSP16.9 was analyzed in the ProtComp v.9.0 database (http://linux1.softberry.
com/berry.phtml?topic=protcomppl &group=programs&subgroup=proloc). ...
Molecular Biology Reports
Volume 39, Issue 3 , pp 2337-2345 DOI: 10.1007/s11033-011-0984-y
Molecular cloning and characterization of an F-box family gene CarF-box1 from chickpea (Cicer arietinum L.)
Yuying Jia et al.,
1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
2. Key Laboratory of Agricultural Biotechnology, Xinjiang Agricultural University, Urumqi, 830052, China
... proteins [42, 43]. But only one study reported that KFB protein LKP2 located in nuclei
[33]. In this study, CarF-box1 was predicted to be located in the nucleus by ProtComp
6.1 (http://linux1.softberry.com/berry). To con- firm this ...
Biologia Plantarum
Volume 56, Issue 1 , pp 43-49 DOI: 10.1007/s10535-012-0014-5
Molecular cloning and characterization of a novel stress responsive gene in alfalfa
Long et al.,
1. College of Animal Science and Technology, China Agriculture University, Beijing, 100191, P.R. China
2. Institute of Animal Sciences, Chinese Academy of Agricultural Sciences, Beijing, 100193, P.R. China
... 5). The position of the nucleus was visualized under laser scanning confocal microscope. In
addition, we also used ProtComp v. 9.0 program online (www.softberry.com) to predict the
subcellular localization, and the result showed that MsPBL most probably localized in nucleus. ...
BioMetals
Volume 25, Issue 2 , pp 275-283 DOI: 10.1007/s10534-011-9501-y
Identification and characterization of a novel outer membrane protein receptor required for hemin utilization in Vibrio vulnificus
Shreya Datta, Jorge H. Crosa
1. Department of Molecular Microbiology and Immunology, Oregon Health and Science University, 3181 SW Sam Jackson Park Road, Portland, OR, 97239, USA
... 2010) and ProtCompB (http:// linux1.softberry.com/berry.phtml?topic=protcompan
&group=programs&subgroup) computational tools that are commonly used to predict
subcellular local- ization of proteins in Gram-negative bacteria. ...
Gene
Volume 502, Issue 1, 1 July 2012, Pages 69–74 DOI: 10.1016/j.gene.2012.04.017
CsNAM-like protein encodes a nuclear localized protein and responds to varied cues in tea [Camellia sinensis (L.) O. Kuntze]
Asosii Paul a, 1, Richard Chalo Muoki a, b, 1, 2, Kashmir Singh b, Sanjay Kumar a
a Biotechnology Division, Council of Scientific and Industrial Research-Institute of Himalayan Bioresource Technology, Palampur, Himachal Pradesh-176061, India
b Biotechnology Department, Panjab University, Chandigarh-160014, Punjab, India
... and [Peng et al., 2009]). In this study, CsNAM-like protein was expected to be localised
in the nucleus as predicted by the analyses using PSORTII and ProComp v8.0
(http://linux1.softberry.com/berry). To confirm the localization ...
AJCS
6(4):649-655 (2012)
Molecular cloning and expression of 12-oxophytodienoic acid reductase gene from barley
Saeid Abu-Romman
Department of Biotechnology, Faculty of Agricultural Technology, Al-Balqa’ Applied University, Al-Salt, 19117,
Jordan
... The amino acids sequence of HvOPR1 was deduced and analyzed with ProtParam tool
(http://cn.expasy.org/tools/ protparam.html), and the prediction of subcellular localization was
performed using the online tool ProtComp 9.0 (http://linux1.softberry.com/berry.phtml). ...
Journal of Plant Physiology
Volume 169, Issue 18, 15 December 2012, Pages 1807–1814 DOI: 10.1016/j.jplph.2012.07.014,
Characterization of a type-A response regulator differentially expressed during adventitious caulogenesis in Pinus pinaster
Jose M. Alvarez a, Millan Cortizo a, 1, Ricardo J. Ordas a, b
a Laboratorio de Biotecnologia Agroforestal, Escuela Politecnica de Mieres, Universidad de Oviedo, C/Gonzalo Gutierrez Quiros, 33600 Mieres, Spain
b Area de Fisiologia Vegetal, Departamento BOS, Universidad de Oviedo, C/Catedratico Rodrigo Uria s/n, 33071 Oviedo, Spain
... The PipsRR1 protein was predicted to be nuclear (ProtComp 9.0 software, http://www.softberry.
com). The receiver domain of PipsRR1, PipiRR1 and all of the Arabidopsis type-A RRs (RR
3–9 and RR 15–17) were aligned with the ClustalW software (Fig. ...
BMC Genomics x
BMC Genomics 2012, 13:221 doi:10.1186/1471-2164-13-221
Deciphering the genomic structure, function and evolution of carotenogenesis related phytoene synthases in grasses
Dibari et al.,
1 INRA - UMR 1095 ‘Genetique Diversite Ecophysiologie des Cereales’ (GDEC), 5 Chemin de Beaulieu, 63100, Clermont-Ferrand, France
2 INRA - Centre National de Ressources Genomiques Vegetales (CNRGV), Chemin de Borde Rouge BP 52627, 31326, Castanet Tolosan cedex, France
...However, according to ProtComp 9.0 [35] prediction, wheat PSY3 may have a putative chloroplast localization....
Plant Molecular Biology
Volume 81, Issue 1-2 , pp 41-56 DOI: 10.1007/s11103-012-9981-3
Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea
Sun et al.,
1. National Key Laboratory for Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou, 310058, Zhejiang, China
2. Samuel Roberts Noble Foundation, Inc., 2510 Sam Noble Parkway, Ardmore, OK, 73401, USA
... 2007; Kaneda et al. 2009; Jensen et al. 2008; Wang et al. 2009; Bu et al. 2008; Takasaki et al.
2010). Subcellular localization of ONAC122 and ONAC131 ONAC122 and ONAC131 were
predicted to localize in nucleus using ProtComp v9.0 (http://linux1.softberry. com/berry). ...
BMC Genomics
2012, 13:544 doi:10.1186/1471-2164-13-544
Genome-wide classification and expression analysis of MYB transcription factor families in rice and Arabidopsis
Katiyar et al.,
1 National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, 110012, India
2 National Bureau of Plant Genetic Resources, Indian Agricultural Research Institute Campus, New Delhi, 110012, India
...and ProtComp 9.0 server ( http:/ / linux1.softberry.com/ berry.phtml?topic=protcomppl&group= programs&subgroup=proloc webcite). ...
PLoS ONE
7(12): e49904. doi:10.1371/journal.pone.0049904
Defining the Predicted Protein Secretome of the Fungal Wheat Leaf Pathogen Mycosphaerella graminicola
Morais do Amaral A, Antoniw J, Rudd JJ, Hammond-Kosack KE
Embrapa LabEx Programme, Rothamsted Research, Harpenden, Herts, United Kingdom, Department of Plant Biology and Crop Science, Rothamsted Research, Harpenden, Herts, United Kingdom
...ProtComp was also used to predict localization of the remaining proteins using the LocDB and PotLocDB databases (ProtComp v8.0; http://www.softberry.com)....
Molecular Biology Reports
Volume 39, Issue 2 , pp 1713-1720 DOI 10.1007/s11033-011-0911-2
Identification and expression pattern of one stress-responsive NAC gene from Solanum lycopersicum
Qinqin Han et al.,
1. Key Laboratory of Horticultural Plant Biology, Ministry of Education, Huazhong Agricultural University, Wuhan, China
2. National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, 430070, China
... affrc.go.jp/PLACE/index.html). Subcellular location of protein was predicted with ProComp
v8.0 (http://linux1. softberry.com/berry). Multiple sequence alignment was performed using
the ClustalW (http://www.ch.embnet.org /software/ClustalW.html). ...
BMC Genomics
2012 13(243). DOI: 10.1186/1471-2164-13-243
The genes and enzymes of the carotenoid biosynthetic pathway in Vitis vinifera L.
Young et al.,
Research and Innovation Centre. Genomics and Biology of Fruit Crops Department
... 1 cTP: Softberry ProtComp (http://www.softberry.com/berry.phtml) prediction for a chloroplast
transit peptide 2 The size in base pairs of the cDNA copy of the gene from the predicted ATG
to the predicted STOP codon; 3 The size in base pairs of the genomic copy of the gene from ...
POJ
5(2):94-102 (2012)
Genome-wide analysis of cytosolic and chloroplastic isoforms of glutathione reductase in plant cells
Ahmad Tahmasebi 1, Farzaneh Aram 2, Mansour Ebrahimi 3, Manijeh Mohammadi-Dehcheshmeh 4,
Esmaeil Ebrahimie 1&5*
1Department of Crop Production & Plant Breeding, College of Agriculture, Shiraz University, Shiraz, Iran
2Institute of Biotechnology, College of Agriculture, Shiraz University, Shiraz University, Shiraz, Iran
...Genomic sequences were also analyzed in the
FGENESH gene structure prediction program
(http://www.softberry.com) and GeneMark program
(http://opal.biology.gatech.edu/GeneMark)....
...Protein sorting and subcellular localization predictions were
performed according to ProtComp program Version 5
(http://www.softberry.com/)...
Plant Cell Reports
October 2012 DOI
10.1007/s00299-012-1350-9
Over-expression of a subgroup 4 R2R3 type MYB transcription factor gene from Leucaena leucocephala reduces lignin content in transgenic tobacco
Sumita Omer (1)
Santosh Kumar (1) (2)
Bashir M. Khan (1)
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India
... 2). In silico sub-cellular localization of LlMYB1 protein was predicted to be nuclear using the
program ProtComp ver- sion 9.0 (http://www.linux1.softberry.com/berry.phtml? topic=
protcomppl&group=programs&subgroup=proloc) accessed from softberry server. ...
Molecular Biology Reports
Volume 39, Issue 4 , pp 3565-3572 DOI
10.1007/s11033-011-1130-6
Identification and characterization of a LEA family gene CarLEA4 from chickpea (Cicer arietinum L.)
Hanyan Gu et al.,
1. State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
2. Key Laboratory of Agricultural Biotechnology, Xinjiang Agricultural University, Urumqi, 830052, China
... For protein locali- zation analysis, ProtComp 6.1 (a program for identification of sub-cellular
localization of eukaryotic proteins) (http:// linux1.softberry.com/berry.phtml?topic=
protcompl&subgroup = programs&subgroup = proloc) and Subloc (Subcellular locali- zation) ...
Journal of Medical Entomology,
2012, Volume 49, Number 3, Pages 441-786 , pp. 656-671(16), DOI: http://dx.doi.org/10.1603/ME11165
Cloning and Characterization of the Peptidoglycan Recognition Protein Genes in the Mosquito, Armigeres subalbatus (Diptera: Culicidae)
Wang, Songjie; Conant, Gavin C.; Ou, Ruguang; Beerntsen, Brenda T.
... The AsPGRP protein sequences were analyzed for the presence of a signal peptide using
SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP) and transmembrane domain using
ProtComp Ver. 8.0 on SoftBerry (http://www.softberry.com). ...
Am J Trop Med Hyg
2012 vol. 86 no. 6 943-954 doi: 10.4269/ajtmh.2012.11-0797
PFE0565w, a Plasmodium falciparum Protein Expressed in Salivary Gland Sporozoites
Schlarman et al.,
Department of Veterinary Pathobiology, University of Missouri, Columbia, Missouri; Molecular Microbiology and Immunology and Veterinary Pathobiology Joint Graduate Program, University of Missouri, Columbia, Missouri; Department of Global Health, University of South Florida, Tampa, Florida
... Next, additional sequence analysis programs available on the ExPASy Bioinformatics Resource
Portal (www.expasy.org) and SoftBerry (www.softberry.com), such as PSORT and ProtComp,
were used to verify that the proteins encoded by the genes were predicted to either be ...
Genet. Mol. Res.
11 (4): 3676-3687 (2012) DOI http://dx.doi.org/10.4238/2012.August.17.3
Regulation of ATG6/Beclin-1 homologs by abiotic stresses and hormones in rice
(Oryza sativa L.)
R.M. Rana1,2, S. Dong1, Z. Ali3,4, J. Huang1 and H.S. Zhang1
1State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, China
2Department of Plant Breeding and Genetics,
Pir Mehr Ali Shah Arid Agriculture University Rawalpindi,
Rawalpindi, Pakistan
... Genomic and cDNA sequences of these proteins were retrieved
from NCBI, and gene structure was predicted by FGENESH+ (http://linux1.softberry.com/
berry.phtml). The chromosomal location of each ATG6 gene in rice was determined from the
rice physical map constructed by the International Rice Genome Sequencing Project (IRGSP)
(http://rgp.dna.affrc.go.jp). Subcellular localization of the OsATG6 family was predicted by
WoLF PSORT (Horton et al., 2006) and ProtComp (http://linux1.softberry.com/berry.phtml). ...
Gene
Volume 485, Issue 1, 1 October 2011, Pages 53–62 DOI: 10.1016/j.gene.2011.06.012
Novel genes specifically expressed during the development of the male thalli and antheridia in the dioecious liverwort Pellia endiviifolia
Sierocka et al.,
a Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland
b Laboratory of Bioinformatics, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland
... The subcellular location of predicted amino acid sequences was assigned with PSORT
(http://psort.imsekundu-tokyo.ac.jp/form.html), TargetP 1.1 (http://www.cbsekunddtu.dk/services/
TargetP/) and ProtComp (http://linux1.softberry.com/berry.phtml?topic=protcompplandgroup ...
Insect Biochemistry and Molecular Biology
Volume 41, Issue 12, December 2011, Pages 956–967 DOI: 10.1016/j.ibmb.2011.09.005,
Functional characterization of ecto-5?-nucleotidases and apyrases in Drosophila melanogaster
Michaela Fenckova a, Radka Hobizalova a, Zdenek Faltynek Fric b, Tomas Dolezal a
a Faculty of Science, University of South Bohemia, Branisovska Street 31, Ceske Budejovice 37005, Czech Republic
b Institute of Entomology, Biology Centre of the Academy of Sciences of the Czech Republic, Ceske Budejovice, Czech Republic
... 3; analyzed by SignalP 3.0 and SoftBerry ProtComp v. 9.0). Full-size image (30 K) Full-size
image (30 K) Fig. 1. Gene structure of 5 loci with putative Ecto-5?-Nucleotidases. Three
chromosomal regions with cytolocations marked in black boxes are shown. ...
Gene
485 (2011) 53–62 DOI: 10.1016/j.gene.2011.06.012
Novel genes speci?cally expressed during the development of the male thalli and
antheridia in the dioecious liverwort Pellia endiviifolia
Sierocka et al.,
a
Department of Gene Expression, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland
b
Laboratory of Bioinformatics, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, 89 Umultowska Street, 61-614 Poznan, Poland
... de/) programs. The subcellular location of predicted amino acid sequences was assigned with
PSORT (http://psort.imsekundu- tokyo.ac.jp/form.html), TargetP 1.1 (http://www.cbsekunddtu.
dk/ services/TargetP/) and ProtComp (http://linux1.softberry.com/berry. ...
POJ
4(5):239-249(2011)
Comparative analysis of the genomic regions flanking Xa21 locus in indica and japonica ssp.
of rice (Oryza sativa L.)
Kumar et al.,
1Department of Plant Sciences, School of Life Sciences, University of Hyderabad, Gachibowli Prof. C.R. Rao
Road , Hyderabad 500046, India
2Department of Plant Pathology, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India
... Protcomp V 8.0 (http://linux1.softberry.com/ berry.phtml) analysis for the sub cellular location of
proteins showed that 80% of the predicted TEs were nuclear in localization while the remaining
were cytoplasmic or mitochondrial in both the rice lines (Table 9). GC Content in the ...
...Gene prediction from the 100 kb region flanking to Xa21
locus of chromosome 11 in japonica and indica rice was
carried out using HMM based gene structure prediction
software FGENESH tool (www.softberry.com) trained for
monocot plant species (Salamov and Solovyer, 2000) ...
BMC Biotechnology
2011, 11:65 doi:10.1186/1472-6750-11-65
A novel subtilase with NaCl-activated and oxidant-stable activity from Virgibacillus sp. SK37
Ekkarat Phrommao 1, Jirawat Yongsawatdigul 1, Sureelak Rodtong 2 and Montarop Yamabhai 3
1 School of Food Technology, Institute of Agricultural Technology, Suranaree University of Technology, 111 University Avenue, Nakhon Ratchasima, 30000, Thailand
2 School of Microbiology, Institute of Science, Suranaree University of Technology, 111 University Avenue, Nakhon Ratchasima, 30000, Thailand
... AprX-SK37 lacks a canonical signal sequence for membrane translocation (signal peptide) at
its N-terminus, indicating an intracellular location as suggested by sub-cellular prediction servers
of SignalP 3.0 [24] and ProtCompB (Softberry Bioinformatics tools: http://linux1 ...
Biochemical Genetics
Volume 49, Issue 9-10 , pp 656-664 DOI: 10.1007/s10528-011-9440-x
Cloning and Expression of One Chloroplastic Ascorbate Peroxidase Gene from Nelumbo nucifera
Dong et al.,
1. Key Lab of the Ministry of Education for Plant Developmental Biology, College of Life Science, Wuhan University, Wuhan, 430072, China
2. Lotus Center, Wuhan University, Wuhan, 430072, China
... Subcellular APX was located using the Prot- Comp Version 6.1 program (http://linux1.
softberry.com/cgi-bin/programs/proloc/ protcomppl.pl). The amino acid sequence of N.
nucifera APX was compared with other species available in GenBank. ...
Biologia
Volume 66, Issue 5 , pp 828-832 DOI: 10.2478/s11756-011-0101-7
Expression analysis of nuclear W2-containing homologs of eukaryotic initiation factors in rice
Peipei Nie, Xiaoyu Li, Yaoguang Liu, Qunyu Zhang
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, College of Life Sciences, South China Agricultural University, Wushan, Guangzhou, 510642, Guangdong, People’s Republic of China
... Subcellular localization of the rice W2 proteins was predicted in silico using the
programs WoLF PSORT (Hor- ton et al. 2007) (http://www.genscript.com/psort/wolf
psort.html) and ProtComp8.0 (http://linux1.softberry.com/ berry.phtml). ...
Enzyme and Microbial Technology
Volume 49, Issues 6–7, 10 December 2011, Pages 540–546 DOI: 10.1016/j.enzmictec.2011.06.002
Engineered tobacco and microalgae secreting the fungal laccase POXA1b reduce phenol content in olive oil mill wastewater
Zhang et al.,
a Department of Soil, Plant, Environmental and Animal Production Sciences, School of Biotechnological Sciences, University of Naples Federico II, Portici, Italy
b Department of Biological Sciences, University of Naples Federico II, Naples, Italy
... 1 . 2.2. In silico analysis of cellular localisation. The computational prediction of
subcellular localisation of POX A1b in plants was carried out by ProtComp 9.0
(http://www.softberry.com). 2.3. Expression vector construction. The ...
Biologia Plantarum
Volume 55, Issue 4 , pp 625-633 DOI: 10.1007/s10535-011-0160-1
Characterization and expression analysis of the SNF2 family genes in response to phytohormones and abiotic stresses in rice
X. -Y. Li et al.,
1. State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, College of Life Sciences, South China Agricultural University, Wushan, Guangzhou, 510642, P.R. China
... Subcellular localization of the rice SNF2 proteins was predicted in silico using the
programs WOLF PSORT (Horton et al. 2007), ProtComp8.0 (http://linux1.
softberry.com/berry.phtml) and NUCLEO (Hawkins et al. 2007). The ...
African Journal of Microbiology Research
Vol. 5(18), pp. 2590-2595, 16 September, 2011
DOI: 10.5897/AJMR11.133
Cloning and characterization of a female gametophyte-specific gene in Gracilaria lemaneiformis (Gracilariales, Rhodophyte)
Peng Chen 1,4, HongBo Shao 1,2* and Di Xu 3
1The CAS/Shandong Provincial Key Laboratory of Coastal Environmental Processes, Yantai Institute of Costal Zone Research, Chinese Academy of Sciences (CAS),
Yantai 264003, China.
2Institute for Life Sciences, Qingdao University of Science and Technology (QUST), Qingdao 266042, China.
... org/tools/protparam.html). Protein analysis was performed with ProtComp (www.softberry.
com), TMHMM (http://www.cbs.dtu.dk/services/TMHMM-2.0/) and PSORT (http://psort.nibb.
ac.jp/form2.html). RESULTS Screening of the SSH cDNA libraries ...
Plant Physiology and Biochemistry
Volume 49, Issue 9, September 2011, Pages 1064–1070 DOI: 10.1016/j.plaphy.2011.07.010,
Characterization of the sulfurtransferase family from Oryza sativa L
Sebastian Guretzki, Jutta Papenbrock
Institute for Botany, Leibniz University Hannover, Herrenhauserstr. 2, D-30419 Hannover, Germany
... number, the length (aa) and the mass (kDa) for 24 Str in Oryza are summarized [PSORT, WoLF
PSORT, iPSORT, and TargetP (http://www.expasy.org/tools/); MultiLoc and TargetLoc
(http://abi.inf.uni-tuebingen.de/Services/MultiLoc/) ProtComp (http://linux1.softberry.com/berry ...
Reproduction in Domestic Animals
(2011), 46: 980–989. doi: 10.1111/j.1439-0531.2011.01771.x
Molecular Cloning of Sheep and Cashmere Goat Pdia3 and Localization in Sheep Testis.
Lv, L., Ujisguleng, B., Orhontana, B., Lian, W. and Xing, W.
The key laboratory of mammalian reproduction biology and technology of ministry of education, School of Life Sciences, Inner Mongolia University, Hohhot, China
... smart.embl.de/smart/set_mode.cgi?NORMAL=1), InterProScan (http://www.ebi.ac.uk/Tools/pfa/
iprscan/), ExPASy-Compute pI/Mw tool (http://expasy.org/tools/pi_tool.html), ExPASy ScanProsite
(http://expasy.org/tools/scanprosite), ProtComp v. 9.0 (http://linux1.softberry.com/berry ...
PLoS ONE
6(8): e23786. (2011) doi:10.1371/journal.pone.0023786
Identifying Schistosoma japonicum Excretory/Secretory Proteins and Their Interactions with Host Immune System.
Liao et al.,
Department of Parasitology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, People's Republic of China, Key Laboratory for Tropical Diseases Control, Ministry of Education, Sun Yat-sen University, Guangzhou, People's Republic of China, Bioinformatics Research Group, Key Laboratory of Intelligent Information Processing, Institute of Computing Technology, Chinese Academy of Sciences, Beijing, People's Republic of China
...By using the above strategy, the final precision to predict ES proteins was 100% for 8 groups of tested
proteins and the average recall is 81.7%, which is much higher than state-of-art methods: SignalP [12],
SecretomeP [13], Phobius [22] and ProtComp [23] (Table 1). ...
J. Antimicrob. Chemother.
(2011) 66 (1): 79-85.
doi: 10.1093/jac/dkq418
Contribution of CmeG to antibiotic and oxidative stress resistance in Campylobacter jejuni
Byeonghwa Jeon 1,†, Yang Wang 1,2, Haihong Hao 1,3, Yi-Wen Barton 1 and Qijing Zhang 1
1Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, IA, USA
2Department of Pharmacology and Toxicology, College of Veterinary Medicine, China Agricultural University, Beijing, China
...CmeG is predicted to be an inner membrane protein by ProtComp Ver. 3.1 (http://linux1.softberry.com/berry.phtml) (data not shown) and transmembrane domain analysis
(http://www.tcdb.org/progs/hydro.php) showed that CmeG possesses 12 TMs (see sequence
alignment in Figure S1, available as Supplementary data at JAC Online). ...
Functional Plant Biology
38(6) 479-492 http://dx.doi.org/10.1071/FP10246
Analysis of differentially expressed genes in leaf rust infected bread wheat involving seedling resistance gene Lr28
Dhariwal et al.,
A Molecular Biology Laboratory, Department of Genetics and Plant Breeding, Ch. Charan Singh University, Meerut-250004, UP, India.
B Interdisciplinary Centre for Plant Genomics and Department of Plant Molecular Biology, University of Delhi South Campus, New Delhi, India.
... Motif and Prosite pattern identification was carried out using PPSearch program (Prosite Database,
EMBL-EBI). Locations of proteins in tissue were predicted using ProtComp V. 9.0 program
(available at http://www.softberry.com/berry.phtml, accessed 9 June 2009). ...
Genomics and Applied Biology
2011, Vol.2 No.1 doi: 10.5376/gab.2011.02.0001
Cloning of an Ascorbate Peroxidase Gene from Puccinellia tenuiflora and its Expression Analysis
Qingjie Guan 1,2 Lin Li 1 Takano Tetsuo 2 Shenkui Liu 1
1. Alkali Soil Natural Environmental Science Center (ASNESC), Northeast Forestry University, Harbin, 150040; 2. Asian Natural Environment Science
Center (ANESC), The University of Tokyo, Tokyo, 1880002, Japan
... nph) by ProtParam soft. At last, the subcellular localization of PutAPx gene was
analysed and predicted respectively by PSORT and ProtComp Version 611 softwares
(http://www.softberry. Compberry.phtml). 3.6 Congstruction of ...
Plant Physiology and Biochemistry
Volume 49, Issue 7, July 2011, Pages 792–799 DOI: 10.1016/j.plaphy.2011.01.018
Molecular cloning, characterization, and expression of an alfalfa (Medicago sativa L.) heme oxygenase-1 gene, MsHO1, which is pro-oxidants-regulated
Fu et al.,
a College of Life Sciences, Cooperative Demonstration Laboratory of Centrifuge Technique, Nanjing Agricultural University, Nanjing 210095, PR China
b Institute of Botany, Jiangsu Province and the Chinese Academy of Sciences, Jiangsu Province Key Laboratory for Plant Ex-situ Conservation, Nanjing 210014, PR China
... HY1 in Arabidopsis is most likely localized in the plastids [21] and [22]. In this study, MsHO1
protein was predicted to be located in the mitochondrial, endoplasmic reticulum, and
chloroplast by ProComp v9.0 (http:/linux1.softberry.com/berry). ...
Plant Science
Volume 181, Issue 3, September 2011, Pages 242–248 DOI: 10.1016/j.plantsci.2011.05.016,
Cellular localization of dual positional specific maize lipoxygenase-1 in transgenic rice and calcium-mediated membrane association
Cho et al.,
a Department of Molecular Biotechnology and Kumho Life Science Laboratory, College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea
b Department of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, Gwangju 500-757, Republic of Korea
... v.1.03, SignalP 3.0, TargetP 1.1 and SIGFIND 2. However, none of these programs identified
any potential targeting sequence except ProtComp 6.1 which predicted that ZmLOX1 is a
cytoplasmic membrane-bound protein with ProtComp score of 11.1 (http://www.softberry.com/). ...
Journal of Theoretical Biology
Volume 262, Issue 4, 21 February 2010, Pages 750-756
Predict potential drug targets from the ion channel proteins based on SVM
Chen Huang et al.,
a College of Bioinformatics Science and Technology, Harbin Medical University, Harbin 150086, China
b Biomedical Engineering Institute of CUMS, Beijing 100054, China
... In stage 2, we searched for potential ion channel targets based on known ion channel
target protein characteristics. 2. Method. 2.1. Datasets. ... The ProtComp 8.0 program
(ProtComp) was used to predict protein subcellular localization. ...
Molecular Oncology
Volume 4, Issue 6, Pages 496-510 (December 2010)
Cancer secretomics reveal pathophysiological pathways in cancer molecular oncology
George S. Karagiannis ab, Maria P. Pavlou ab, Eleftherios P. Diamandis abc
a Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, Toronto, ON, Canada
b Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada
... Protcomp algorithms (http://www.softberry.com) [Softberry ProtComp 6.0 [http://www.softberry.
com/berry.phtml?topic=protcompan&group=help&subgroup=proloc]], SignalP (http://www.cbs.
dtu.dk/services/SignalP/) ([Bendtsen et al., 2004a] and [Bendtsen et al., 2004b]), web ...
Mol Biol Rep.
2010 Feb;37(2):1081-8.
Molecular analysis of an actin gene, CarACT1, from chickpea (Cicer arietinum L.)
Peng et al.,
State Key Laboratory of Crop Genetics and Germplasm, Enhancement, National Center for Soybean Improvement, Nanjing Agricultural University, 210095 Nanjing, China
... The putative CarACT1 had 377 amino acids with the pre- dicted molecular mass of 41.96 kD
and the isoelectric point of 5.16. Based on the analysis by the Softberry program (ProtComp
v8.0; http://linux1.softberry.com/berry.phtml), CarACT1 was localized in the cytoplasm. ...
BMC Genomics
2010, 11:225doi:10.1186/1471-2164-11-225
Differential transcript expression between the microfilariae of the filarial nematodes, Brugia malayi and B. pahangi
Michael M Kariuki 1, Leonard B Hearne 2 and Brenda T Beerntsen
1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri, Columbia, MO 65211, USA
2 Department of Statistics, College of Arts and Science, University of Missouri, Columbia, MO 65211, USA
... preferentially expressed transcripts were further analyzed by PSORTII [24] and ProtComp
(http://www.softberry.com); two protein algorithm that give more detailed protein localization
predictions. ... localization algorithm, ProtComp, from Softberry Inc (http://www.softberry.com/). ...
Appl. Comput. Math.
V.9, Special Issue, 2010, pp. 19-33
POSSIBLE FUNCTIONAL AND EVOLUTIONARY ROLE OF PLASTID DNA INSERTIONS IN RICE GENOME
YAGUT YU. AKBAROVA 1,2, VICTOR V. SOLOVYEV 3, ILHAM A. SHAHMURADOV 1
1 Bioinformatics Laboratory, Institute of Botany, Baku AZ1073, Azerbaijan
2 College of Medicine and Health Sciences, Sultan Qaboos University, Muscat, Sultanate of Oman
3 Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20, UK
... of amino acid sequences has been carried out by BLAST program [1]. Search for statistically
significant open reading frames (ORFs) and putative target compartments of proteins were done
by BESTORF and ProtComp programs, respectively (http://www.softberry.com). ...
Molecular Biotechnology
2010 Volume 44, Number 1, 30-40, DOI: 10.1007/s12033-009-9202-8
Cloning and Characterization of a Novel NAC Family Gene CarNAC1 from Chickpea (Cicer arietinum L.)
Peng et al.,
... CarNAC1 is a Nuclear Protein Transcription factor always functions in the nuclei, and numerous
NACs have been located in the cell nucleus [3, 4, 20]. In this study, CarNAC1 was predicted to
be located in the nucleus by ProComp v8.0 (http://linux1.softberry.com/ berry). ...
Planta
2010 Volume 231, Number 6, 1425-1437, DOI: 10.1007/s00425-010-1143-8
Comparative molecular and biochemical characterization of segmentally duplicated 9-lipoxygenase genes ZmLOX4 and ZmLOX5 of maize
Yong-Soon Park, Susan Kunze, Xinzhi Ni, Ivo Feussner and Michael V. Kolomiets
(1) Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843-2132, ETATS-UNIS
(2) Department of Plant Biochemistry, Albrecht-von-Haller-Institute for Plant Sciences, Georg-August University, Justus-von-Liebig-Weg 11, 37077 Gottingen, ALLEMAGNE
... Four different pub- licly available programs, including ProtComp (http://linux1. softberry.com),
TargetP (http://www.cbs.dtu.dk/services/ TargetP/), ChloroP (http://www.cbs.dtu.dk/services/
ChloroP/) and WolfPsort (http://wolfpsort.org) were utilized to pre- dict the subcellular ...
Biosci Rep.
2009 Oct 9;30(1):59-71, 1 p following 71
Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress
Daurelio LD, Checa SK, Barrio JM, Ottado J, Orellano EG
Molecular Biology Division, IBR (Instituto de Biologia Molecular y Celular de Rosario), CONICET (Consejo Nacional de Investigaciones Cientificas y Tecnicas), Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina.
... services/SignalP/). Subcellular localization was analysed using ProtComp v6.0
(http://www.softberry.com, Protein location/patterns/Epitops, ProtComp) and TargetP
(http://www.cbs.dtu.dk/services/TargetP/). Transcription and ...
Biochimica et Biophysica Acta (BBA) - Bioenergetics
Volume 1787, Issue 3, March 2009, Pages 135-143
Cyanobacterial cytochrome cM: Probing its role as electron donor for CuA of cytochrome c oxidase
Bernroitner et al.,
aMetalloprotein Research Group, Division of Biochemistry, Department of Chemistry, BOKU – University of Natural Resources and Applied Life Sciences, Muthgasse 18, A-1190 Vienna, Austria
... role as either signal peptide or transmembrane helix several bioinformatic tools were used
(selected organism group: gram negative prokaryotes): (i) SignalP, version 3.0 (http://www.cbs.
dtu.dk/services/SignalP/) [30]; (ii) ProtCompB, version 3 (http://www.softberry.com/berry ...
Biosci Rep.
2009 Oct 9;30(1):59-71, 1 p following 71
Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress
Daurelio LD, Checa SK, Barrio JM, Ottado J, Orellano EG.
Molecular Biology Division, IBR (Instituto de Biologia Molecular y Celular de Rosario), CONICET (Consejo Nacional de Investigaciones Cientificas y Tecnicas), Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina
... Subcellular localization was analysed using ProtComp v6.0 (http://www.softberry.com, Protein
location/patterns/Epitops, ProtComp) and TargetP (http://www.cbs.dtu.dk/services/TargetP/).
Transcription and translation initiation sites were inferred with ProScan ...
Plant Physiology and Biochemistry
Volume 47, Issues 11-12, November-December 2009, Pages 1037-1045
Characterization of a chickpea (Cicer arietinum L.) NAC family gene, CarNAC5, which is both developmentally- and stress-regulated
Hui Peng et al.,
aState Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Nanjing Agricultural University, Nanjing 210095, China
bKey Laboratory of Ecology of Rare and Endangered Species and Environmental Protection, Ministry of Education, Guangxi Normal University, Guilin 541004, China
... View Within Article. 2.4. CarNAC5 is a nuclear protein. Numerous NACs have been located
in the nucleus [5], [6] and [18]. In this study, CarNAC5 protein was predicted to be located
in the nucleus by ProtComp v8.0 (http://linux1.softberry.com/berry). ...
Current Genetics
Volume 55, Number 4 / August 2009 ,pp. 485-496
Functional analysis of an a-1,2-mannosidase from Magnaporthe oryzae
Jie Zhou et al.,
(1) The Ministry of Education Key Laboratory of Biopesticide and Chemical Biology, Fujian Agriculture and Forestry University, 350002 Fuzhou, China
(2) Department of Plant Pathology and Microbiology, Texas A & M University, College Station, TX 77843-2132, USA
... al. 2004), and SignalP 3.0 (http://www.cbs.dtu.dk/services/) (Nielsen et al. 1997) and
Protcomp v8.0 (Softberry.com) were applied to predict its cleavage site and its possible
sub-cellular localiza- tion (Soderlund et al. 2006). The ...
Infection and Immunity
October 2009, p. 4356-4361, Vol. 77, No. 10 doi:10.1128/IAI.00242-09
High-Throughput Identification of New Protective Antigens from a Yersinia pestis Live Vaccine by Enzyme-Linked Immunospot Assay{triangledown}
Bei Li et al.,
Laboratory of Analytical Microbiology, State Key Laboratory of Pathogen and Biosecurity, Institute of Microbiology and Epidemiology, Beijing 100071, China,1 Yunyang Medical College, Shiyan, Hubei Province, China2
... were subjected to computer analysis to identify genes potentially encoding surface-exposed,
membrane-associated proteins by using PSORTb (http://www.psort.org/psortb/), SignalP
(http://www.cbs.dtu.dk/services/SignalP/), and ProtcompB (http://linux1.softberry.com/berry.phtml ...
Plant Physiology Preview
Published on September 16, 2009; 10.1104/pp.109.144766
A Nuclear Factor Regulates Abscisic Acid Responses in Arabidopsis
Min Jung Kim , Ryoung Shin , and Daniel P. Schachtman
Donald Danforth Plant Science Center, St. Louis, MO 63132
... npx1-1 and wild type. NPX1 Is a Nuclear Protein We identified three putative nuclear
localization sequences (NLS; softberry ProtComp6.0 http://www.softberry.com/berry.
phtml?topic=protcompan&group=help& sub group =proloc ...
New Phytologist,
2008 Volume 177 Issue 1, Pages 77 - 89
Transcript profiles of the cytokinin response regulator gene family in Populus imply diverse roles in plant development
Gustavo A. Ramirez-Carvajal, Alison M. Morse and John M. Davis
1 Plant Molecular and Cellular Biology Program, University of Florida, PO Box 110690, Gainesville, FL 32611, USA; 2 School of Forest Resources and Conservation, University of Florida, PO Box 110410, Gainesville, FL 32611, USA
... silico using the software packages TargetP1.1 (http://www.cbs.dtu.dk), WoLF PSORT
(http://www.wolfpsort.seq.cbrc.jp) and ProtComp 6.0 (http://www.softberry.com ...
Current Genetics
Volume 53, Number 4 / April, 2008 Page 217-224
Biochemical and molecular characterization of a putative endoglucanase in Magnaporthe grisea
Jie Zhou et al.,
(1) The Key Laboratory of Biopesticide and Chemistry Biology, Ministry of Education, Fujian Agriculture and Forestry University, 350002 Fuzhou, People’s Republic of China
(2) The School of Life Sciences, Fujian Agriculture and Forestry University, 350002 Fuzhou, People’s Republic of China
(3) Departmant of Plant Pathology and Microbiology, Texas A & M University, College Station, TX 77843-2132, USA
... cbs.dtu.dk/services/), and it was also predicted as being a secretory protein tar-
geted at the extracellular compartment by ProtComp (http:/ /www.softberry.com ...
Planta
Volume 227, Number 2 / January, 2008 Pages 491-503
A novel plastidial lipoxygenase of maize ( Zea mays ) ZmLOX6 encodes for a fatty acid hydroperoxide lyase and is uniquely regulated by phytohormones and pathogen infection
Xiquan Gao, Michael Stumpe, Ivo Feussner and Michael Kolomiets
(1) Department of Plant Pathology and Microbiology, Texas A&M University, 2132 TAMU, College Station, TX 77843-2132, USA
(2) Department of Plant Biochemistry, Albrecht-von-Haller-Institute for Plant Sciences, Georg-August-University Goettingen, Justus-von-Liebig-Weg 11, 37077 Goettingen, Germany
... otherwise. Subcellular localization was predicted using four diVer- ent
programs ProtComp (http://www.softberry.com/berry. phtml ...
Molecular Genetics and Genomics
Volume 279, Number 1 / January 2008 27-39
Identification and characterization of secreted and pathogenesis-related proteins in Ustilago maydis
Olaf Muller, Peter H. Schreier and Joachim F. Uhrig
(1) Max Planck Institute for Plant Breeding Research, Carl-von-Linne' Weg 10, 50829 Koeln, Germany
(2) Present address: Department of Regine Kahmann, Max Planck Institute for Terrestrial Microbiology, 35043 Marburg, Germany
... ProtComp (v. 6.0; http://www.soft- berry.com) analyzes the entire protein sequence ...
neu- ral network, NN, and hidden markov model, HM) and prot- comp (v. 6.0 ...
MPMI
December 2008, Volume 21, Number 12
Pages 1571-1581
Phases of Infection and Gene Expression of Fusarium graminearum During Crown Rot Disease of Wheat
Amber E. Stephens, Donald M. Gardiner, Rosemary G. White, Alan L. Munn, and John M. Manners
1CSIRO Plant Industry, Queensland Bioscience Precinct, 306 Carmody Road, St. Lucia, Brisbane, QLD 4067, Australia; 2The Institute for Molecular Bioscience, The University of Queensland, St Lucia, QLD, 4072, Australia 3CSIRO Plant Industry, PO Box 1600, Canberra ACT 2601, Australia
.. Of these, 19 are predicted to be extracellular secreted proteins (ProtComp 6.0;
Softberry, Inc., Mount Kisco, NY, USA) and most, if not all, probably act as ...
Eukaryotic Cell
February 2008, p. 368-378, Vol. 7, No. 2
A Botrytis cinerea Emopamil Binding Domain Protein, Required for Full Virulence, Belongs to a Eukaryotic Superfamily Which Has Expanded in Euascomycetes
Gioti et al.
UMR1290 BIOGER-CPP, INRA, Route de St-Cyr, 78026 Versailles, France
... 4). BcPIE3 protein was predicted to locate at the endoplasmic reticulum membrane
according to Protcomp version 6.0 software (http://www.softberry.com). ...
PLoS ONE.
2008; 3(6): e2300.
Comparative Genome Analysis of Filamentous Fungi Reveals Gene Family Expansions Associated with Fungal Pathogenesis
Darren M. Soanes et al.,
1School of Biosciences, Geoffrey Pope Building, University of Exeter, Exeter, United Kingdom
2School of Computer Science, University of Manchester, Manchester, United Kingdom
... For example, a similar analysis for M. grisea using SignalP and ProtComp
(www.Softberry.com) predicted only 739 secreted proteins (out of a proteome of 11,109 ...
Insect Biochemistry and Molecular Biology
Volume 38, Issue 2, February 2008, Pages 166-175
Angiotensin-converting enzyme in Spodoptera littoralis: Molecular characterization, expression and activity profile during development
Els Lemeire, Bartel Vanholme, Thomas Van Leeuwen, John Van Camp and Guy Smagghe
Laboratory of Agrozoology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, B-9000 Ghent, Belgium
bResearch Group of Applied Molecular Genetics, Department of Molecular Biotechnology, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium
cResearch Group of Food Chemistry and Human Nutrition, Department of Food Safety and Food Quality, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium
... Server (Nielsen et al., 1997; Bendtsen et al., 2004) and sub-cellular localization
of the protein was predicted by Protcomp 6.0 (http://sun1.softberry.com/berry ...
Experimental Parasitology
,
Volume 117, Issue 2, October 2007, Pages 124-132
Toxocara canis: Molecular cloning, characterization, expression and comparison of the kinetics of cDNA-derived arginine kinase
Susiji Wickramasinghe et al.,
Department of Environmental Health Sciences, Kochi Medical School, Oko, Nankoku City, Kochi 783-8505, Japan
...... i Softberry (http://sun1.softberry.com/cgi-bin/programs/proloc/protcompan.pl). j ...
Trends in Plant Science
,
Volume 12, Issue 6, June 2007, Pages 239-244
The tify family previously known as ZIM
Bartel Vanholme, Wim Grunewald, Alex Bateman, Takayuki Kohchi and Godelieve Gheysen
Faculty of Bioscience Engineering, Department of Molecular Biotechnology, Ghent University, Coupure links 653, B-9000 Ghent, Belgium
2Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK
3Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Japan
...Subcellular
localization as predicted by Protcomp 6.0 from Softberry. d ...
Nature Protocols,
2, 953 - 971 (01 Apr 2007)
Locating proteins in the cell using TargetP, SignalP and related tools
Olof Emanuelsson, SA,ren Brunak, Gunnar von Heijne, Henrik Nielsen
...SignalP 3.0, SignalP 2.0 and TargetP to PrediSi, Phobius and
ProtComp 6.0 (a commercially available program from Softberry Inc.) on a set of exclusively mammalian proteins....
Journal of Biochemistry and Molecular Biology,
Vol. 40, No. 2, March 2007, pp. 247-260
Molecular Cloning of Two Genes Encoding Cinnamate 4-Hydroxylase (C4H)
from Oilseed Rape (Brassica napus)
An-He Chen 1,2,, You-Rong Chai 1,, Jia-Na Li 1,,* and Li Chen 1
1Chongqing Rapeseed Technology Research Center; Chongqing Key Laboratory of Crop Quality Improvement;
Key Lab of Biotechnology & Crop Quality Improvement of Ministry of Agriculture;
College of Agronomy and Life Sciences, Southwest University, Beibei, Chongqing 400716, People’s Republic of China
2College of Bio-Information, Chongqing University of Posts and
Telecommunications, Huang jueya, Nanan Zone, Chongqing 400065, People’s Republic of China
...respectively. Softberry-
ProtComp 6.0 (http://www.softberry. com/berry.phtml) also
definitely predicted them to be ER-membrane bound with scores
of 3.1 and 3.0 respectively...
Journal of Experimental Botany
2006 57(14):3767-3779; doi:10.1093/jxb/erl137
Duplicate maize 13-lipoxygenase genes are differentially regulated by circadian rhythm, cold stress, wounding, pathogen infection, and hormonal treatments
Andriy Nemchenko1, Susan Kunze2, Ivo Feussner2 and Michael Kolomiets1,*
1Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX 77843-2132, USA
2Department of Plant Biochemistry, Albrecht-von-Haller-Institute for Plant Sciences, Georg-August University Gottingen, Justus-von-Liebig-Weg 11, D-37077 Gottingen, Germany
... Subcellular localization was predicted based on the identification of signal peptide
sequences by four different programs ProtComp (www.softberry.com/berry ...
NATURE
444, 97-101 (2 November 2006)
Insights from the genome of the biotrophic fungal plant pathogen Ustilago maydis
Jorg Kamper et al.,
Department of Organismic Interactions, Max Planck Institute for Terrestrial Microbiology, Karl-von-Frisch Strasse, D-35043 Marburg, Germany
...Prediction of secreted proteins. For the prediction of amino-terminal secretion signals,
SignalP 3.0 (ref. 26) was used. A total of 750 proteins were predicted to carry a signal
peptide both by the hidden Markov and the neural network algorithms.
These candidates were analysed with the integral prediction score of
ProtComp 6.0 (http://www.softberry.com), yielding 426 candidate secreted proteins. ...
In Silico Biology
7, 0002 (2006)
In silico analysis of the Lateral Organ Junction (loj) gene
and promoter of Arabidopsis thaliana
Dipnarayan Saha et al.,
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, India
The probable organelle targeting signal sequence was detected using TargetP 1.1
(http://www.cbs.dtu.dk/services/TargetP/) [Emanuelsson et al., 2000], Mitoprot v1.0a4
(http://ihg.gsf.de/ihg/mitoprot.html) [Claros and Vincens, 1996], Predotar v1.03
(http://urgi.infobiogen.fr/predotar/) [Small et al., 2004], ProtComp v6.0
(SoftBerry Inc.) (http://www.softberry.com/) and Plant RNA Binding Protein Database (PlantRBP)
(http://plantrbp.uoregon.edu/advsearch.php).
MPMI (Molecular plant-microbe interactions)
Vol. 19, No. 10, 2006, pp. 1055-1061 DOI: 10.1094/MPMI -19-1055.
TECHNICAL ADVANCE
MGOS: A Resource for Studying
Magnaporthe grisea and Oryza sativa Interactions
Carol Soderlund et al.,
Arizona Genomics Computational Laboratory, Bio5 Institute, University of Arizona, Tucson 85721, U.S.A
Hence, the ESTs and genomic sequence for M. grisea were mined for putatively secreted proteins using SignalP (Bendtsen
et al. 2004) to identify those containing likely signal sequence cleavage sites and PROTCOMP, available from Softberry, to predict cellular localization of the putative proteins, which resulted in 739 proteins.
Molecular Biology Reports
33 (2006), 4, 279-285
GmZFP1 encoding a single zinc finger protein is expressed with enhancement
in reproductive organs and late seed development in soybean (Glycine max)
Fang Huang, Yingjun Chi, Qingchang Meng, Junyi Gai and Deyue Yu
National Center for Soybean Improvement, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China
... the ProtComp program (http://. www.softberry.com) still
predicted that GmZFP1 pro- ..
Nucleic Acids Research
2006, Vol. 34, No. 17 4685-4701 doi:10.1093/nar/gkl588
Organization of chromosome ends in the rice blast
fungus, Magnaporthe oryzae
Cathryn Rehmeyer et al.,
Department of Plant Pathology and 2Department of Biology, University of Kentucky, Lexington,
KY 40546 USA
Cellular localization prediction for secreted proteins was
performed with ProtComp version 6.0 for animal and fungi (www.softberry.com).
GENES & DEVELOPMENT
(2006) 20:1365-1377
The chicken talpid3 gene encodes a novel protein essential for Hedgehog signaling
Megan G. Davey et al.,
Division of Cell and Developmental Biology, Wellcome Trust Biocentre (WTB), University of Dundee, Dundee DD1 5EH,
United Kingdom
Using the program ProtComp, the KIAA0586 protein was predicted to be cytoplasmic.
DNA Sequence - The Journal of Sequencing and Mapping
Volume 17, Number 1 / February 2006 pp. 41 - 48
Molecular cloning and characterization of a rice blast-inducible RING-H2 type Zinc finger gene
Xiang-Bing Meng, Wen-Sheng Zhao, Rui-Ming Lin, Min Wang, You-Liang Peng
China Agricultural University, Department of Plant Pathology, Beijing, 100094, People's Republic of China
... were identified in putative OsRING-1 protein. The ProtComp program
(http://softberry. com) a putative nuclear localization motif ...
Journal of Lipid Research
, Vol. 47, 268-283, February 2006
Further characterization of mammalian ceramide kinase: substrate delivery and (stereo)specificity, tissue distribution, and subcellular localization studies
Helena Van Overloop, Sofie Gijsbers, and Paul P. Van Veldhoven
Katholieke Universiteit Leuven, Faculteit Geneeskunde, Departement Moleculaire Celbiologie, Afdeling Farmacologie, Leuven, Belgium
... as predicted by different algorithms [SignalP 3.0 (54), http://www.cbs.dtu.dk/services/
SignalP/#submission; ProtComp 6.0, http://sun1.softberry.com/berry.phtml ...
Microbiology
152 (2006), 547-554
MfLIP1, a gene encoding an extracellular lipase of the lipid-dependent fungus Malassezia furfur
Sascha Brunke and Bernhard Hube
Robert Koch-Institut, Nordufer 20, D-13353, Berlin, Germany
... 2.0 algorithm (Krogh et al., 2001 ) and TargetP 1.1 (Emanuelsson et al., 2000 )
at the CBS prediction server, or with ProtComp 6.0 at www.softberry.com, with ...
Genes and Immunity,
2005, 6, 319–331. doi:10.1038/sj.gene.6364173
Immune response in silico(IRIS): immune-specific genes identified from a compendium of microarray ...
AR Abbas, D Baldwin, Y Ma, W Ouyang, A Gurney, F ...
Department of Bioinformatics, Genentech, Inc., South San Francisco, CA, USA
... The ProtCompalgorithm (Softberry, Inc.) predicts for the 1589 IRIS genes with ORFs
that 24% of the encoded proteins are in the plasma membrane, 13% are ...
Plant Molecular Biology
Volume 59, Number 2 / September, 2005, pp. 323-343
Genomic Analysis of the 12-oxo-phytodienoic Acid Reductase Gene Family of Zea mays
Zhang et al.,
1) Department of Plant Pathology and Microbiology, Department of Plant Pathology, Texas A&M University, 2132 TAMU, College Station, Texas 77843-2132, USA
(2) Pioneer Hi-Bred International, Inc., 7250 NW 62nd Ave., Johnston, Iowa 50131-0552, USA
... nibb. ac.jp/), TargetP (http://www.cbs.dtu.dk/services/ TargetP/) and ProtComp
(http://www.softberry. com/berry.phtml). Transcription ...
BMC Bioinformatics
2005, 6:256doi:10.1186/1471-2105-6-256
Evaluating eukaryotic secreted protein prediction
Eric W Klee and Lynda BM Ellis
Department of Laboratory Medicine and Pathology, University of Minnesota, Mayo Mail Code 609, 420 SE Delaware Street, Minneapolis, MN 55455, USA
... ProtComp 6.0, from Softberry, Inc., predicts protein localization, including
extracellular proteins, using a combination of neural networks and sequence ...
Genetics and Molecular Biology
28, 3 (suppl), 529-538 (2005)
Multigene families encode the major enzymes of antioxidant metabolism in
Eucalyptus grandis L
Felipe Karam Teixeira, Larissa Menezes-Benavente, Vinícius Costa Galvão and Marcia Margis-Pinheiro
Universidade Federal do Rio de Janeiro, Departamento de Genética, Laboratório de
Genética Molecular Vegetal, Rio de Janeiro, RJ, Brazil.
.. Protein sorting and subcellular localization predictions were performed according to ProtComp program
Version 5 (http://www.softberry.com/) ...
MPMI
Vol. 17, No. 7, 2004, pp. 789-797. Publication no. M-2004-0426-01R. © 2004 The American Phytopathological Society
Lotus japonicus LjKUP Is Induced Late During Nodule Development and Encodes a
Potassium Transporter of the Plasma Membrane
Guilhem Desbrosses, Claudia Kopka, Thomas Ott, and Michael K. Udvardi
Max Planck Institute of Molecular Plant Physiology, Am Muhlenberg 1, 14476 Golm, Germany
...Both PSORT and ProtComppredicted a PM location for LjKUP...
Planta
Issue: Volume 218, Number 6 Date: April 2004 Pages: 965 - 975
Biochemical and immunological characterization of pea nuclear intermediate filament proteins
Sonal S. D. Blumenthal1, Gregory B. Clark1 and Stanley J. Roux1
(1) School of Biological Sciences, Section of Molecular Cell and Developmental Biology, The University of Texas, Austin, TX 78712, USA
Stanley J. Roux Email: sroux@uts.cc.utexas.edu
... html), BCM Search Launcher (Protein structure prediction, http:// searchlauncher.
bcm.tmc.edu/), SoftBerry (Protein subcellular. localization ...
Comparative and Functional Genomics
Volume 5, Issue 4 , Pages 342 - 353
Published Online: 20 May 2004
Research Paper
Investigation into the use of C- and N-terminal GFP fusion proteins for subcellular localization studies using reverse transfection microarrays
Ella Palmer, Tom Freeman *
MRC Rosalind Franklin Centre for Genomics Research (formerly the HGMP-Resource Centre), Genome Campus, Hinxton, Cambridge CB10 1SB, UK
... ProtCompversion 4 (Softberry) combines results with proteins of known subcellular
localization and assumed subcellular localization (based on theoret- ical ...
Plant Physiol.
2004; 134: 286-295.
RHM2 Is Involved in Mucilage Pectin Synthesis and Is Required for the Development...
Usadel et al.
... Tentative subcellular localization prediction by TargetP (Emanuelsson et al., 2000 ) or ProtComp (http://www.softberry.com), a prediction software trained on ...
Journal of Cellular Biochemistry
Volume 90, Issue 2 , Pages 361 - 378
Published Online: 3 Sep 2003
A proteomic study of the arabidopsis nuclear matrix
Tomasz T. Calikowski 1 3, Tea Meulia 2, Iris Meier 1 *
1Department of Plant Biology and Plant Biotechnology Center, Ohio State University, Columbus, Ohio 43210
... For prediction of subcellular localization, ProtComp4 (Softberry, Inc., Mount Kisco,
NY; http://www.softberry.com/berry.phtml?topic? proteinloc), PSORT v.6.4 ...
International Journal for Parasitology
Volume 33, Issue 11, 30 September 2003, Pages 1195-1206
Trehalose metabolism genes in Caenorhabditis elegans and filarial nematodes
Pellerone et al.,
a School of Biochemistry & Molecular Biology, Faculty of Science, Australian National University, Canberra, ACT 0200, Australia
... potential GPI anchors, membrane-spanning regions, signal peptides and predicted
subcellular localisation using ProtComp ver.5 at http://www.softberry.com/berry ...
The Journal of Neuroscience
August 13, 2003, 23(19):7415-7425
Freud-1: A Neuronal Calcium-Regulated Repressor of the 5-HT1A Receptor Gene
Xiao-Ming Ou et al.,
Ottawa Health Research Institute, Neuroscience, University of Ottawa, Ottawa, Ontario, Canada K1H-8M5
... a consensus nuclear localization signal was not identified, Freud-1 localization
is predicted to be nuclear (ProtComp program; http://www.softberry.com/berry ...
Cellular Molecular Life Sciences,
2003, in press
Automatic prediction of protein function
Burkhard Rost 1, 2, 3, *, Jinfeng Liu 1, 3, 4, Rajesh Nair 1, 5, Kazimierz O. Wrzeszczynski 1 and Yanay Ofran 1,6
1 CUBIC, Dept. of Biochemistry and Molecular Biophysics, Columbia University, 650 West 168th Street BB217, New York, NY 10032, USA
... genome/localize/. ProtComp, predict localization for plants, http://www.softberry.com/berry.phtml?topic=proteinloc. Predotar, predict ...
Genome Research
13:2265-2270, 2003
The Secreted Protein Discovery Initiative (SPDI), a Large-Scale Effort to Identify
Novel Human Secreted and Transmembrane Proteins: A Bioinformatics Assessment
Hilary F. Clark1, et al.
Departments of Bioinformatics, Molecular Biology and Protein Chemistry, Genentech, Inc., South San Francisco, California 94080, USA
An automated computational strategy was utilized to query each protein translation with the Signal Sensor, Sighmm, Tmdetect (T. Wu, unpubl.), hmmpfam (Eddy 1998 ), and ProtComp (Softberry, Inc.) algorithms.
...The ProtCompalgorithm predicts the subcellular localization of a protein, on the basis of homology to well-annotated proteins, a neural net, and various protein motifs.
.. In this case, the ProtCompsubcellular localization prediction was used to categorize these genes as "Other Secreted", "Other Transmembrane", or "Other Cytoplasmic or Nuclear".
Plant Physiol,
February 2002, Vol. 128, pp. 336-340
Gene prediction in eukaryota
Samuel P. Hazen, John S. Scott-Craig, and Jonathan D. Walton*
Department of Energy-Plant Research Laboratory, Michigan State University, East Lansing, Michigan 48824
... genome/localize/. ProtComp, predict localization for plants, http://www. softberry.com/berry.phtml?topic=proteinloc. Predotar, predict ...
Proc Natl Acad Sci U S A.
2001 April 24; 98(9): 5341-5346.
The Cia5 gene controls formation of the carbon concentrating mechanism in Chlamydomonas reinhardtii
Youbin Xiang, Jun Zhang, and Donald P. Weeks*
Department of Biochemistry and School of Biological Sciences, University of Nebraska, Lincoln, NE 68588-0664
...Computer-assisted analysis of the CIA5 aa sequence (PROTCOMP, version 4, http://www.softberry.com) predicted a nuclear localization of the protein.
...Finally, computer program predictions (e.g., PROTCOMP version 4, http://www.softberry.com) for a nuclear localization of CIA5 and the clear-cut nuclear localization of CIA5 in onion epidermal cells (Fig. 3) provide additional weight to the argument that CIA5 may be a transcription factor.
strong>
Gene
2001 Dec 12;280(1-2):175-81.
A novel serine/threonine kinase gene, STK33, on human chromosome 11p15.3.
Mujica AO, Hankeln T, Schmidt ER.
Institut fur Molekulargenetik, Gentechnologische Sicherheitsforschung und Beratung, Johannes Gutenberg Universitat Mainz, J.J. Becherweg 32, D-55099 Mainz, Germany.
... localization prediction was performed with PSORT II (Nakai and Horton, 1999), SubLoc (
Hua and Sun, 2001) and ProtComp (http://www.softberry.com/protein.html). ...
PSITE
DNA and Cell Biology
2016 doi: 10.1089/dna.2015.3033
Focal Adhesion Kinase Directly Interacts with TSC2 Through its FAT Domain and Regulates Cell Proliferation in Cashmere Goat Fetal Fibroblasts.
Zheng, X. et al.,
1College of Life Sciences, Inner Mongolia University, Hohhot, People's Republic of China.
2Hulunbeier Municipal people's Hospital, Hailaer, People's Republic of China.
3Department of Oncology, Kailuan General Hospital, Tangshan, People's Republic of Chian.
... Protein prosite
pattern analysis was identified by the Psite program (www.softberry.com). ...
Fish physiology and biochemistry
2016, 1-14. DOI: 10.1007/s10695-016-0238-y
Characterization, promoter analysis and expression of the interleukin-6 gene in blunt snout bream, Megalobrama amblycephala
Fu, X. et al.,
College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of Ministry of Education, Huazhong Agricultural UniversityFreshwater Aquaculture Collaborative Innovation Center of Hubei Province
... Posttranslational modifications were analyzed using SoftBerry-Psite (http://?linux1.?softberry.
?com/?berry.?phtml??topic=?psite&?group=?programs&?subgroup=?proloc) and
Motif-Scan (http://?myhits.?isb-sib.?ch/?cgi-bin/?motif_?scan). ...
Asian-Australasian Journal of Animal Sciences (AJAS)
2013; 26(8): 1057-1064. DOI:10.5713/ajas.2012.12710
Molecular Characterization and Expression Analysis of S6K1 in Cashmere Goats (Capra hircus)
Manlin et al.,
College of Life Science, Inner Mongolia University, Hohhot, 010021, China
.... Protein domains were analyzed using the SMART program (http://smart.embl-heidelberg.
de/). Protein prosite patterns were identified using Psite (http://www.softberry.com). ... All sites
were determined using Psite (http://www.softberry.com). Figure 2. ...
Asian-Australasian Journal of Animal Sciences (AJAS)
2013; 26(11): 1644-1650.
DOI: http://dx.doi.org/10.5713/ajas.2013.13157
Molecular Characterization and Expression Analysis of Ribosomal Protein S6 Gene in the Cashmere Goat (Capra hircus)
Wenlei et al.,
College of Life Science, Inner Mongolia University, Hohhot 010021, China
... isoelectric.ovh.org/. Protein domain analysis was identified by the SMART program
(http://smart.embl-heidelberg.de/). Protein prosite patterns analysis were identified
by the Psite program (http://www.softberry.com). The model of ...
Asian-Aust. J. Anim. Sci.
Vol. 25, No. 5 : 606 - 612
May 2012 http://dx.doi.org/10.5713/ajas.2011.11290
Molecular Characterization and Expression Pattern of Gene IGFBP-5 in the Cashmere Goat (Capra hircus)
X. J. Wang 1, a et al.,
1 College of Life Science, Inner Mongolia University,
The Key Laboratory of Mammal Reproductive Biology and Biotechnology,
Ministry of Education, Hohhot 010021, China
... Protein prosite patterns were identified by the Psite program (http://www.softberry.com).
A phylogenetic tree was constructed by using the MEGA 4.1 program. RESULTS ... All these
were determined using the Psite program (http://www.softberry.com). ...
Asian-Aust. J. Anim. Sci.
June 2012 Vol. 25, No. 6 : 758 - 763 http://dx.doi.org/10.5713/ajas.2011.11398
Molecular Characterization and Tissue-specific Expression of
a Novel FKBP38 Gene in the Cashmere Goat (Capra hircus)
X. Zheng et al.,
1 College of Life Science, Inner Mongolia University,
The Key Laboratory of Mammal Reproductive Biology and Biotechnology,
Ministry of Education, Hohhot 010021, China
... Protein prosite patterns analysis was identified by the Psite program (http://www.softberry.com).
The bands on gel were analyzed by Carestream MI software Page 3. Zheng et al. (2012)
Asian-Aust. ... All these were determined using the Psite software (http://www.softberry.com). ...
DNA Cell Biol.
2012 May;31(5):839-44. Epub 2011 Dec 16.
Molecular characterization and functional analysis of Cashmere goat mammalian target of rapamycin
Liang Y et al.,
College of Life Science, Inner Mongolia University , The Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot, People's Republic of China
... Based on the amino-acid sequence of mTOR, the active sites and domains were
predicted using Psite (www.softberry.com) and InterProScan (www.ebi.ac.uk),
respectively. ... All sites were determined using Psite (www.softberry.com). ...
Agricultural Sciences in China
Volume 10, Issue 9, September 2011, Pages 1452–1458 DOI: 10.1016/S1671-2927(11)60138-7
Molecular Characterization and Expression Pattern of Rheb Gene in Inner Mongolia Cashmere Goat (Capra hircus)
Xu ZHENG et al.,
College of Life Science, Inner Mongolia University/Key Laboratory of Mammal Reproductive Biology and Biotechnology, Ministry of Education, Hohhot 010021, P.R. China
... embl-heidelberg.de/) and NCBI CDD program (http:// www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.
cgi). Pro- tein prosite patterns analysis were identified by the Psite program (http://www.softberry.
com). ... softberry.com). 1456 ZHENG Xu et al. 2011, CAAS. All rights reserved. ...
Plant Pathology
57(1):92-102, February 2008.
A role for oxidative stress in the Citrus limon/Phoma tracheiphila interaction.
Reverberi, M et al.,
... NSite and cellular localization predictions were performed by the software
PSITE (© Softberry, Inc. 2000-2005). Statistics TOP. ...
CTL epitope-Finder
Advanced Materials Research
2013, 647, 304-309 DOI: 10.4028/www.scientific.net/AMR.647.304
Bioinformatics Analysis of OmpA/MotB Protein Encoded by OmpA/MotB Gene(ORF 648bp) of Riemerella anatipestifer
Xu Pan et al.,
... Predicting AntigenicPeptides[17] (http://www.cbs.dtu.dk/services/BepiPred/),
ProtScal[18] (http://www.expasy.org/cgi-bin/protscale.pl), CTL epitope-Finder 1.1
(http://linux1.softberry.com/berry.phtml), PSORTb (http://www.psort.org/psortb/), ...
FPROM
Fish physiology and biochemistry
2016, 1-20. DOI 10.1007/s10695-016-0199-1
Identification and characterization of kiss2 and kissr2 homologs in Paralichthys olivaceus
Song, H. et al.,
1. Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, 266003, People’s Republic of China
... The transcription start sites (TSSs) were predicted using Softberry (http://?linux1.?softberry.?
com/?berry.?phtml??topic=?fprom&?group=?programs&?subgroup=?promoter), and
transcription factor binding sites were analyzed with the help of TFSEARCH (http://?www.?cbrc ...
General and comparative endocrinology
2015, 214, 114-125. doi:10.1016/j.ygcen.2014.06.010
Characterisation of kisspeptin system genes in an ovoviviparous teleost: Sebastes schlegeli
Song, H. et al.,
Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao 266003, PR China
... The tool of Promoter Scan (http://www-bimas.cit.nih.gov/molbio/proscan/), Softberry
(http://linux1.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter),
and NNPP (http://www.fruitfly.org/seq_tools/promoter.html) were used to predict the transcription .
Scientific Reports
2015, 5, Article number: 14093 doi:10.1038/srep14093
Living without DAT: Loss and compensation of the dopamine transporter gene in sauropsids (birds and reptiles)
P. V. Lovell, B. Kasimi, J. Carleton, T. A. Velho & C. V. Mello
Department of Behavioral Neuroscience; Oregon Health & Science University; Portland, OR 97239-3098; USA
Department of Biology; Portland State University; Portland, OR 97207-0751; USA
... In some cases we were able to refine, or computationally validate the location of the TSS by
scanning each promoter region with algorithms available through Softberry (http://linux1.softberry.
om/berry.phtml) that predict TSSs based on the position of TATA or non-TATA promoter sequences (FPROM41), or the location of CpG-rich islands (CpGFinder). ...
International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573
The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53
Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China
... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools:
NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp.
duke.edu/generegulation/McPromoterMMII/), and Softberry programs
FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...
Scientia Horticulturae
Volume 154, 2 May 2013, Pages 96–101 DOI: 10.1016/j.scienta.2013.02.009
The intron from the 5?-UTR of the FBP11 gene in petunia displays promoter- and enhancer-like functions
Liao Liao 1, Guogui Ning 1, Caixian Liu, Wei Zhang, Manzhu Bao
Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, PR China
... 2.2. Sequence analysis. To predict the components of the FBP11 gene promoter and the first
intron in the 5?-UTR, the sequence was analyzed using SoftBerry FPROM programs, available
on the Softberry website (http://www.softberry.com) (Jens et al., 2008). ...
PloS one
September 12, 2013 DOI: 10.1371/journal.pone.0073920
Ets-2 Regulates Cell Apoptosis via the Akt Pathway, through the Regulation of Urothelial Cancer Associated 1, a Long Non-Coding RNA, in Bladder Cancer Cells
Wenjing Wu, Shuwan Zhang, Xu Li, Mei Xue, Sancheng Cao, Wei Chen
Clinical Laboratory, the First Affiliated Hospital, School of Medicine, Xi’an Jiaotong University, Xi’an, China
School of Medicine, Xi’an Jiaotong University, Xi’an, China, Clinical Laboratory, Xi’an Children’s Hospital, Xi’an, China
... The promoter and TSS predict tools include the FPROM program from Softberry software
(http://linux1.softberry.com/berry.phtml??topic=fprom&group=programs&subgroup=prom?oter)
and PromoterInspector program from genomatix (http://www.genomatix.de/online_help/help ...
Breast Cancer Research and Treatment
Volume 137, Issue 2 , pp 383-396 DOI:10.1007/s10549-012-2353-5
Vimentin DNA methylation predicts survival in breast cancer
Ulirsch et al.,
4. The University of North Carolina at Chapel Hill School of Nursing, Lab 013, Carrington Hall, CB #7460, Chapel Hill, NC, 27599-7460, USA
2. Lineberger Comprehensive Cancer Center, University of North Carolina, 450 West Drive, Chapel Hill, 27599, USA
... We first custom designed the primers for an amplicon that included the core Vimentin
promoter (Fig. 1), as predicted by http://linux1.softberry.com/berry.phtml?topic=fprom&
group=programs&subgroup=promoter and http://www.cbs. ...
Hum. Mol. Genet.
(2013) doi: 10.1093/hmg/ddt116
Meta-Analysis of Genome-wide Association Studies in 5 cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error
Stambolian et al.,
1Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, USA
2Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health and National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, USA
... Promoter/enhancer prediction tools used included FPROM from Softberry (http://linux1.softberry.
com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), FirstEF from Cold Spring
Harbor Laboratory (http://rulai.cshl.org/tools/FirstEF/), Promoter 2.0 ...
Matrix Biology
Volume 31, Issues 7–8, September–October 2012, Pages 412–420 DOI: 10.1016/j.matbio.2012.08.002
Quantification of type II procollagen splice forms using alternative transcript-qPCR (AT-qPCR)
McAlinden et al.,
a Department of Orthopaedic Surgery, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States
b Department of Cell Biology and Physiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States
... Analysis of the Col2a1 gene for alternative promoter sequences with FPROM (http://linux1.softberry.
com/berry.phtml) revealed 12 potential alternative promoter sites, including a TATA box
(TATAAAGA) within exon 2, which could also contribute to transcript diversity. ...
BMC Evolutionary Biology
2012, 12:125
http://www.biomedcentral.com/1471-2148/12/125
Molecular evolution of a-kinase anchoring protein
(AKAP)-7: implications in comparative
PKA compartmentalization
Keven R Johnson 1 , Jessie Nicodemus-Johnson 2, Graeme K Carnegie 3 and Robert S Danziger1,4,5
1 Department of Medicine, University of Illinois at Chicago, Chicago, IL, USA
4 Jesse Brown VA Medical Center, Chicago, IL, USA
... To determine AKAP7 splice variant exon positions and gene structures, the AKAP7 genes of
human, rat, dog, opossum, zebrafish, lamprey, and ciona were analyzed using GENESCAN
[58] and Promoter 2.0 Prediction Server [59] FPROM (Softberry, Inc., Mt Kisco, NY) programs ...
Stem Cells Trans Med March
2012 vol. 1 no. 3 188-199 doi: 10.5966/sctm.2011-0005
Human Muller Glia with Stem Cell Characteristics Differentiate into Retinal Ganglion Cell (RGC) Precursors In Vitro and Partially Restore RGC Function In Vivo Following Transplantation
Shweta Singhal et al.,
Divisions of aOcular Biology and Therapeutics and
bVisual Neurosciences, NIHR BRC University College London Institute of Ophthalmology and Moorfields Eye Hospital, London, United Kingdom
.. species in this region were used to ascribe a 1.6-kb sequence upstream of the coding region
as a putative promoter region for the gene (supplemental online Table 1). This sequence was
then analyzed using the FPROM Human promoter prediction software (Softberry, Inc., Mt. ...
Gene Expression Patterns
Volume 11, Issues 1–2, January–February 2011, Pages 118–121 DOI: 10.1016/j.gep.2010.10.002,
Transgenic labeling of the zebrafish pronephric duct and tubules using a promoter from the enpep gene
Christoph Seiler a, Michael Pack a, b,
a Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA
b Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA, USA
... We used the softberry FPROM program (http://softberry.com) to identify possible transcription
start sites. ... For promotor prediction we used softberry fprom (http://www.softberry.com/berry.
phtml?topic = fprom&group = programs&subgroup = promoter). ...
Gene
Volume 492, Issue 1, 15 January 2012, Pages 148–159 DOI: 10.1016/j.gene.2011.10.034
Identification and functional characterization of the human EXT1 promoter region
Jennes et al.,
a Department of Medical Genetics, University of Antwerp, Belgium
b Department of Medical Genetics and Skeletal Rare Diseases, Rizzoli Orthopedic Institute, Bologna, Italy
... In silico analysis of the 10 kb upstream region of the EXT1 start codon (region [-10,000_- 1])
(transcript NM_000127.2) was performed with several promoter prediction programs using different
algorithms: BDGP (http://www.fruitfly.org/), FPROM (http://softberry.com/), Promoter ...
Archives of Virology
Volume 156, Issue 6 , pp 1097-1100 DOI: 10.1007/s00705-011-0971-6
Discovery of a genome of a distant relative of chicken anemia virus reveals a new member of the genus Gyrovirus
Rijsewijk et al.,
1. Virology Laboratory, Microbiology Department, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul (UFRGS), Av. Sarmento Leite 500, Porto Alegre, Rio Grande do Sul (RS), CEP 90050-170, Brazil
2. Institute for Veterinary Research “Desiderio Finamor” (IPVDF), Estrada do Conde 6000, Eldorado do Sul, Rio Grande do Sul (RS), CEP 92990-000, Brazil
... Cold Spring Harbour Laboratory Press, New York 18. Schat KA (2009) Chicken anemia virus.
Curr Top Microbiol Immunol 331:151–183 19. SoftBerry FPROM program. http://www.softberry.
ru/berry.phtml? group=programs&subgroup=promoter&topic=fprom 20. ...
Archiv Tierzucht
54 (2011) 4, 430-438, ISSN 0003-9438
Polymorphic sites in the 5?-region of the porcine C8A gene
D? Vo Anh Khoa 1,2, Siriluck Ponsuksili 1 , Eduard Murani 1 and Klaus Wimmers 1
1 Research Unit »Molecular Biology« Leibniz Institute for Farm Animals Biology (FBN), Dummerstorf, Germany,
2 Department of Animal Sciences, College of Agriculture and Applied Biology, Cantho University, Cantho City, Vietnam
... In silico analysis software The Neural Network Promoter Prediction http://www.fruitfly.org/
seq_ tools/promoter.html and the FPROM software http://www.softberry.com were used to
identify the transcription start site (TSS) and TATA-box, respectively. ...
BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51
Identification of a novel temperature sensitive promoter in cho cells
Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria
2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria
... Computational analysis of this region was performed using several freely available online
prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/
berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...
Journal of Virology
December 2009, p. 12769-12778, Vol. 83, No. 24
The 5' Leader of the mRNA Encoding the Marek's Disease Virus Serotype 1 pp14 Protein Contains an Intronic Internal Ribosome Entry Site with Allosteric Properties
Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, United Kingdom,1 Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037
... Promoter prediction and validation. We used different web-based programs for promoter
predictions. These included the FPROM program (Softberry, Inc., Mt. Kisco, NY) and the Neural
Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...
J. Virol.
2009 doi:10.1128/JVI.01010-09
The 5' Leader of the mRNA encoding the MDV-1 pp14 protein contains an intronic IRES with allosteric properties
Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, UK; Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037, USA
... Promoter prediction and validation. We have used different web-based programs for promoter
predictions. 20 These included the FPROM program (http://www.softberry.ru/berry) and the Neural
Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...
Molecular Biotechnology
Volume 39, Number 2 / June 2008 pp. 135-139
Identification of CHO Endogenous Promoter Elements Based on a Genomic Library Approach
Jens Pontiller, Stefan Gross, Haruthai Thaisuchat, Friedemann Hesse and Wolfgang Ernst
... http://www. softberry.co m/berry.pht ml?topic=fprom&group =programs &subgroup
=promoter http://www .softberry. ... http://www .softberry. ...
Entomological Research
2008 Volume 38 Issue 1, Pages 77 - 86
On page(s): 50-53
Differential expression profile of genes encoded in a genome segment of Cotesia plutellae bracovirus in a parasitized host, Plutella xylostella
Wael GAD, Jae Young CHOI, Yeon Ho JE and Yonggyun KIM
1 Department of Bioresource Sciences, Andong National University, Andong, Korea
2 School of Agricultural Biotechnology, Seoul National University, Seoul, Korea
... Promoter components were predicted using SoftBerry fprom (http://softberry.com/berry.
phtml?topic=fpromgroup=helpsubgroup=promoter). Southern hybridization. ...
Bioinformatics and Biomedical Engineering, 2008. ICBBE 2008. The 2nd International Conference
Publication Date: 16-18 May 2008
On page(s): 50-53
Sequence Analysis in Vicinity of Type 2 Diabetes Related SNP rs7903146
Jiao Chuan-zhen et al.,
... C. Promoter predication and transcription binding sites identification The FPROM
program for Human promoter prediction on http://www.softberry.com server was ...
BMC Genomics
2007, 8:374doi:10.1186/1471-2164-8-374
MetaProm: a neural network based meta-predictor for alternative human promoter prediction
Junwen Wang, Lyle H Ungar, Hung Tseng and Sridhar Hannenhalli
Center for Bioinformatics, University of Pennsylvania, Philadelphia, PA 19104, USA
Department of Genetics, University of Pennsylvania, Philadelphia, PA 19104, USA
... In this paper, we evaluate the performances of current major promoter prediction programs (i.e., PSPA, FirstEF, McPromoter, DragonGSF,
DragonPF, and FProm) using 42,536 distinct human gene promoters on a genome-wide scale, and with emphasis on alternative promoters.
...
FProm: Human Promoter Prediction.
[http://www.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter.]
...
Genome Biology
2006, 7(Suppl 1):S10
Automatic annotation of eukaryotic genes, pseudogenes and promoters
Victor Solovyev, Peter Kosarev, Igor Seledsov and Denis Vorobyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Softberry Inc., Radio Circle, Mount Kisco, NY10549, USA
... The Fprom promoter prediction program identifies 80% of TATA promoters sequences with one false
positive prediction per 2,000 base-pairs (bp) and 50% of TATA-less promoters with one false positive prediction per 650 bp. ...
Genome Biology
2006, 7(Suppl 1):S3
Performance assessment of promoter predictions on ENCODE regions in the EGASP experimen
Bajic et al.,
South African National Bioinformatics Institute (SANBI), University of the Western Cape, Bellville 7535, South Africa
... threshold of +0.005. The program can be found at [45]. Fprom: Softberry
Pol-II promoter recognition approach. The task of finding ...
CpGFinder
Molecular Ecology
(2016) 25, 1801–1811 doi: 10.1111/mec.13519
Evidence from pyrosequencing indicates that natural variation in animal personality is associated with DRD4 DNA methylation
Verhulst, E. C. et al.,
*Department of Animal Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Droevendaalsesteeg 10, 6708 PB,
Wageningen, The Netherlands, †Department of Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW),
Droevendaalsesteeg 10, 6708 PB, Wageningen, The Netherlands
... A CGI motif was searched in the DRD4 genomic region (GenBank accession DQ006802)
using CpGFinder (Softberry, USA) with the base pair numbering set to 1 on the transcription
start site. ... 2016). This indirectly supports the interpretation that ...
Gene
2014, 544(2), 165-176. DOI: 10.1016/j.gene.2014.04.062
Identification and characterization of a Sox2 homolog in the Japanese flounder Paralichthys olivaceus
Gao J. et al.,
a College of Marine Life Science, Ocean University of China, Key Laboratory of Marine Genetics and Breeding, Ministry of Education, 5 Yushan Road, Qingdao 266003, China
b College of Marine Life Science, Ocean University of China, Laboratory of Biochemistry and Biomaterials, 5 Yushan Road, Qingdao 266003, China
... The presence of a CpG-rich region within the upstream region was analyzed using the
Softberry CpGFinder program (http://linux1.softberry.com/berry.phtml?topic=
cpgfinder&group=programs&subgroup=promoter). 2.5. Bisulfite sequencing. ...
Cellular and molecular neurobiology
2014, 34(5), 715-725. DOI:10.1007/s10571-014-0053-x
Identification, Cloning, and Functional Analysis of the TATA-Less Mouse FNDC5 Promoter During Neural Differentiation
Seifi T. et al.,
1. Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran
5. Department of Biology, Payame Noor University, P.O. Box 19395-4697, Tehran, Iran
2. Department of Cellular Biotechnology at Cell Science Research Center, ACECR, Royan Institute for Biotechnology, 816513-1378, Isfahan, Iran
... www.genomatix.de) (Sobocki et al. 2007). CG content was predicted and calculated
by CpG Island finder (http://linux1.softberry.com), CpG plot (http://www.
ebi.ac.uk/Tools/emboss/cpgplot). Approximately, 2 9 104 bp upstream ...
Biochemical and Biophysical Research Communications
Volume 438, Issue 1, 16 August 2013, Pages 54–60 DOI:10.1016/j.bbrc.2013.07.023
Differential DNA methylation patterns in the CD86 gene controls its constitutive expression in keratinocytes
M.A. Romero-Tlalolini, P. Chavez Olmos, Efrain Garrido
Department of Genetics and Molecular Biology, CINVESTAV-IPN, Mexico City, Mexico
... human CD86 genomic region (GenBank ID: 942) including the coding sequence, the promoter
and the upstream intergenic region was analyzed in silico using three different software programs:
Methyl Primer Express Software v1.0 (Applied Biosystems), Softberry CpG Finder ...
Gene
Volume 529, Issue 2, 25 October 2013, Pages 238–244 DOI:10.1016/j.gene.2013.07.102
Core promoter analysis of porcine Six1 gene and its regulation of the promoter activity by CpG methylation
Wu et al.,
a Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
b Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, College of Animal Science, Huazhong Agricultural University, Wuhan, Hubei 430070, China
... sites. While, possible CpG islands were predicted using the program CpG finder
on Softberry (http://www.softberry.com/berry.phtml) and MethPrimer (http://www.
urogene.org/methprimer/index1.html). 2.3. Plasmids. To produce ...
Fish Physiology and Biochemistry
Volume 39, Issue 5 , pp 1153-1163 DOI:10.1007/s10695-013-9771-0
Identification of HIF-1a promoter and expression regulation of HIF-1a gene by LPS and hypoxia in zebrafish
Shasha Liu, Kecheng Zhu, Nan Chen, Weimin Wang, Huanling Wang
1. Key Lab of Freshwater Animal Breeding, Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, College of Fishery, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China
... 72 °C for 8 min. The PCR product was cloned into pGEM-T Easy vector (Promega,
Germany) and sequenced. The CpG island was predicted by CpG finder
(http://linux1.softberry.com/berry.phtml). To identify putative cis-acting ...
Molecular Biology Reports
June 2012, Volume 39, Issue 6, pp 6449-6465 doi: 10.3389/fmicb.2012.00185
Molecular analysis of a sunflower gene encoding an homologous of the B subunit of a CAAT binding factor
Salvini et al.,
1. Scuola Normale Superiore, Piazza dei Cavalieri 7, 56126, Pisa, Italy
2. Dipartimento di Biologia delle Piante Agrarie, Sezione di Genetica, Universita di Pisa, Via Matteotti 1B, 56124, Pisa, Italy
... The sequence of the intergenic DNA fragment spanning from the start codon of the HaL1L coding
region back to the stop codon of the upstream gene was examined with ''CpG- finder'' software
available at the site http://www.softberry. com to look for CpG isles. ...
PLoS ONE
7(3): e32154. doi:10.1371/journal.pone.0032154
Isolation of a 97-kb Minimal Essential MHC B Locus from a New Reverse-4D BAC Library of the Golden Pheasant.
Ye Q, He K, Wu S-Y, Wan Q-H
The Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education and State Conservation Center for Gene Resources of Endangered Wildlife, College of Life Sciences, Zhejiang University, Hangzhou, China
... CpG islands were elicited with Softberry CpGfinder (http://linux1.softberry.com/all.html),...
Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002
Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes
M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico
b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico
... Rho-independent bacterial terminators were searched using the program FindTerm
(Softberry Inc.). ... Search for genomic islands was made using CpG finger program from
Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...
Asian-Aust. J. Anim. Sci.
Vol. 24, No. 4 : 463 - 470 April 2011
Single Nucleotide Polymorphisms of the GnRHR Gene Associated with Reproductive Traits of Japanese Flounder (Paralichthys olivaceus)
He et al.,
Fisheries College, Ocean University of China, Qingdao 266003, China
... 2001). In this study, the consensus GnRHR sequence was analyzed for the presence
of a CpG Island using Soft berry CpG Finder (http://www.softberry.com/berry.phtml?
topic=cpgfinder&gr oup=programs&subgroup=promoter). It ...
Molecular Biology Reports
Volume 38, Issue 4 , pp 2619-2632 DOI: 10.1007/s11033-010-0403-9
Molecular characterization, expression patterns and polymorphism analysis of porcine Six1 gene
W.Wu et al.,
1. Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture and Key Lab of Agriculture Animal Genetics, Breeding and Reproduction, Ministry of Education, Beijing, People’s Republic of China
2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... Proscan software, version 1.7 was used to predict the putative promoter and transcription factor
binding sites (http:// www-bimas.cit.nih.gov/molbio/proscan/). Possible CpG islands were searched
with the program CpG finder on Softberry (http://www.softberry.com/berry.phtml). ...
FEMS Microbiology Ecology
Volume 71, Issue 1, pages 23–33, January 2010
Phylogenetic and metagenomic analysis of Verrucomicrobia in former agricultural grassland soil
Kielak et al.,
1 Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands
2 Arlington Department of Biology, University of Texas, Arlington, TX, USA
... Searches for GC islands were performed using CPGFINDER (SoftBerry, http://linux1.softberry.
com). For identification of potential HGT regions, the method described by Tamames & Moya
(2008) was applied to examine tetranu- cleotide frequencies. ...
Applied and Environmental Microbiology
October 2010, p. 6769-6777, Vol. 76, No. 20 doi:10.1128/AEM.00343-10
Comparative Analysis of Acidobacterial Genomic Fragments from Terrestrial and Aquatic Metagenomic Libraries, with Emphasis on Acidobacteria Subdivision 6
Anna M. Kielak, 1 Johannes A. van Veen, 1,2 and George A. Kowalchuk 1,3*
Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), P.O. Box 40, 6666 ZG Heteren, Netherlands,1 Institute of Biology Leiden University, P.O. Box 9516, 2300 RA Leiden, Netherland,2
...Annotation and sequence properties. Open reading frames (ORFs) were assigned using the
GLIMMER (12) and FGENESB (http://linux1.softberry.com) software tools. ... Searches for GC
islands were performed using CpGFinder (http://linux1.softberry.com). ... .
BMC Cancer
2008, 8:253 doi:10.1186/1471-2407-8-253
Promoter methylation inhibits BRD 7 expression in human nasopharyngeal carcinoma cells
H Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Changsha, Hunan, 410078, PR China
... CpGplot and Softberry CpGFinder, respectively. ... http://www.ebi.ac.uk/emboss/cpgplot)
program CpGplot and Softberry CpGFinder program Page 6. 5 ...
Molecular and Cellular Neuroscience
Volume 37, Issue 3, March 2008, Pages 537-547
Identification and characterization of the promoter region of the Nav1.7 voltage-gated sodium channel gene (SCN9A)
Diss et al.,
aMedical Molecular Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK
bMolecular Haematology and Cancer Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK
... This is not within a CpG island (EMBOSS CpG Plot, http://www.ebi.ac.uk/emboss/cpgplot/;
Softberry-CpGFinder, http://www.softberry.com/berry.phtml topic ...
Gene
Volume 384, 15 December 2006, Pages 62-72
Isolation and molecular characterization of the porcine transforming
growth factor beta type I receptor (TGFBR1) gene
Kefei Chen, Laurie A. Rund, Jonathan E. Beever and Lawrence B. Schooka
Department of Animal Sciences, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
Institute for Genomic Biology, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
... com). Possible CpG islands were searched with the program CpGfinder on
Softberry (http://www.softberry.com/berry.phtml). Protein ...
Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology
Volume 141, Issue 4, August 2005, Pages 406-411
Analysis of CpG methylation in the killifish CYP1A promoter
Alicia R. Timme-Laragy a, Joel N. Meyer a, Robert A. Waterland b and Richard T. Di Giulio
aNicholas School of the Environment and Earth Sciences/Integrated Toxicology Program, Box 90328, Duke University, Durham, NC, USA
bDepartments of Pediatrics and Molecular and Human Genetics, Baylor College of Medicine, USDA Children's Nutrition Research Center, Houston, TX, USA
... The consensus CYP1A promoter sequence was analyzed for the presence of a CpG Island
using Softberry CpGFinder (http://www.softberry.com/berry.phtml?topic ...
Gene
Volume 340, Issue 1, 29 September 2004, Pages 19-30
Isolation and molecular characterization of the porcine stearoyl-CoA desaturase gene
Jun Ren a, b, Christoph Knorr a, Lusheng Huang b and Bertram Brenig
a Institute of Veterinary Medicine, Georg-August-University of Go"ttingen, Groner Landstrasse 2, Go"ttingen 37073, Germany
b Jiangxi Provincial Key Laboratory for Animal Biotechnology, Jiangxi Agricultural University, Nanchang 330045, PR China
... com). Possible CpG islands were searched with the program CpGfinder on
Softberry (http://www.softberry.com/berry.phtml). Repetitive ...
NSITE
Biosci. Rep.
(2016) / 36 / art:e00293 / doi 10.1042/BSR20150290
Interrupted E2F1-miR-34c-SCF negative feedback
loop by hyper-methylation promotes colorectal
cancer cell proliferation
Yang S. et al.,
*Department of Histology and Embryology, School of Basic Medical Sciences, Capital Medical University, Beijing 100069, P.R. China
†Beijing Key Laboratory of Cancer Invasion and Metastasis Research, Beijing 100069, P.R. China
... Prediction of transcription
factors for miR-34c was conducted using TFSearch (http://
www.cbrc.jp/research/db/TFSEARCH.html), NSite (http://
linux1.softberry.com/) and Alggen (http://alggen.lsi.upc.
edu/). CpG island was predicted by EMBOSS Cpgplot
(http://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/). ...
Journal of cellular physiology
2016 DOI: 10.1002/jcp.25391
Atp2c2 Is Transcribed From a Unique Transcriptional Start Site in Mouse Pancreatic Acinar Cells
Fenech, M. A. et al.,
1 Children''s Health Research Institute, London, Ontario, Canada
2 Department of Pediatrics, University of Western Ontario, London, Ontario, Canada
... In all cases, n = 3. Download figure to PowerPoint. The region upstream of the Atp2c2c TSS
was examined for putative transcription factor binding motifs using the Alibaba-Gene
Regulation Data Base and Nsite—softberry (http://www.softberry.com). ...
Journal of Thoracic Oncology
2016 DOI: http://dx.doi.org/10.1016/j.jtho.2016.05.010
ITPKA gene body methylation regulates gene expression and serves as an early diagnostic marker in lung and other cancers
Wang, Y. W. et al.,
Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX, USA
The Center for Systems Biology, Department of Molecular and Cell Biology, The University of Texas at Dallas, Richardson, TX, USA
... binding motifs present in both ITPKA promoter and CpG island-2 regions. Using the Softberry
NSITE Program (http://www.softberry.com), we identified putative binding motifs for SP1 in
the promoter (nts -89 to -140) as well as CpG island-2 (motif 1 nts ...
Bioinformatics
2015, btv404. doi: 10.1093/bioinformatics/btv404
Nsite, NsiteH and NsiteM computer tools for studying transcription regulatory elements
Shahmuradov, I. A., & Solovyev, V. V.
1Computer, Electrical and Mathematical Sciences and Engineering Division, KAUST, Thuwal 23955-6900, KSA,
2Bioinformatics laboratory, Institute of Botany, ANAS, Baku AZ1073, Azerbaijan and
3Bioinformatics Division, Softberry Inc., Mount Kisco, NY 10549, USA
... Availability and implementation: Pre-compiled executables built under commonly used
operating systems are available for download by visiting http://www.molquest.kaust.edu.
sa and http://www.softberry.com. Contact: solovictor{at}gmail.com. ...
Brain Pathology
2015 DOI: 10.1111/bpa.12294
Role of microRNAs Located on Chromosome Arm 10q in Malignant Gliomas
Wolter, M., Werner, T., Malzkorn, B., Reifenberger, G.
1 Department of Neuropathology, Heinrich Heine University, Dusseldorf, Germany
2 German Cancer Consortium (DKTK), Partner Site Essen/Dusseldorf, German Cancer Research Center (DKFZ), Heidelberg, Germany
... In the 5'genomic region of miR-146b-5p, we investigated methylation patterns in and around
three putative SP1 transcription factor-binding sites predicted by the NSITE program (Version
2.2004, Softberry Inc., http://linux1.softberry.com/cgi-bin/programs/promoter/nsite.pl). ...
Physiology and Molecular Biology of Plants
2015, Volume 21, Issue 4 , pp 465-478 DOI: 10.1007/s12298-015-0325-z
Identification and expression analyses of MYB and WRKY transcription factor genes in Papaver somniferum L
Tayebeh Kakeshpour, Shadi Nayebi, Sajad Rashidi Monfared , Ahmad Moieni, Ghasem Karimzadeh
1. Plant Breeding and Biotechnology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran
... 1999) and Soft Berry (NSITE) (Solovyev et al. ... As a result of TFBSs identification obtained using
the TRANSFAC, PLACE and SoftBerry databases, multiple unique TFBSs of many known TFs
in the promoter regions of these 10 co-expressed genes were found (Table 4). WRKY ...
Am J Respir Crit Care Med
2014 , 189, A2026. DOI:
Redox Regulation Of Ap-1 At Three Response Elements Is Required For Transforming Growth Factor-b Gene Expression
Ryan, A. J., Carter, A. B., & Khan, M. T.
... Four potential AP-1 recognition sites in the 3' region of the TGF-? promoter were
identified with the Softberry NSITE: M1 (-407 -> -405), M2 (-369 -> -367), M3 (+160 ->
+162), M4 (+256 -> +258) with respect to transcription start site. ...
Virus genes
2014, 1-9. DOI: 10.1007/s11262-014-1081-9
Molecular characteristics of the complete genome of a J-subgroup avian leukosis virus strain isolated from Eurasian teal in China
Zeng X et al.,
1. College of Wildlife Resources, Northeast Forestry University, Harbin, 150040, China
2. Division of Avian Infectious Diseases, National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute Chinese Academy of Agricultural Sciences, No. 427 Maduan St., Harbin, 150001, China
... Transcriptional regulatory elements in the U3 were analyzed with NSITE (Recognition of
Regulatory motifs) which is an online service of Soft Berry (http://?linux1.?softberry.?com/?berry.?
phtml). The sequences obtained in this study have been submitted to GenBank. ...
Small Ruminant Research.
Volume 120, Issue 1, July 2014, Pages 20–26 DOI: 10.1016/j.smallrumres.2014.03.014
Genetic diversity of GH1 and LEP genes in Argentine llama ( Lama glama) populations
Daverio, M. S., Lorenzo, Y., Rigalt, F., Vidal-Rioja, L., Di Rocco, F.
a Laboratorio de Genetica Molecular, Instituto Multidisciplinario de Biologia Celular (IMBICE), CCT-CONICET-La Plata, CICPBA, Calle 526 e/10 y 11, PO Box 403, La Plata 1900, Buenos Aires, Argentina
b INTA-Estacion Experimental Agropecuaria Catamarca, Ruta Provincial N° 33km 4 (4705), Sumalao, Valle Viejo, Catamarca, Argentina
... impact of amino acid substitutions on protein function was performed by using SIFT software
(http://sift.jcvi.org/) whereas the analysis of putative Transcription Factor Binding Sites (TFBS)
within the GH1 promoter gene was done with the NSITE program at Softberry site (http ...
Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology
2014, 169, 16-24. DOI: 10.1016/j.cbpb.2013.12.002
Acute endocrine and nutritional co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, Oncorhynchus mykiss
Mennigen J. A. et al.,
INRA, UR 1067, Nutrition, Metabolisme, Aquaculture, Aquapole, F-64310 Saint-Pee-sur-Nivelle, France
... Target sequences including a 2000 bp upstream sequence were retrieved and
transcription factor binding sites predicted using the NSITE software package Version
2.2004 (www.http://linux1.softberry.com/berry.phtml, Softberry Inc.). ...
PloS one
November 11, 2013DOI: 10.1371/journal.pone.0079307
Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds
Yang et al.,
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China, Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted and
identified with SoftBerry-NSITE/Recognition of Regulatory motifs(http://www.softberry.ru/berry.
phtml?topi?c=nsite&group=programs&subgroup=promoter). ...
Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI:10.1007/s11010-012-1522-5
Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene
Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml?
topic=nsite and group = programs and subgroup = promoter), and Promoter Scan
(http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...
Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019
Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress
Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland
b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium
... software. The cis-acting elements were determined with the use of TSSP,
NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol-
tools.ca/Promoters.htm). Measurements of ethylene production. The ...
PloS one
December 31, 2013DOI: 10.1371/journal.pone.0083392
UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes
Kraemer et al.,
Institute of Radiation Biology, Helmholtz Center Munich, Neuherberg, Germany
Department Molecular Cell Biology, Center of Dermatology, Elbekliniken Stade/Buxtehude, Buxtehude, Germany
... Primers used are given in Table S2. Prediction of potential regulatory elements using the NSITE
program. Potential regulatory elements in the promoter region (1500 bp) of the miRNAs commonly
regulated by UVA and UVB were identified using the NSITE program (Softberry,. ...
The Plant Cell
September 2013 vol. 25 no. 9 3389-3404 DOI:10.?1105/?tpc.?113.?114736
Arabidopsis KINETOCHORE NULL2 Is an Upstream Component for Centromeric Histone H3 Variant cenH3 Deposition at Centromeres[
Lermontova et al.,
aLeibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany
bInterdisciplinary Center for Crop Plant Research, Martin Luther University Halle-Wittenberg, D\x{2013}06120 Halle (Saale), Germany
... To see whether KNL2 is similarly regulated, the KNL2 promoter region was studied in silico using
the NSITE program (available through www.softberry.com/berry.phtml?topic=promoter). A potential
E2F binding site (CCCGCCAAA) was found at ?148 bp upstream of ATG. ...
PloS pathogenes
August 29, 2013DOI: 10.1371/journal.ppat.1003571
Schistosoma mansoni Mucin Gene (SmPoMuc) Expression: Epigenetic Control to Shape Adaptation to a New Host
Perrin et al.,
Universite de Perpignan Via Domitia, Perpignan, France, CNRS, UMR 5244, Ecologie et Evolution des Interactions (2EI), Perpignan, France
Center for Infection and Immunity of Lille, Inserm U1019, CNRS UMR 8204, Institut Pasteur de Lille, University Lille Nord de France, Lille, France
...We scanned the promoter sequences for putative regulator binding sites using the web based interface Program NSITE (Softberry Inc.) (http://linux1.softberry.com/berry.phtml??topic=nsite&group=programs&subgroup=prom?oter).þþþ
Scientific Reports
3, Article number: 2178 doi:10.1038/srep02178
Hox genes are involved in vascular wall-resident multipotent stem cell differentiation into smooth muscle cells
Diana Klein, Mohamed Benchellal, Veronika Kleff, Heinz Gunther Jakob & Suleyman Ergun
Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany
Institute of Anatomy, University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany
...Chromosome 11: 117,070,037-117,075,503 forward strand) was analyzed for promoter prediction sites using the Promotor 2.0
prediction server (www.cbs.dtu.dk/services/Promoter/) and SoftBerry NSITE (http://linux1.softberry.com)...
Forest Pathology
6 NOV 2012 DOI: 10.1111/efp.12011 Early View (Online Version of Record published before inclusion in an issue)
Characterization and expression of daf-9 and daf-12 genes in the pinewood nematode, Bursaphelenchus xylophilus
D.-D. Wang 1,2,
X.-Y. Cheng 3,*,
Y.-S. Wang 2,
H.-Y. Pan 1,
B.-Y. Xie 2
1
College of Plant Science, Jilin university, Changchun, China
2
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing, China
... nested PCR. The PCR products were purified, cloned and sequenced. The sequences
were analysed using NSITE (http://linux1.softberry.com/berry.phtml?topic=nsite&group=
programs&subgroup=promoter). 2.5 Gene expression ...
JCB
March 19, 2012 vol. 196 no. 6 689-698 DOI: 10.1083/jcb.201201077
MicroRNA-30c-2* limits expression of proadaptive factor XBP1 in the unfolded protein response
Andrew E. Byrd, Ileana V. Aragon, and Joseph W. Brewer
Department of Microbiology and Immunology, College of Medicine, University of South Alabama, Mobile, AL 36688
... Potential transcription factor binding sites upstream of the miR-30c-2* chromosomal location
were identified using the NSITE program (Softberry) and the University of California, Santa
Cruz Genome browser. Reporter and expression vectors. ...
Molecular Genetics and Metabolism
Volume 106, Issue 3, July 2012, Pages 281–286 DOI: 10.1016/j.ymgme.2012.04.013,
Algorithm for Pompe disease newborn screening: Results from the Taiwan screening program
Shu-Chuan Chiang a, Wuh-Liang Hwu a, b, Ni-Chung Lee a, b, Li-Wen Hsu a, Yin-Hsiu Chien a, b
a Department of Medical Genetics, National Taiwan University Hospital, Taipei, Taiwan
b Department of Pediatrics, National Taiwan University Hospital and National Taiwan University School of Medicine, Taipei, Taiwan
... upon request). The promoter regions (? 500 bp) of the GAA and neutral ?-glucosidase
C (GANC) genes were analyzed by the NSITE program (available at http://www.
softberry.com/berry.phtml). 2.3. Statistical analysis. A single ...
PLoS ONE
7(10): e48097. doi:10.1371/journal.pone.0048097
How Peroxisomes Affect Aflatoxin Biosynthesis in Aspergillus Flavus
Reverberi et al.,
Dipartimento di Biologia Ambientale, Universita Sapienza, Roma, Italy
Oklahoma State University, Oklahoma City, Oklahoma, United States of America
... present in the 2.0 Kb 5' Flanking sequence (upstream) of AFLA099000, retrieved from
http://fungi.ensembl.org/Aspergillus_fla?vus/Info/Index, was performed with the genomic tools
in the aspergillusflavus.org website and through the NSITE tool in the softberry.com website and ...
Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI: 10.1007/s11010-012-1522-5
Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene
Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China
... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml?
topic=nsite and group = programs and subgroup = promoter), and Promoter Scan
(http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...
African Journal of Biotechnology
Vol. 11 (31), pp. 7864-7874, 17 April, 2012
DOI: 10.5897/AJB11.1229
The characterization of cytoplasmic ribosomal protein genes in microsporidian Nosema bombycis Genome
Handeng Liu 1,2, Guoqing Pan 1*, Tian Li 1, Wei Huang 1 and Zeyang Zhou 1,3,
1Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, P.R. China.
2Experimental Teaching Center, Chongqing Medical University, Chongqing 400016, P.R. China.
... from the initiation site of the predicted transcription start site (TSS, +1). The regions 500 bps
upstream from the transcription initiation site were used for analyzing the potential binding sites
for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...
Plant Science
Volumes 193–194, September 2012, Pages 39–47 http://dx.doi.org/10.1016/j.plantsci.2012.05.005
The regulation of the SARK promoter activity by hormones and environmental signals
Carla A. Delatorre a, b, 1,
Yuval Cohen a, c, 1,
Li Liu a, 1,
Zvi Peleg a, 2,
a Department of Plant Sciences, University of California, Davis, CA 95616, USA
b Department of Crop Science, Agronomy School, Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS, 91501970, Brazil
... To identify cis-regulatory elements in the promoter, cis-element search programs at PLACE
(http://www.dna.affrc.go.jp/PLACE/info.html, PlantCARE (http://bioinformatics.psb.ugent.be/
webtools/plantcare/html/), and NSITE (http://linux1.softberry.com/cgi-bin/programs/promoter ...
Sci. Signal.
18 January 2011 Vol. 4, Issue 156, p. ra2 [DOI: 10.1126/scisignal.2001211]
The Kinase SGK1 in the Endoderm and Mesoderm Promotes Ectodermal Survival by Down-Regulating Components of the Death-Inducing Signaling Complex. Sci. Signal. 4, ra2 (2011).
T. Endo, M. Kusakabe, K. Sunadome, T. Yamamoto, E. Nishida
... Cis-regulatory elements in the promoter regions were searched with TRANSFAC (41) and
NSITE (http://linux1.softberry.com/berry.phtml). ChIP. ChIP was performed as described (42).
Fifty embryos were injected with HA-xRelA mRNA at four-cell stage. ...
Virology Journal
2011, 8:158
http://www.virologyj.com/content/8/1/158
Sequence analysis for the complete proviral genome of subgroup J Avian Leukosis virus associated with hemangioma: a special 11 bp deletion was observed in U3 region of 3’UTR
Shi et al.,
1 College of Veterinary Medicine, Sichuan Agricultural University, Ya’an,
Sichuan, 625014, China
... DNASTAR package. Transcriptional regulatory elements in U3 were analyzed by
the online service system of NSITE (Recog- nition of Regulatory motifs) of SoftBerry
(http://linux1. softberry.com/berry.phtml). Phylogenetic analysis ...
Virology Journal
2011, 8:552 http://www.virologyj.com/content/8/1/552
Novel sequences of subgroup J avian leukosis viruses associated with hemangioma in Chinese layer hens
Pan et al.,
1
Division of Avian Infectious Diseases, State Key Laboratory of Veterinary
Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of
Agricultural Sciences, Harbin 150001, PR China
... Bootstrap values were calculated using 500 or 1000 replicates of the alignment. Transcriptional
regulatory elements in the U3 were ana- lyzed by NSITE (Recognition of Regulatory motifs),
an online service of Soft Berry (http://linux1.softberry.com/ berry.phtml). ...
Genetics and Molecular Research
10 (3): 1777-1786 (2011) DOI: 10.4238/vol10-3gmr1466.
Molecular cloning, characterization and association analysis of the promoter region of the bovine CDK6 gene
Liu YF, Zan LS, Cui WT, Xin YP, Jiao Y, Li K.
College of Animal Science and Technology, Northwest Agriculture and Forestry University, Yangling Shaanxi, PR China.
... were analyzed using Cat- tle dbSNP (http://www.ncbi.nlm.nih.gov/snp/limits), Transcription Element
Search System (http://www.cbil.upenn.edu/cgi-bin/tess/tess), Promoter Scan (http://www.bimas.
cit.nih.gov/ molbio/proscan), and the NSITE program (Softberry, http://linux1 ...
Mol Cancer Res
April 2011 9; 497 doi: 10.1158/1541-7786.MCR-10-0556
Expression Regulation of the Metastasis-Promoting Protein InsP3-Kinase-A in Tumor Cells
Chang et al.,
1Institut fur Biochemie und Molekularbiologie I: Zellulare Signaltransduktion; 2Institut fur Tumorbiologie, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany
... transcription factors was investigated. Therefore, transcription factor binding sites
in ITPKA-1250 were analyzed by a Softberry NSITE motif search (core similarity 0.8,
significance level 0.95) motif search. Potential binding sites ...
Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126–3137 DOI: 10.1016/j.biortech.2010.10.079
Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes
Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted
and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry.
ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...
Journal of Hazardous Materials
Volume 192, Issue 2, 30 August 2011, Pages 855–873 DOI: 10.1016/j.jhazmat.2011.05.106,
Decolorization of different dyes by a newly isolated white-rot fungi strain Ganoderma sp.En3 and cloning and functional analysis of its laccase gene
Rui Zhuo et al.,
a Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted
and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry.
ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...
Cellular and Molecular Life Sciences
Volume 68, Issue 24 , pp 4115-4132 DOI: 10.1007/s00018-011-0785-4
Functional diversity of melanopsins and their global expression in the teleost retina
Davies et al.,
1. Nuffield Laboratory of Ophthalmology, Nuffield Department of Clinical Neurosciences, Levels 5-6 West Wing, John Radcliffe Hospital, University of Oxford, Headley Way, Oxford, OX3 9DU, UK
2. Department of Cell and Developmental Biology, Centre for Cell and Molecular Dynamics, University College London, 21 University Street, London, WC1E 6DE, UK
... gene were performed by using the MatrixTM Version 1.0 database (with a cut- off filter to minimize
false positives) (http://www.gene- regulation.com/cgi-bin/pub/programs/match/bin/match.cgi)
and NSITE: Animal TFD from Ghosh database (http:// linux1.softberry.com/berry.phtml ...
Applied Microbiology and Biotechnology
2011, Volume 91, Issue 4 , pp 1107-1119 DOI: 10.1007/s00253-011-3355-7
PdCYP51B, a new putative sterol 14?-demethylase gene of Penicillium digitatum involved in resistance to imazalil and other fungicides inhibiting ergosterol synthesis
Xuepeng Sun, Jiye Wang, Dan Feng, Zhonghua Ma, Hongye Li
1. Institute of Biotechnology, Zhejiang University, Hangzhou, Zhejiang, 310029, China
2. Key Laboratory of Molecular Biology for Crop Pathogens and Insect Pests of Ministry of Agriculture, Zhejiang University, Hangzhou, Zhejiang, 310029, China
... The NSITE program (www.softberry.com) and the eukaryotic promoter predictor (Berkeley
Drosophila Genome Project, http://www.fruitfly.org/seq_tools/promoter.html) were used to
analyze the sequence of PdCYP51B gene. The protein ... softberry.com). ...
Scandinavian Journal of Rheumatology
May 2010, Vol. 39, No. 3 , Pages 254-258 (doi:10.3109/03009740903347983)
Association of TBX21 gene haplotypes in a Chinese population with systemic lupus erythematosus
You et al.,
1Department of Dermatology
2Department of Paediatrics
3Department of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing, P. R. China
... (A) Computer analysis of sequences covering -1993 bp, by using NSITE (http://linux1.softberry.
com/berry.phtml?topic = nsite&group =programs&subgroup = promoter), indicated that the
-1993T>C SNP is located on a putative binding site for the Sp1 transcription factor. ...
Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126-3137, doi:10.1016/j.biortech.2010.10.079
Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes
Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China
b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China
... The putative cis-acting elements in the promoter region of laccase gene were predicted
and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry.
ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...
The Journal of Physiological Sciences
Volume 59, Number 2 / March, 2009, pp. 81-86
Association of Ala589Ser polymorphism of WNK4 gene with essential hypertension in a high-risk Chinese population
Sun et al.,
(1) Department of Medical Genetics, China Medical University, Shenyang, 110001, China
(2) Department of Cardiology, Shengjing Hospital, China Medical University, Shenyang, 110004, China
... 2). Using software including TRANSFAC 4.0 (avail- able at http://transfac.gbf.de/TRANSFAC/),
TSSG/TSSH (available at http://www.cbs.dtu.dk/services/Promoter/) and NSITE (available at
http://www.softberry.com/berry.phtml), a number of cis-acting elements, eg, AP1, SP1, GRE ...
Gene
Volume 435, Issues 1-2, 15 April 2009, Pages 63-71
Characterization of porcine MMP-2 and its association with immune traits
Honggang Huang et al.,
aKey Laboratory for Farm Animal Genetic Resources and Utilization of Ministry of Agriculture of China, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, PR China
... The 5?-?anking DNA sequences were analyzed using the Transcription Element Search System
(http://www.cbil.upenn.edu/cgi-bin/tess/tess), the NSITE program (http://linux1.softberry.com/berry.
phtml?topic=nsite and group=programs and subgroup=promoter), and the ...
Meat Science
Volume 82, Issue 2, June 2009, Pages 278-283
Identification of the new polymorphisms in the promoter region of the CAST gene in cattle
E. Juszczuk-Kubiak a, E, K. Flisikowski b, K. Wicin'ska a, J. Po?oszynowicza and S. Rosochacki a, c
aInstitute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrze;biec, 05-552 Wo'lka Kosowska, Poland
bLehrstuhl fuer Tierzucht Technische Universitat in Muenchen, 85354 Hochfeldweg 1, Freising, Germany
... Sequences with 100% identity to TF-binding sites were searched in the NSITE program
(Softberry, Inc., USA, http://www.softberry.com) and TESS software (Schug J & Overton,
Ch.G.; http://www.cbil.upenn.edu/tess). 3. Results and discussion. ...
Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90
Characterization of the murine Dfna5 promoter and regulatory regions
Karen Vrijens a, Guy Van Camp a and Lut Van Laer a
aDepartment of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium
... Transcription factor (TF) binding sites were scored using three programs, MatInspector
(www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www-bimas.cit.nih.gov/
molbio/proscan/). 2.2. 5?- and 3?-rapid amplification of cDNA ends (RACE). ...
BMC Molecular Biology
2008, 9:104 doi:10.1186/1471-2199-9-104
The artiodactyl APOBEC3 innate immune repertoire shows evidence for a
multi-functional domain organization that existed in the ancestor of placental
mammals
LaRue et al.,
Department of Biochemistry, Molecular Biology and Biophysics, Institute for Molecular
Virology,BeckmanCenter for Genome Engineering,University of Minnesota,Minneapolis,
Minnesota 55455,USA
... were identified and compared using the TransFac and Biobase databases through
the softberry NSITE portal (www.softberry.com). The ...
Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90
Characterization of the murine Dfna5 promoter and regulatory regions
Karen Vrijens, Guy Van Camp and Lut Van Laer
Department of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium
... Transcription factor (TF) binding sites were scored using three programs, MatInspector
(www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www ...
Eukaryotic Cell
June 2008, p. 988-1000, Vol. 7, No. 6 doi:10.1128/EC.00228-07
Modulation of Antioxidant Defense in Aspergillus parasiticus Is Involved in Aflatoxin Biosynthesis: a Role for the ApyapA Gene{triangledown}
Reverberi, M et al.,
... This analysis was performed using the NSITE tool in the Softberry software package,
which allowed us to reveal all of the putative regulatory elements present ...
International Journal of Plant Sciences
169(6):701–707. 2008.
The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants
Sabina Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana, Slovenia
... Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ...
Signal Scan program and the REGSITE database with the NSITE program, several ...
DNA and Cell Biology
June 1, 2008, 27(6): 307-314. doi:10.1089/dna.2007.0692
Identification and Characterization of the Human Testes-Specific Protease 50 Gene Promoter
M. Wang et al.,
Institute of Genetics and Cytology, Northeast Normal University, ChangChun, China.
.. MatInspector(Carthariusetal.,2005) (http:==www.genomatix.de=cgi-bin=matinspector_prof),
and NSITE (Solovyev and Shahmuradov, 2006) (http:==www .softberry.com). ..
Plant Pathology
57(1):92-102, February 2008.
A role for oxidative stress in the Citrus limon/Phoma tracheiphila interaction.
Reverberi, M et al.,
... NSite and cellular localization predictions were performed by the software
PSITE (© Softberry, Inc. 2000-2005). Statistics TOP. ...
Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208
Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes
Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy
... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter,
Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.),
"TSSG" and "TSSW" ... 1999–2005, www.softberry.com); ...
J Appl Genet
48(4), 2007, pp. 371–374
Polymorphisms in intron 1 of the porcine POU1F1 gene
Cheng-Yi Song et al.,
College of Animal Science & Technology, Yangzhou University, Jiangsu, China;
Division of Biological Sciences, University of Missouri-Columbia, Columbia, MO, USA
... the potential functional importance of the 313-bp indel, the insertion sequences
were analysed in silico and by the use of NSITE pro- gram (Softberry, Inc, USA ...
Molecular Microbiology
(2007), 66 (2), 534–551
Transcriptional control of nmrA by the bZIP transcription factor MeaB reveals a new level of nitrogen
regulation in Aspergillus nidulans
Koon Ho Wong, Michael J. Hynes, Richard B. Todd, Meryl A. Davis
Department of Genetics, The University of Melbourne, Melbourne, Vic. 3010, Australia
... Analysis using the NSITE algorithm (http://www.softberry.com) matched both element
A and B sequences independently to the binding site of the mammalian bZIP ...
Epilepsy Research
Volume 75, Issue 2-3, Pages 145-153
Linkage and mutational analysis of CLCN2 in childhood absence epilepsy
K Everett et al.,
... using the prediction program ESEfinder version 2.0 (Cartegni et al., 2003) and the
TransFac and Biobase GmbH databases via NSITE (http://www.softberry.com). ...
RNA
(2007), 13:1988-1999
Regulation of transcription of the RNA splicing factor hSlu7 by Elk-1 and Sp1 affects alternative splicing
Moti Alberstein et al.,
Department of Human Molecular Genetics and Biochemistry, Sackler Faculty of Medicine, Tel-Aviv University, Tel Aviv 69978, Israel
... programs: TRANSPLORER (http://www.developmentontheedge.com/transplorer.shtml);
Genomatix (http://www.genomatix.de/); NSITE (http://www.softberry.com/berry.phtml ...
European Journal of Human Genetics 15, 463 - 472 (01 Apr 2007)
Linkage and association analysis of CACNG3 in childhood absence epilepsy
KV Everett et al.,
... identified variants was assessed by searching for predicted regulatory motifs contained
within the TransFac and Biobase databases via the Softberry NSITE portal ...
Insect Science
Volume 14 Issue 1 Page 5-14, February 2007
Analysis of the structure and expression of the 30K protein genes in silkworm,
Bombyx mori
QUAN SUN et al.,
The Key Laboratory of Sericulture of Agriculture Ministry, College of Sericulture and Biotechnology, Southwest University, Chongqing, China
... initiation site were used for analyzing the potential binding sites for the
transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...
Mammalian Genome
Volume 17, Number 8 / August, 2006 pp. 892-901
Identification of genetic variation and putative regulatory regions in bovine CARD15
Kristen H. Taylor, Jeremy F. Taylor, Stephen N. White and James E. Womack
Department of Veterinary Pathobiology, Texas A&M University, College Station, Texas, 77843-4467, USA
... These motifs were analyzed using NSITE (available through SoftBerry, http://www.
softberry.com/berry.phtml?topic=pro- moter) to determine homology to previously ...
Human Genetics
Volume 117, Number 1 / June 2005 pp. 16-26
Functional promoter polymorphism in the TBX21 gene associated with aspirin-induced asthma
Mitsuteru Akahoshi et al.,
Laboratory for Genetics of Allergic Diseases, SNP Research Center, RIKEN Yokohama Institute, Institute of Physical and Chemical Research (RIKEN), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama Kanagawa, 230-0045, Japan
... shown). Computer analysis of sequences covering A1993 bp, by using NSITE,
available at http://www.softberry.com/berry.phtml? topic ...
NSITE-PL
Plant Gene
2016, 5, 78-86. doi:10.1016/j.plgene.2016.01.001
Molecular cloning and transcriptional analysis of WRKY and solavetivone biosynthetic genes in the hairy roots of Hyoscyamus albus
Kawauchi, M., Arima, T. H., Kuroyanagi, M.
Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan
.. PLACE (http://www.dna.affrc.go.jp/PLACE/index.html) and NSITE-PL
(http://www.softberry.com/berry.phtml?topic=nsitep&group=programs&subgroup ...
Plant Physiology
September 2013 vol. 163 no. 1 431-440 DOI:10.?1104/?pp.?113.?221713
Histone Deacetylase AtHDA7 Is Required for Female Gametophyte and Embryo Development in Arabidopsis
Cigliano et al.,
National Research Council of Italy, Institute of Plant Genetics, Research Division Portici, 80055 Portici, Italy (R.A.C., G.C., R.P., P.T., G.P., M.F.C., C.C.); and
Gregor Mendel Institute of Molecular Plant Biology, Austrian Academy of Sciences, 1030 Vienna, Austria (R.G.)
... An area 1,000 bp upstream of the predicted start codon of HDA7 was analyzed with NSITE-PL
(http://linux1.softberry.com) and Akiyama's TFSEARCHv1.3 (http://molsun1.cbrc.aist.go.jp/research/
db/TFSEARCH.html) with default setting to detect putative regulatory motifs. ...
Plant Growth Regulation
Volume 71, Issue 1 , pp 77-92 DOI:10.1007/s10725-013-9814-7
A novel GRAS protein gene MtSymSCL1 plays a role in regulating nodule number in Medicago truncatula
Goon-Bo Kim, Young-Woo Nam
Sta1. Department of Life Science, Sogang University, Seoul, 121-742, Koreate
... 2008 ). The 5? upstream flanking region of MtSymSCL1 was analyzed by using the PLACE
database (Higo et al. 1999 ) or the RegSite database of plant regulatory elements (NSITE-PL
program, http://www.softberry.com). Construction of reporter fusion and RNAi plasmids. ...
Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019
Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress
Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland
b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium
... software. The cis-acting elements were determined with the use of TSSP,
NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol-
tools.ca/Promoters.htm). Measurements of ethylene production. The ...
Plant, Cell & Environment
2013, 36: 1171–1191. doi: 10.1111/pce.12051
Two closely linked tomato HKT coding genes are positional candidates for the major tomato QTL involved in Na+/K+ homeostasis
ASINS et al.,
1Plant Protection and Biotechnology Center, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain
2Department of Biochemistry, Molecular and Cellular Biology of Plants, Estacion Experimental del Zaidin, Consejo Superior de Investigaciones Cientificas (CSIC), Granada, Spain
3Center for Plant Biotechnology and Genomics (UPM-INIA), Universidad Politecnica de Madrid, Madrid, Spain
... 1999) and PlantCARE (Lescot et al. 2002) and NSITE-PL (http://linux1.softberry.com)
databases and tools. The presence of CpG islands was checked by the CpG Islands Searcher
web tool using the program's default settings (Takai & Jones 2002). ...
Plant Molecular Biology
Volume 82, Issue 1-2 , pp 51-58 DOI:10.1007/s11103-013-0034-3
Sugarcane Loading Stem Gene promoters drive transgene expression preferentially in the stem
Richard L. Moyle, Robert G. Birch
1. Hines Plant Science Building, The University of Queensland, Brisbane, 4072, Australia
... ScLSG promoters, by searching PLACE (Higo et al. 1999), PlantCARE (Lescot et
al. 2002), Athena (O'Connor et al. 2005) and NSITE-PL (www.softberry.com/berry.
phtml) databases. ScLSG5 Apex IN3 IN4 IN5 IN6 IN7 IN8 IN9 ...
Journal of Integrative Plant Biology
Volume 54, Issue 6, pages 400–411, June 2012 DOI: 10.1111/j.1744-7909.2012.01126.x
Characterization of Two Putative Protein Phosphatase Genes and Their Involvement in Phosphorus Efficiency in Phaseolus vulgaris
Cui-Yue Liang 1,2, Zhi-Jian Chen 1, Zhu-Fang Yao 1, Jiang Tian 1,*, Hong Liao 1
1 State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Root Biology Center, South China Agricultural University, Guangzhou 510642, China
2 Robert Holley Center for Agriculture and Health, United States Department of Agriculture, Agricultural Research Service, Cornell University, Ithaca, New York 14853, USA
... genomewalker DNA library derived from G19833 genomic DNA. Putative motifs regulated by
environmental stresses were identified by using the software NSITE-PL (www.softberry.com)
and PLACE (http://www.dna.affrc.go.jp/PLACE/signalscan) in silico. Among them, two 8-bp ...
Plant Cell Reports
Volume 31, Issue 2 , pp 271-279 DOI
10.1007/s00299-011-1161-4
Native polyubiquitin promoter of rice provides increased constitutive expression in stable transgenic rice plants
Jagannath Bhattacharyya et al.,
1. Advanced Laboratory for Plant Genetic Engineering, Indian Institute of Technology, Kharagpur, 721302, India
... 2002; http://www.bioinformatics.psls.ugent.be/webtools/ PlantCARE/html/); Athena (O'Connor
et al. 2005; http://www.bioinformatics2.wsu.edu/Athena); NSITE-PL (Soft berry,
http://www.softberry.com/berry.phtml). Results Generation of transgenic rice lines ..
African Journal of Biotechnology
Vol. 11(40), pp. 9534-9542, 17 May, 2012 DOI: 10.5897/AJB12.040
Isolation and characterization of a candidate gene for
resistance to cereal cyst nematode from Aegilops
variabilis in China
D. L. Xu et al.,
1
Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan, China.
2
Graduate University of the Chinese Academy of Sciences, Beijing, China.
... The ORFs of the sequences were identified by FGENESH (http://linux1.softberry.com/) and the
amino acid sequence was obtained at the same time. ... The resulting sequences were analyzed
using NSITE-PL to identify regulatory motifs (http://linux1.softberry.com/). RESULTS ...
The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x
A soybean b-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses.
Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China
... accession number FJ461673). In silico analysis of the promoter sequence was
performed using the software programs tssp-tcm (Shahmuradov et al., 2005),
nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...
Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24
Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar
Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.
... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb.
ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry,
http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ...
Plant Cell Rep.
2009 May;28(5):851-60. Epub 2009 Mar 21.
43-bp A/T-rich element upstream of the kinesin gene AtKP1 promoter functions as a silencer in Arabidopsis
Lai C, Xiong J, Li X, Qin X.
College of Biological Sciences, China Agricultural University, Beijing, China
... 1999) and NSITE-PL (www.softberry.com) to ascertain whether the 180-bp sequence
has sequence similarity to other regulatory elements. We found that multiple previously
reported cis- elements were present in this region (Fig. ...
BMC Evolutionary Biology
2009, 9:271 doi:10.1186/1471-2148-9-271
The evolution of Brassica napus FLOWERING LOCUST paralogues in
the context of inverted chromosomal duplication blocks
Jing Wang et al.,
1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, PR China and 2Rothamsted
Research, Harpenden, Herts, AL5 2JQ, UK
... Sequence analysis The coding sequences and amino acids ofBnFT paralogues were predicted
using the software "Softberry FGENESH" online service (http://linux1.softberry.com/berry.phtml). ...
"Softberry NSITE-PL" online service (http://linux1.softberry.com/berry.phtml). ...
Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394
Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar
Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China
... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as
UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to
predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...
Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065
Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)
Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece
2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece
... elements was performed using the database available at: http://softberry.com. TSSs
were determined using the TSSP program available at the site. NSITE-PL was ...
Forestry Studies in China
June 20, 2007, pp. 95-106
Isolation and analysis of a TIR-specific promoter from poplar
Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China
... out with the BLAST search program in NCBI Transcriptional start site of the obtained
DNA sequence, was predicted with the online program TSSP in Softberry. ...
... Cis-acting regulatory elements located at the promoter region were predicted by
using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...
Plant Physiology
144:1786-1796 (2007)
Exclusion of Na+ via Sodium ATPase (PpENA1) Ensures Normal Growth of
Physcomitrella patens under Moderate Salt Stress
Christina Lunde, Damian P. Drew, Andrew K. Jacobs and Mark Tester
Plant Biochemistry Laboratory, Department of Plant Biology, Faculty of Life Sciences,
University of Copenhagen, DK–1871 Frederiksberg C, Copenhagen, Denmark (C.L.,); and Australian
Centre for Plant Functional Genomics, University of Adelaide, Waite Campus, Glen Osmond, South
Australia 5064, Australia (D.P.D., A.K.J., M.T.)
... obtained from the eight templates were aligned using Contig Express (Vector NTI
8). The promoter sequence was analyzed using NSITE-PL (www.softberry.com) and ...
Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1769, Issue 2, February 2007, Pages 139-148
Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis
Nitima Suttipantaa, Sitakanta Pattanaika, Samir Gunjanc, Claire H. Xiea,John Littletonb, and Ling Yuana
Department of Plant and Soil Sciences, University of Kentucky, Lexington, KY 40546, USA
... 1). Sequence analysis using PLACE (www.dna.affrc.go.jp/PLACE) [14] and the
NSITE-PL program (www.softberry.com) reveals that the G10H promoter contains several ...
In Silico Biology
Volume 7, Number 1 / 2007 pp. 7-19
In silico analysis of the Lateral Organ Junction (loj) gene
and promoter of Arabidopsis thaliana
Dipnarayan Saha et al.,
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, India
...The software programs used were AtcisDB (http://arabidopsis.med.ohio-state.edu/AtcisDB/index.jsp) [Davuluri et al., 2003] PLACE (http://www.dna.affrc.go.jp/PLACE/) [Higo et al., 1999], PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [Lescot et al., 2002], and NSITE-PL (Softberry; http://www.softberry.com/berry.phtml).
Similarly NSITE-PL of Softberry Inc. and PLACE database identified a large number of cis-elements, except few the majority of which may not be relevant for the function of this promoter.
...
Plant Molecular Biology
(2006) 60, 2, 259-275
Gene Structure and Expression Pattern Analysis of Three Monodehydroascorbate Reductase (Mdhar)
Genes in Physcomitrella patens: Implications for the Evolution of the MDHAR Family in Plants*
Christina Lunde , Ute Baumann, Neil J. Shirley, Damian P. Drew and Geoffrey B. Fincher
Australian Centre for Plant Functional Genomics, School of Agriculture and Wine, University of Adelaide, Waite Campus, Glen Osmond, 5064, SA, Australia
... The promoter sequence was analysed using NSITE-PL (www.softberry.com), PLACE ...
The Plant Cell
Volume18 Number 10 October 2006 2443-2451
Loading of Arabidopsis Centromeric Histone CENH3 Occurs Mainly during G2 and Requires the Presence of the Histone Fold Domain
Inna Lermontova et al.,
Leibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany
... Computer analysis of the presumed promoter region of A. thaliana CENH3, using the
NSITE program (available through SoftBerry, http://www.softberry.com/berry ...
NSITEM
Genes and Immunity
07 Aug 2008, doi: 10.1038/gene.2008.63,
Expression levels of FAS are regulated through an evolutionary conserved element in intron 2, which modulates cystic fibrosis disease severity
V Kumar et al.,
# 1Department of Pediatric Pneumology and Neonatology, Hannover Medical School, Hannover, Germany
# 2Institute for Medical Biometry, Informatics and Epidemiology, University of Bonn, Bonn, Germany
... Webthermodyn. 17 The program NSITEM at www.softberry.com was used to search
for conserved functional motifs within the CNS. Possible ...
BMC Genetics
2008, 9:50 doi:10.1186/1471-2156-9-50
Bovine CD14 gene characterization and relationship between
polymorphisms and surface expression on monocytes and
polymorphonuclear neutrophils
Eveline M Ibeagha-Awemu1 Jai-Wei Lee, Aloysius E Ibeagha1 and
Xin Zhao
1Department of Animal Science, McGill University, Ste-Anne-de-Bellevue, Quebec H9X 3V9, Canada and 2Department of Tropical
Agriculture and International Cooperation, National Pingtung University of Science and Technology, Neipu, Pingtung 912, Taiwan
... of the CD14 genes of different species (cattle, human, mouse, rat and pig) through
a query in the NSITEM data base http:/ / linux1.softberry.com/ berry.phtml
Journal of Investigative Dermatology
2006 126, 325–335. doi:10.1038/sj.jid.5700065
Transcriptional Regulation and Characterization of the Promoter Region of the Human ABCC6 Gene
Qiujie Jiang1, Yasushi Matsuzaki1, Kehua Li and Jouni Uitto
# Department of Dermatology and Cutaneous Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania, USA
# 2Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Thomas Jefferson University, Philadelphia, Pennsylvania, USA
... putative cis-acting elements using transcription factor databases (TFSEARCH, Kyoto
University, version 1.3) and ConSite (nsiteM, Softberry, Inc., version 2.2004 ...
Plant Molecular Biology
Volume 58, Number 2 / May 2005 pp. 193-212
Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana
Rachel Clifton et al.,
Plant Molecular Biology Group, School of Biomedical and Chemical Sciences,, The University of Western Australia, 35 Stirling Highway, 6009 Crawley, Western Australia, Australia
... jsp). Pre- viously described motifs were identified using Softberry nsiteM (Shahmuradov
et al., 2003), PlantCARE (Lescot et al., 2002), PLACE (Higo et al., 1999 ...
PATTERN
PloS one
2014, 9(1), e84692. DOI: 10.1371/journal.pone.0084692
Isolation and Characterization of Three Cassava Elongation Factor 1 Alpha (MeEF1A) Promoters
Suhandono, S., Apriyanto, A., Ihsani, N.
School of Life Sciences and Technology, Institut Teknologi Bandung, Bandung, Jawa Barat, Indonesia
... www.cbs.dtu.dk/services/NetGene2/) [51]. Conserved cis-acting regulatory was
carried out using the PATTERN search from Softberry website (http://www.softberry.
com/berry.phtml). PLACE [52] and PlantCARE [53] software ...
Nature and Science,
4(3), 2006
An In Silico Investigation into the Discovery of
Novel Cis-acting Elements within the Intronic Regions of Human PAX7
Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan
University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center),
New York City, New York 10021, USA
The names and functions of the programs used are:
...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) -
This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) -
TSSG is the most accurate mammalian cis element prediction program.
POLYAH
Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6
DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic
Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland
2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA
... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures
in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry),
3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...
Gene
Volume 529, Issue 2, 25 October 2013, Pages 228–237 DOI:10.1016/j.gene.2013.07.103
Splicing variants of the porcine betaine–homocysteine S-methyltransferase gene: Implications for mammalian metabolism
Radhika Ganu a, Timothy Garrow b, Markos Koutmos c, Laurie Rund d, Lawrence B. Schook a, d,
a Division of Nutritional Sciences, University of Illinois, Urbana, IL 61801, USA
b Department of Food Science and Human Nutrition, University of Illinois, Urbana, IL 61801, USA
... The mRNA secondary structures and free energy values were predicted using the MFOLD software
program (version 3.2; http://www.bioinfo.rpi.edu/applications/mfold)(Zuker, 2003). PolyAH software
(http://www.softberry.ru/berry.phtml) was used to detect poly A signal sites. ...
Journal of Investigative Dermatology
(6 December 2012) | doi:10.1038/jid.2012.458
A Genome-Wide Association Study in Caucasian Women Points Out a Putative Role of the STXBP5L Gene in Facial Photoaging
Clerc et al.,
... exploration we tried to look for modifications in mRNA expression levels (Yang et al., 2010; Nica
et al., 2011; Dixon et al., 2007; Zeller et al., 2010), splicing (NetGene2, http://www.cbs.dtu.dk/
services/NetGene2/), polyadenylation regions (polyAH, http://linux1.softberry.com/berry ...
PLoS ONE
7(5): e36151. doi:10.1371/journal.pone.0036151
3D Profile-Based Approach to Proteome-Wide Discovery of Novel Human Chemokines
Tomczak et al.,
Structural Bioinformatics, BIOTEC TU Dresden, Germany
Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany
... Exon organization, chromosomal location and proximity to known chemokine genes,
presence of a PolyA site (using Ensembl, Polyah.pl (softberry) and Polyadq ...
Biologia Plantarum
December 2012, Volume 56, Issue 4, pp 641-647 DOI
10.1007/s10535-012-0255-3
Identification and characterization of a novel gene encoding myb-box binding zinc finger protein in Gossypium arboreum
M. Zahur et al.,
1. Department of Biochemistry and Molecular Biology, University of Gujrat, Gujrat, 50700, Pakistan
... 1990). To find out the untranslated regions (UTRs), and Poly-A tail softberry server was used
(http://www.softberry.com/berry.phtml). The conceptual translation of nucleotide sequence
was made using the open reading frame finder program (ORF; ...
Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015
Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes
Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/
proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software
(http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...
Gene
Volume 483, Issues 1–2, 1 September 2011, Pages 49–53 DOI: 10.1016/j.gene.2011.05.014
Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid
Pardeep Kumar Bhardwaj a, b, 1, Jagdeep Kaur b, Ranbir Chander Sobti b, Paramvir Singh Ahuja a, Sanjay Kumar a
a Biotechnology Division, Institute of Himalayan Bioresource Technology, Council of Scientific and Industrial Research, P.O. Box 6, Palampur-176061, Himachal Pradesh, India
b Department of Biotechnology, Panjab University, Chandigarh-160014, India
... Secondary structure of deduced amino acids sequences was predicted by SOPMA (Self Optimized
Prediction Method with Alignment; http://npsa-pbil.ibcp.fr/). The polyadenylation signal was
identified using POLYAH server (http://linux1.softberry.com/berry.phtml). ...
J Acquir Immune Defic Syndr.
2011 March; 56(3): 279–284. DOI: 10.1097/QAI.0b013e318204982b
SCREENING LOW FREQUENCY SNPS FROM GENOME WIDE ASSOCIATION STUDY REVEALS A NEW RISK ALLELE FOR PROGRESSION TO AIDS
Le Clerc et al.,
1 Chaire de Bioinformatique, Conservatoire National des Arts et Metiers, Paris, France
2 Universite Paris 12, INSERM U955, Creteil, France
... we tried to identify putative modifications in mRNA expression as shown in Genevar 26 and Dixon
27 databases, in splicing (FastSNP 28 , http://fastsnp.ibms.sinica.edu.tw/pages/
input_CandidateGeneSearch.jsp/), in polyadenylation (polyAH, http://linux1.softberry.com/berry ...
African Journal of Biotechnology
Vol. 8 (24), pp. 7116-7124, 15 December, 2009
Cloning and characterization of peptidylprolyl
isomerase B in the silkworm, Bombyx mori
Hengchuan Xia et al.,
1Institute of Life Sciences, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, P. R. China
... Corporation. Bioinformatic analysis The DNAstar software was used to locate the open
reading frame (ORF) for B. mori PPIB. Poly-A signal was predicted by POLYAH
(http://www.softberry.com/cgi-bin/programs/promoter/polyah.pl). In ...
Genetics
Vol. 176, 2541-2549, August 2007
The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus
Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences,
South China Agricultural University, Guangzhou, 510642, China and
Key Biotechnology Laboratory of State Ethnic Affairs Commission,
College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China
... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH,
respectively (http://www.softberry.com/berry.html). ...
PROMH
PLoS ONE
5(9): e12599. doi:10.1371/journal.pone.0012599
The CC-NB-LRR-Type Rdg2a Resistance Gene Confers Immunity to the Seed-Borne Barley Leaf Stripe Pathogen in the Absence of Hypersensitive Cell Death
Bulgarelli et al.,
1 Genomic Research Center, CRA-GPG, Fiorenzuola d'Arda, Italy, 2 Department of Plant Microbe Interactions, Max Planck Institute fur Zuchtungsforschung, Koln, Germany
... The PromH program for the prediction of plant promoters (http://www.softberry.ru/berry.phtml?
group=programs&subgroup=promoter&topic=tssp , [47]) identified potential transcription factor
binding sites, a TATA box, and a likely promoter within the MITE sequence (data not ...
Nucleic Acids Research,
2003, Vol. 31, No. 13 3540-3545
PromH: promoters identification using orthologous genomic sequences
V. V. Solovyev* and I. A. Shahmuradov1
Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA 1 Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
*To whom correspondence should be addressed. Tel: +1 914 242 3592; Fax: +1 914 242 3593; Email: victor@softberry.com
Present address: I. A. Shahmuradov, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Received February 15, 2003; Revised and Accepted March 21, 2003
PlantProm
Plant Biotechnology Reports
2016, 10(4), 241-255. doi:10.1007/s11816-016-0400-0
Functional analysis of a cryptic promoter from Arabidopsis thaliana reveals bidirectionality
Parvathy, S. T., Srinivasan, R.
ICAR-National Research Centre on Plant BiotechnologyIndian Agricultural Research Institute
ICAR-Indian Institute of Oilseeds Research
... 2000; http://www.genomatix.de/), Gene2 Promoter (http://www.genomatix.de/), McPromoter (Ohler
et al. 2001; http://tools.genome.duke.edu/generegulation/McPromoter/) and PlantProm DB of
SoftBerry Inc. (Shahmuradov et al. 2002; http://www.softberry.com/). ...
Journal of Biotechnology
174 (2014) 49–56 DOI: 10.1016/j.jbiotec.2014.01.027
Strong seed-specific protein expression from the Vigna radiata storage protein 8SG promoter in transgenic Arabidopsis seeds
Chen M. X. et al.,
aCollege of Life Science and Technology, Jinan University, Guangzhou 510632, ChinabSchool of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, Chinaa
... HQ214071, Chen et al., 2013) and the 661-bp 5 -flanking sequence of 8SG? (GenBank accession
No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry.com) was
uti- lized to predict the transcription start site (TSS) and the TATA box. ...
Journal of biotechnology
2014, 174, 49-56. DOI: 10.1016/j.jbiotec.2014.01.027
Strong seed-specific protein expression from the Vigna radiata storage protein 8SG? promoter in transgenic Arabidopsis seeds.
Chen M. X. et al.,
a College of Life Science and Technology, Jinan University, Guangzhou 510632, China
b School of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, China
... HQ214071, Chen et al., 2013) and the 661-bp 5?-flanking sequence of 8SG? (GenBank
accession No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry.
com) was utilized to predict the transcription start site (TSS) and the TATA box. ...
Functional & integrative genomics
2014, 14(1), 111-125. DOI: 10.1007/s10142-013-0354-z
The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance
Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China
2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China
... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region
of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1.
softberry.com/berry.phtml). Promoter motifs were analyzed ...
Plant Molecular Biology Reporter
2014, 32(3), 664-678. DOI: 10.1007/s11105-013-0681-1
Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses
Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China
2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China
... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream
region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD)
(http://linux1.softberry.com/ berry.phtml). The promoter ...
Plant Molecular Biology Reporter
2014, 32(1), 198-208. DOI: 10.1007/s11105-013-0641-9
Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa
Rodriguez-Valentin R. et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico
2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico
... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried
by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/
berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...
Journal of Molecular Biology Research
Vol 3, No 1 (2013) DOI:10.5539/jmbr.v3n1p23
Characterization of Structure, Divergence and Regulation Patterns of Plant Promoters
Liu et al.,
... less often than transcribed gene sequences. A total of 3922 plant promoters in the
Plant Promoter Database (PlantProm DB; http://linux1.softberry.com/berry.phtml)
have been collected to date. Knowledge of the basic structural ...
Functional & Integrative Genomics
December 2013 DOI:10.1007/s10142-013-0354-z
The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance
Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China
2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China
... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region
of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1.
softberry.com/berry.phtml). Promoter motifs were analyzed ...
Plant Molecular Biology Reporter
November 2013 DOI:10.1007/s11105-013-0681-1
Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses
Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China
2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China
... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream
region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD)
(http://linux1.softberry.com/ berry.phtml). The promoter ...
Plant Molecular Biology Reporter
Volume 32, Issue 1 , pp 198-208 DOI:10.1007/s11105-013-0641-9
Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa
Rodriguez-Valentin, et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico
2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico
... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried
by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/
berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...
Australian Journal of Grape and Wine Research
19: 238–248. doi: 10.1111/ajgw.12023
Anthocyanin profile and gene expression in berry skin of two red Vitis vinifera grape cultivars that are sunlight dependent versus sunlight independent.
Zheng et al.,
1Beijing Key Laboratory of Grape Sciences and Enology, CAS Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing, China
2University of Chinese Academy of Sciences, Beijing, China
3Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China
... figure. There was no difference in the isolated promoter regions of VvMYBAb1 between Jingxiu
and Jingyan (Figure 5). Via a homology search of the isolated promoter regions using the
PlantProm (Plant Promoters database http://linux1.softberry.com/berry.phtml) and PlantDB ...
J. Exp. Bot.
(2012) 63 (8): 2985-3000. doi: 10.1093/jxb/ers009
The gene encoding Arabidopsis acyl-CoA-binding protein 3 is pathogen inducible and subject to circadian regulation
Shu-Xiao Zheng,
Shi Xiao* and
Mee-Len Chye†
School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China
... Results using SoftBerry PlantProm DB (http://www.softberry.com) (Shahmuradov et al., 2003)
and PlantCare (http://sphinx.rug.ac.be:8080/PlantCARE/) (Rombauts et al., 1999) revealed that
the putative transcription start site of ACBP3 maps 93 bp 5? to the translation initiation ...
Algorithms for Molecular Biology
2011, 6:19 http://www.almob.org/content/6/1/19
Prediction of plant promoters based on hexamers and random triplet pair analysis
A K M Azad1 , Saima Shahid2 , Nasimul Noman 3* and Hyunju Lee 1
1 Department of Information and Communications, Gwangju Institute of
Science and Technology, South Korea
3 Department of Electrical Engineering & Info Systems, Graduate School of
Engineering, University of Tokyo, Japan
... validated TSSs. This dataset was downloaded from the recent release (2009.02) of
PlantProm database http://linux1.softberry.com/berry. phtml?topic=plantprom&group=
data&subgroup=plant- prom on January 2nd, 2011. Additional ...
Genetics and Molecular Research
9 (4): 2349-2356 (2010)
Molecular and functional analysis of the poly-b-
hydroxybutyrate biosynthesis operon of Pseudomonas sp BJ-1
S.W. Zhu, Z.Y. Fang, H.Y. Jiang and B.J. Cheng
School of Life Science, Anhui Agricultural University, Hefei, China
... Predicted operons, promoters, and terminators were identified with the tools at Softberry
(http://www.softberry. com/berry.phtml). ... SW Zhu et al. Promoter analysis The promoter prediction
used the promoter database and the Softberry Plant Regula- tory motifs database. ...
Plant Physiology and Biochemistry
Volume 48, Issue 12, December 2010, Pages 945-951, doi:10.1016/j.plaphy.2010.09.005
Characterization and expression of the maize b-carbonic anhydrase gene repeat regions
Ursula Tems, James N. Burnell
Department of Biochemistry and Molecular Biology, James Cook University, Townsville, Queensland 4811, Australia
... gov). Nucleotide sequence up to 1,500 bp in the 5 flanking sequence of the CA2
gene was analyzed using a transcription factor database (PlantProm DB at
www.softberry.com) in conjunction with MacVectorTM software. 4.3. ...
BMC Plant Biol.
2009 Jul 17;9:93.
Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.
Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.
... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter
recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih.
gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...
Journal of Cereal Science
Volume 50, Issue 3, November 2009, Pages 324-331
Isolation and characterisation of a xylanase inhibitor Xip-II gene from durum wheat
Elliott et al.,
aInstitute of Food Research (IFR), Norwich Research Park, Colney, Norwich NR4 7UA, UK
bUniversita degli Studi della Tuscia, Dipartimento di Agrobiologia e Agrochimica, via San Camillo de Lallis, 01100 Viterbo, Italy
... Analysis of the 3'UTR by PlantProm DB (Shahmuradov et al., 2003) (http://www.softberry.
com) revealed the presence of a single putative polyadenylation sequence (AATAAAA),
starting 55 bp downstream of the TGA termination codon (Fig. S1). ...
Nucleic Acids Research
2006 34(19):e126; doi:10.1093/nar/gkl522
Robust analysis of 5'-transcript ends (5'-RATE): a novel technique for transcriptome analysis and genome annotation
Malali Gowda, Haumeng Li, Joe Alessi1, Feng Chen1, Richard Pratt2 and Guo-Liang Wang*
Department of Plant Pathology, The Ohio State University Columbus, OH 43210, USA 1 US DOE Joint Genome Institute, Walnut Creek CA 94598, USA 2 Department of Horticulture and Crop Science, Ohio Agricultural Research and Development Center, The Ohio State University Wooster, OH 44691, USA
... such as the TATA box and other cis-acting elements were predicted using a PlantProm
DB program (http://mendel.cs.rhul.ac.uk and http://www.softberry.com) (20). ...
Genetics: Published Articles Ahead of Print,
published on September 19, 2005 as 10.1534/genetics.105.044727
Molecular characterization of the major wheat domestication gene Q
Kristin J. Simons*, John P. Fellers‡, Harold N. Trick*, Zengcui Zhang§, Yin-Shan Tai, Bikram
S. Gill*, and Justin D. Faris
*Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University,
Manhattan, KS 66506
... searches of plant promoter databases PlantCARE (http://intra.psb.ugent.be:8080/
PlantCARE/index.html), PlantProm (http://www.softberry.com), ...
Annals of Botany
2005 96(4):669-681; doi:10.1093/aob/mci219
Detection and Preliminary Analysis of Motifs in Promoters of Anaerobically Induced Genes of Different Plant Species
BIJAYALAXMI MOHANTY1,*, S. P. T. KRISHNAN1, SANJAY SWARUP2 and VLADIMIR B. BAJIC1
1 Knowledge Extraction Laboratory, Institute for Infocomm Research, 21 Heng Mui Keng Terrace, Singapore 119613 and 2 Department of Biological Sciences, National University of Singapore, Singapore
... Promoter sequences Plant promoter sequences were extracted from
SoftBerry's Plant Promoter Database (PPD) (Shahmuradov et al., 2003 Go ), the Eukaryotic ...
Surgery Today
Volume 34, Number 12 / December, 2004 pp. 981-986
Role of Hypermethylation on Carcinogenesis in the Pancreas
Tamotsu Kuroki 1 Yoshitsugu Tajima 1 and Takashi Kanematsu 1
(1) Department of Surgery, Nagasaki University, Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki 852-8501, Japan
... of Bioinformatics and http://www.isrec.isb-sib.ch/ssa Swiss Institute for Experimental
Cancer Research, Eukaryotic Promoter Database Softberry, Promoter and ...
Nucleic Acids Research
2003, Vol. 31, No. 1 114-117
PlantProm: a database of plant promoter sequences
Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA
... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based
on discriminant analysis has been created by Softberry Inc. ...
RegSite
Plant Molecular Biology Reporter
2014, 32(2), 372-381. DOI: 10.1007/s11105-013-0657-1
Initiation of Flowering in Protea compacta x Protea neriifolia Hybrid ‘Carnival’Coincides with Expression of the FLOWERING LOCUS THomologue
Smart M., Roden L. C.
1. Department of Molecular and Cell Biology, University of Cape Town, Private Bag, Rondebosch, 7701, Cape Town, South Africa
2. Institute for Microbial Biotechnology and Metagenomics, Department of Biotechnology, University of the Western Cape, Bellville, 7535, Cape Town, South Africa
... In silico analyses of the 5? upstream region of ProFT were performed using the RegSite Plant
database (SoftBerry, Inc., NY, USA), to predict the transcrip- tion start site (TSS) and promoter
position, and the PlantCARE database (Lescot et al. 2002) and PLACEDB (Higo et al. ...
Plant Molecular Biology Reporter
Volume 30, Issue 1 , pp 131-138 DOI
10.1007/s11105-011-0319-0
Isolation and Partial Characterization of an R2R3MYB Transcription Factor from the Bamboo Species Fargesia fungosa
Juan Wang (1)
Jing Wang (1)
Huaibi Zhang (2)
Yuming Yang (1)
Kevin M. Davies (2)
1. Southwest Forestry University, Bailongsi 300, Kunming, Yunnan, China
2. New Zealand Institute for Plant & Food Research Limited, Private Bag, 11600, Palmerston North, New Zealand
... PLANTCARE (Lescot et al. 2002, with additional data from El-Shehawi et al. 2011)
and RegSite Plant DB (www. softberry.com) databases. The proximal 1 kb region
contained several notable sequence motifs (Fig. 2 and Table 1 ...
Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x
Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)
Xia YANG 1,
Hong CUI 2,
Zu-Li YUAN 2,
Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China
2 Henan Agricultural University, Zhengzhou 450002, China
... To predict the promoter regions and the transcription start sites, genomic regions upstream of
the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region
and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ...
SCIENCE CHINA Life Sciences
Volume 53, Number 11, 1315-1321, DOI: 10.1007/s11427-010-4079-0
Expression pattern and core region analysis of AtMPK3 promoter in response to environmental stresses
Fei Gao, Qi Su, YunLiu Fan and Lei Wang
... There are several plant-specific promoter databases with information on cis-acting elements,
which control the initia- tion of transcription by binding corresponding nuclear fac- tors. These
databases include PlantCARE [23], RegSite (http://softberry. ...
Methods Mol Biol.
2010;674:57-83
Identification of promoter regions and regulatory sites
Solovyev VV, Shahmuradov IA, Salamov AA.
Department of Computer Science, Royal Holloway, London, UK.
... Over 7,900 sequences of transcrip- tional elements have been described in
TRANSFAC database (21, 22). The other collections of functional motifs are TRRD
(23), PlantCARE (24), PLACE (25), RegSite (http://softberry. com ...
Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821
Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines
Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China
... was based on program of ScanWM-PL and accession numbers of regula- tion factors
were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...
Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072
The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants
S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia
... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters
(using the RegSite plant database, Softberry, http://www.softberry.com). ...
Molecular Plant Pathology
Volume 8 Issue 3 Page 307-319, May 2007
Molecular and cytological responses of Medicago truncatula
to Erysiphe pisi
DAWN FOSTER-HARTNETT et al.,
Department of Plant Pathology, University of Minnesota, 495 Borlaug Hall, St Paul, MN 55108, USA
... groups of promoters using (1) > 20 published motifs associated with plant defence,
(2) 803 regulatory motifs present in the Softberry RegSite PlantDB database ...
Cell Res.
2006 Aug;16(8):731-9.
Tissue differential expression of lycopene beta-cyclase gene in papaya.
Skelton RL, Yu Q, Srinivasan R, Manshardt R, Moore PH, Ming R.
1Hawaii Agriculture Research Center, Aiea, HI 96701, USA.
... upstream sequence. Two possible sites of the cpLCY-B promoter were predicted
using RegSite Plant DB (www.softberry.com). The first ...
ScanWM-PL
PLOS ONE
July 30, 2013DOI: 10.1371/journal.pone.0069124
The LuWD40-1 Gene Encoding WD Repeat Protein Regulates Growth and Pollen Viability in Flax (Linum Usitatissimum L.)
Santosh Kumar, Mark C. Jordan, Raju Datla, Sylvie Cloutier
Department of Plant Science, University of Manitoba, Winnipeg, Manitoba, Canada, Cereal Research Centre, Agriculture and Agri-Food Canada, Winnipeg, Manitoba, Canada
... Promoter analysis was performed with PLAnt Cis-acting regulatory DNA Elements (PLACE) [42],
PLANT Promoter Analysis Navigator (PlantPAN) and Weight Matrix patterns of PLant regulatory
sequences (ScanWM-PL) available on the Softberry web portal (http://linux1.softberry ...
Journal of Integrative Plant Biology
Volume 54, Issue 1, pages 15–32, January 2012 DOI: 10.1111/j.1744-7909.2011.01084.x
Characterization of the Tomato Prosystemin Promoter: Organ-specific Expression, Hormone Specificity and Methyl Jasmonate Responsiveness by Deletion Analysis in Transgenic Tobacco Plants
Hamlet Aviles-Arnaut, John Paul Delano-Frier
Center of Research and Advanced Studies (Cinvestav) at Irapuato: Unit for Plant Biotechnology and Genetic Engineering, Irapuato, Gto., Mexico, PO Box 36821 Mexico
... (www.dna.affrc.go.jp/PLACE/), PlantCARE (http://bioinformatics.SlPSb.ugent.be/wetools/
plantcare/html/), the RegSite Plant Database (www.softberry.com) and the Genomatix ... compared
against known cis-regulatory elements with the ScanWM-P software (www.softberry.com). ...
Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24
Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar
Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.
... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb.
ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry,
http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ...
Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394
Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar
Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China
... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as
UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to
predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...
Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821
Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines
Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China
... was based on program of ScanWM-PL and accession numbers of regula- tion factors
were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...
ScanWM-P
Forestry Studies in China
June 20, 2007, pp. 95-106
Isolation and analysis of a TIR-specific promoter from poplar
Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China
... out with the BLAST search program in NCBI Transcriptional start site of the obtained
DNA sequence, was predicted with the online program TSSP in Softberry. ...
... Cis-acting regulatory elements located at the promoter region were predicted by
using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...
TSSP
Organ Cult
(2016) 126: 469. doi:10.1007/s11240-016-1015-4
Characterization of a trichome-specific promoter of the aldehyde dehydrogenase 1 (ALDH1) gene in Artemisia annua
Liu, M. et al.,
Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D CenterShanghai Jiao Tong University
Department of Chemistry and Biomedical SciencesLinnaeus University
... The cis-acting elements and ATG start codon are in box. We used the TSSP software
(http://?linux1.?softberry.?com/?berry.?phtml??topic=?tssp&?group=?programs&?
subgroup=?promoter) to search more information about this promoter. ...
Biotechnology and Applied Biochemistry.
2016 DOI: 10.1002/bab.1520
Molecular cloning and characterization of the promoter of aldehyde dehydrogenase gene from Artemisia annua
Wang, H. et al.,
Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing, China
School of Chemistry and Chemical Engineering, Chongqing University of Science and Technology, Chongqing, China
... element of the ALDH1 promoter was analyzed by the TSSP software (http:// http://linux1.softberry.
com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) [24], the PlantCARE software
(http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and the PLACE ...
Genes & Genomics
2016, 38(4), 377-387. DOI: 10.1007/s13258-015-0378-y
Genomic identification of microRNA promoters and their cis-acting elements in Populus
Chen, M., Wei, M., Dong, Z., Bao, H., Wang, Y.
1. National Engineering Laboratory for Tree Breeding, Beijing Forestry University, Beijing, 100083, People’s Republic of China
2. Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, People’s Republic of China
... Prediction and characterization of TSSs, TATA box- like sequences With the obtained
sequences, TSSs and TATA box-like sequences were predicted using the plant promoter
identifi- cation program, TSSP (http://linux1.softberry.com/berry. ...
Plant Physiology
2016 Vol. 162, No. 2 (June 2013), pp. 885-896 http://www.jstor.org/stable/41943270
The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear
Wang Z. et al.,
... name proPcMYBlO (JX403962). It contained a core promoter at position -60 bp and
an enhancer promoter at position -675 bp (as analyzed by TSSP software on softberry;
http:/ /linuxl. softberry.com/berry.phtml). Be- sides the ...
Molecular Genetics and Genomics
2016, Volume 291, Issue 2 , pp 935-941 DOI 10.1007/s00438-015-1159-7
Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes
Ranade, S. S., Garcia-Gil, M. R., Rossello, J. A.
1. Department of Forest Genetics and Plant Physiology, Umea Plant Science Centre, Swedish University of Agricultural Sciences, 901 83, Umea, Sweden
2. Jardi Botanic, Universidad de Valencia, c/Quart 80, 46008, Valencia, Spain
... Upstream regions were also screened for the pres- ence of promoters, TATA boxes and enhancers
using the TSSP/Prediction of Plant Promoters (TSSP: Transcription Start Sites in Plants, SoftBerry:
http://www.softberry.com, Shahmuradov et al. 2003) web interface. Results ...
Journal of Zhejiang University SCIENCE B
2014, 15(2), 125-132. DOI:10.1631/jzus.B1300179
Analysis of promoters of microRNAs from a Glycine max degradome library
Han, Y. Q. et al.,
1. College of Life Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, 163319, China
2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... Promoters were predicted by the plant promoter identification pro- gram TSSP
(http://www.softberry.com), which is designed for predicting plant Pol II promoters
(Shahmuradov et al., 2005). The predictions were obtained at the default TSSP settings. ...
Biochemical and biophysical research communications
2014, 444(4), 676-681. DOI: 10.1016/j.bbrc.2014.01.171
MicroRNA mediates DNA methylation of target genes
Hu, W., Wang, T., Xu, J., Li, H.
a College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang 310058, China
b Zhejiang-California International Nanosystems Institute, Zhejiang University, Hangzhou, Zhejiang 310058, China
... 0). 2.2. DNA methylation pattern of MIRs. 1 or 2 kb upstream and downstream
sequences of pre-miRNA were retrieved from rice genome. Promoters of MIRs were
predicted by TSSP (http://linux1.softberry.com/berry.phtml). Then ...
Euphytica
2014, 196(3), 365-374. DOI: 10.1007/s10681-013-1038-4
Variation in GmAOS1 promoter is associated with soybean defense against insect attack
Wang H. et al.,
1. Soybean Research Institute, Nanjing Agricultural University, National Center for Soybean Improvement, Ministry of Agriculture, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing, 210095, Jiangsu, China
... 1997 ). SoftBerry-TSSP (http://?linux1.?softberry.?com/?berry.?phtml) was used to predict
the position of promoter (Shahmuradov et al. 2003 ) and PlantCARE was used to predict
the cis-regulating elements for GmAOS1 (Lescot et al. 2002 ). ...
Biologia Plantarum
2014, 58(2), 247-255. DOI: 10.1007/s10535-014-0393-x
Structural and expression analyses of three PmCBFs from Prunus mume
Guo C. et al.,
1. Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, 430070, P.R. China
... The promoter region of PmCBFb was identified by the prediction of plant promoters (TSSP)
analysis in softberry database (http:// linux1.softberry. com/berry.phtml). The cis-element
analysis was performed by signal scan searching in the PLACE ...
Plant Molecular Biology Reporter
2014, 32(1), 82-91. DOI: 10.1007/s11105-013-0603-2
Jiang, W., Lu, X., Qiu, B., Zhang, F., Shen, Q., Lv, Z., ... & Tang, K. (2014). Molecular cloning and characterization of a trichome-specific promoter of artemisinic aldehyde ?11 (13) reductase (DBR2) in Artemisia annua.
Jiang W. et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were
analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE
software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...
Open Journal of Genetics
Vol.4 No.3(2014), Article ID:47053,12 pages DOI:10.4236/ojgen.2014.43020
Microsatellites and the Polyploid Guarana Plant: Diversity under a Sea of Alleles
da Silva Angelo P. C. et al.,
1Embrapa Western Amazon, Manaus, Brazil
2CNPq Fellowship at Embrapa Western Amazon, Manaus, Brazil
...On the other hand, the same TA repeat block displays a predicted potential to function as a
TATA box (Softberry-TSSP) and to promote the transcription of smRNAs located downstream. ...
...Finally, there is at least one predicted pre-miRNA
(Softberry-findmirna) in the MFT 3’-UTR, which could generate 21 or 24 nucleotides long mature miRNAs with the sequence 5’-ugccaggcguaauauauauau(aua)-3’ (Figure 4(b)). ...
Gene
2014, 545(1), 45-55. Volume DOI: 10.1016/j.gene.2014.05.008
Characterization of the promoter and 5?-UTR intron of oleic acid desaturase (FAD2) gene in Brassica napus
Xiao G. et al.,
a Key Laboratory of Oil Crop Biology of Ministry of Agriculture, Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, Hubei 430062, China
b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, PR China
... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml)
and Berkeley Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.
html) web servers; the known cis-acting elements were analyzed through a web ...
Scientia Horticulturae
2014, 175, 16-26. DOI: 10.1016/j.scienta.2014.05.032
Comparison of anthocyanin components, expression of anthocyanin biosynthetic structural genes, and TfF3? H1 sequences between Tulipa fosteriana‘Albert heijn’and its reddish sport
Yuan, Y., Ma, X., Tang, D., Shi, Y.
School of Agriculture & Biology, Shanghai Jiao Tong University, Shanghai 200240, China
... The putative transcriptional start site (TSS) and cis-elements in the 5?flanking region of
TfF3?H1AH were predicted by the Softberry database (http://linux1.softberry.com/berry.phtml?
topic=tsssp&group=programs&subgroup=promoter) and the PLACE database (http://www.dna ...
Planta
Volume 237, Issue 4 , pp 1149-1161 DOI:10.1007/s00425-012-1833-5
Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum)
Vitthal T. Barvkar et al.,
1. Biochemical Sciences Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Plant Biotechnology Institute, NRC, 110 Gymnasium Place, Saskatoon, SK, S7N 0W9, Canada
... This sequence was used for prediction of transcription start sites (TSS) using the TSSP
(http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter)
program from the softberry package (Solovyev and Salamov 1997 ). ...
Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6
DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic
Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland
2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA
... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures
in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry),
3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...
Tree Genetics & Genomes
October 2013, Volume 9, Issue 5, pp 1369-1381 DOI:10.1007/s11295-013-0640-x
Nucleotide sequence analysis of two lignin genes in Acacia auriculiformis ? Acacia mangium hybrid for enhancement of wood pulp quality
A. Sukganah, C. Y. Choong, J. Russell, D. Neale, R. Wickneswari
1. School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor Darul Ehsan, Malaysia
2. The James Hutton Institute, Invergowrie, Dundee, DD2 5DA, Scotland, UK
... The promoter regions were analysed using Softberry-TSSP (http://linux1.softberry.com/
berry.phtml) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/
html) programmes to predict the core ele- ments in the promoters. ...
Plant Molecular Biology Reporter
May 2013 DOI: 10.1007/s11105-013-0603-2
Molecular Cloning and Characterization of a Trichome-Specific Promoter of Artemisinic Aldehyde ?11(13) Reductase (DBR2) in Artemisia annua
Jiang et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were
analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE
software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...
Protoplasma
Volume 250, Issue 2 , pp 565-576 DOI:10.1007/s00709-012-0442-2
Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum
Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Further the upstream flanking region was used for identification of RNA pol II binding site
and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml?
Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...
Protoplasma
Volume 250, Issue 1 , pp 333-345 DOI:10.1007/s00709-012-0417-3
Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera
Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding
site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml?
topic0tssp&group0 programs&subgroup0promoter) database. ...
Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 114, Issue 3 , pp 373-383 DOI:10.1007/s11240-013-0332-0
Petal-specific activity of the promoter of an anthocyanidin synthase gene of tobacco (Nicotiana tabacum L.)
Lim et al.,
1. National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Republic of Korea
2. Department of Genetic Engineering and Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Republic of Korea
... The 5?-upstream region was analyzed using the PLACE (http://www.dna.affrc.go.jp/PLACE/
signalscan.html), PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and
Softberry (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup ...
Functional & Integrative Genomics
Volume 13, Issue 2 , pp 167-177 DOI:10.1007/s10142-013-0310-y
A root-specific wall-associated kinase gene, HvWAK1, regulates root growth and is highly divergent in barley and other cereals
Ravneet Kaur, Kashmir Singh, Jaswinder Singh
1. Plant Science Department, McGill University, 21 111 Rue lakeshore, Ste Anne de Bellevue, QC, H9X 3V9, Canada
... 1999) and TSSP program (prediction of plant promoters, RegSite Plant DB, Softberry Inc.). ...
1). Various motifs and transcriptional factor binding sites were predicted using both the
programs against the Softberry Regsite-Plant and PLACE databases. ...
Plant Physiology
June 2013 vol. 162 no. 2 885-896 DOI:10.?1104/?pp.?113.?214700
The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear
Wang et al.,
Laboratory of Fruit Cell and Molecular Breeding, College of Agronomy and Bio-tech, China Agricultural University, Beijing 100193, China (Z.W., D.M., TZ.L.)
Research Institute of Pomology, Chinese Academy of Agricultural Sciences, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.)
Shenyang Agricultural University, Shenyang 110866, China (A.W., TL.L.); and
Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Germplasm Resources Utilization), Ministry of Agriculture, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.)
... name proPcMYB10 (JX403962). It contained a core promoter at position ?60 bp
and an enhancer promoter at position ?675 bp (as analyzed by TSSP software on
softberry; http://linux1.softberry.com/berry.phtml). Besides the ...
Gene
Volume 531, Issue 1, 15 November 2013, Pages 15–22 DOI:10.1016/j.gene.2013.08.060
Identification of abiotic stress miRNA transcription factor binding motifs (TFBMs) in rice
Rama Devi et al.,
a Crop Improvement section, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India
b Department of Statistics, Acharya N. G. Ranga Agricultural University, Rajendranagar, Hyderabad 500030, India
... org/gb2/gbrowse/maize_v2/). The TSS and TATA-box predictions were made using
TSSP web tool (http://linux1.softberry.com/berry.phtml? topic = tssp& group =
programs&subgroup = promoter). Putative promoter sequences ...
Journal of Integrative Agriculture
Volume 12, Issue 6, June 2013, Pages 962–970 DOI:10.1016/S2095-3119(13)60473-6
Molecular Cloning and Characterization of a Novel Gene Involved in Fatty Acid Synthesis in Brassica napus L
XIAO et al.,
a The Oil Crops Research Institute/National Oil Crops Improvement Center, Changsha 410128, P.R. China
b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, P.R. China
... pI and MW were predicted using the DNAMAN program. Promoter prediction was performed
on the SoftBerry TSSP (http://linux1.softberry. com/berry.phtml) and Berkeley Neural Network
Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter. ...
J. Agric. Food Chem.
2013, 61 (18), pp 4396–4405 DOI: 10.1021/jf400776m
Differential Expression of Genes Encoding Acid Invertases in Multiple Shoots of Bamboo in Response to Various Phytohormones and Environmental Factors
Shu-Chien Liao †, Choun-Sea Lin ‡, Ai-Yu Wang *†, and Hsien-Yi Sung *†
† Department of Biochemical Science and Technology, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 106, Taiwan
‡ Agricultural Biotechnology Research Center, Academia Sinica, No. 128, Sec. 2, Academia Road, Nankang, Taipei 115, Taiwan
... Sequence Analysis The potential transcription initiation site and the putative regulatory
cis-elements and conserved motifs were analyzed using the online TSSP program
(http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) and ...
PloS one
August 08, 2013DOI: 10.1371/journal.pone.0071435
Characterization and Evolution of Conserved MicroRNA through Duplication Events in Date Palm (Phoenix dactylifera)
Xiao et al.,
Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan, China
School of Agriculture and Food Sciences and Centre for Integrative Legume Research, The University of Queensland, Brisbane, Australia
... Similarities between duplicated pre-miRNA sequences were analyzed by Blast2. Promoters
(TATA box) and enhancers of miRNA genes were predicted from regions 1 kb upstream of
pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...
J. Exp. Bot.
(2013) 64 (11): 3299-3312. doi: 10.1093/jxb/ert183
Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts
Wen et al.,
The Applied Plant Genomics Laboratory of Crop Genomics and Bioinformatics Center, and National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095 Jiangsu, China
... Positive clones were sequenced at Takara Bio, Inc., Dalian, China. Basic sequence analysis
was conducted with Macvector 10.0 (Accelrys, Oxford, USA). The transcription start site (TSS)
was predicted with the plant promoter prediction program TSSP (http://www.softberry.com). ...
Plant Molecular Biology Reporter
Volume 31, Issue 5 , pp 1089-1099 DOI:10.1007/s11105-013-0578-z
LtuCAD1 Is a Cinnamyl Alcohol Dehydrogenase Ortholog Involved in Lignin Biosynthesis in Liriodendron tulipifera L., a Basal Angiosperm Timber Species
Xu et al.,
1. Department of Genetics and Biochemistry, Clemson University, 130 McGinty Court, Robert F. Poole Agricultural Center, Room 153, Clemson, SC, 29634, USA
2. Bioenergy Systems Research Institute, University of Georgia, Athens, GA, 30602, USA
... The TSSP/Prediction of Plant Promoters (Solovyev and Shahmuradov 2003) (http://
softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) was used
to predict the potential Plant Mol Biol Rep Page 4. transcription start site. ...
Plant Molecular Biology Reporter
October 2013 DOI:10.1007/s11105-013-0656-2
Characterization of the Promoter of Artemisia annua Amorpha-4,11-diene Synthase (ADS) Gene Using Homologous and Heterologous Expression as well as Deletion Analysis
Zhu et al.,
1. Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China
2. Laboratory of Plant Biotechnology, College of Life and Environment Sciences, Shanghai Normal University, Shanghai, 200234, People’s Republic of China
... As TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=
promoter) predicted, three promoter/enhancer(s) are located at 2868 LDF-, 1247 LDF-, and 774
LDF-, respectively; the 2868 LDF- site is then considered as the transcription start site (+1 ...
Plant Pathology
doi: 10.1111/ppa.12155
Construction of a cassava PR protein-interacting network during Xanthomonas axonopodis pv. manihotis infection.
Roman et al.,
Manihot-Biotec Group, Department of Biology, Universidad Nacional de Colombia, Bogota D.C, Colombia
... For analysis of the promoter regions, 2 kp of upstream sequence of the HEV, CHI, SiR
genes, 18 HEV interactors, five CHI interactors and a SiR interactor, were used in the
tssp program (http://linux1.softberry.com/berry.phtml). Results. ...
Planta
Volume 237, Issue 6 , pp 1495-1508 DOI:10.1007/s00425-013-1860-x
Polymorphism of TaSAP1-A1 and its association with agronomic traits in wheat
Chang et al.,
1. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... A putative transcription start site (TSS) was identified at ?1,030 bp using the TSSP
software available at site http://www.softberry.com (Fig. 1b). Fig. 1 a Isolation of the
sequence surrounding TaSAP1 using primer pair Sap2F and Sap2R. ...
PloS one
November 22, 2013DOI: 10.1371/journal.pone.0080643
Studies on the Expression of Sesquiterpene Synthases Using Promoter-b-Glucuronidase Fusions in Transgenic Artemisia annua L
Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
Department of Chemistry and Biomedicine, Linnaeus University, Kalmar, Sweden
... The transcription start site (TSS) (labeled +1) of the cloned promoters was predicted using the
TSSP software (http://linux1.soft-berry.com/berry.phtml) as summarized in Table 2. Using the
PLACE (http://www.dna.affrc.go.jp/PLACE/) and PlantCARE (http://bioinformatics.psb.ugent ...
New Phytologist
198: 1191–1202. doi: 10.1111/nph.12207
AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea
Lu et al.,
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China
... To examine the expression pattern of AaORA in detail, we cloned an 1193-bp promoter sequence
(JQ797714) of AaORA by genomic walking. The transcription start site (TSS) of the cloned
promoter was predicted using TSSP software (http://linux1.softberry.com/berry.phtml). ...
Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI:10.1007/s11033-012-2169-8
Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree
Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India
... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter)
program pre- dicted promoter position has been numbered ?1 and the upstream sequences have
been numbered from -1 whereas the downstream nucleotides have been ...
Journal of Genetics,
Vol. 91, No. 3, December 2012
Genomewide analysis of intronic microRNAs in rice and Arabidopsis
G. D. YANG, et al.,
State Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University,
Tai’an, Shandong 271018, People’s Republic of China
... The upstream sequences were anal- ysed by two popular promoter prediction tools
for plant genes: TSSP (http://linux1.softberry.com/) and Promoter Scan (http://www-
bimas.cit.nih.gov/molbio/proscan/) with the default parameters. ...
J. Exp. Bot.
(2012) 63 (17): 6267-6281.
doi: 10.1093/jxb/ers278
GbTCP, a cotton TCP transcription factor, confers fibre elongation and root hair development by a complex regulating system
Juan Hao et al.,
National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China
... Gene-specific primers were designed for genome walking (Supplementary Table S1), and
promoter prediction software TSSP (http://linux1.softberry.com/berry.phtml?topic=tssp&group=
programs&subgroup=promoter) was used to predict the GbTCP transcription initiation site. ...
Functional & Integrative Genomics
November 2012, Volume 12, Issue 4, pp 649-658 DOI: 10.1007/s10142-012-0282-3
Novel miRNAs in the control of arsenite levels in rice
Qingpo Liu
1. College of Agriculture and Food Science, Zhejiang A & F University, Lin’an, Hangzhou, 311300, People’s Republic of China
... al. (2007). If the pre-miRNAs were located in intronic or exonic regions, the upstream
sequences of the host genes were adopted. The software TSSP (http://linux1.softberry.
com/berry.phtml? topic0tssp&group0programs&subgroup0promoter ...
Molecular Biotechnology
10.1007/s12033-012-9583-y
Efficient Regeneration Potential is Closely Related to Auxin Exposure Time and Catalase Metabolism During the Somatic Embryogenesis of Immature Embryos in Triticum aestivum L
She et al.,
1. Key Laboratory of Crop Genetics and Breeding, Ministry of Agriculture, National Key Facility of Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China
2. National Key Facility of Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Zhong Guan Cun South St, Haidian District, Beijing, 100081, China
... ugent.be/webtools/plantcare/html/, Lescot et al. [36]). TSSP software was used to predict
TATA-box and transcriptional start site (TSS) (http://linux1.softberry.com/berry.phtml?
topic= tssp&group=programs&subgroup=promoter). Results ...
BMC Plant Biology
2012, 12:155 doi:10.1186/1471-2229-12-155
Intraspecific sequence comparisons reveal similar rates of non-collinear gene insertion in the B and D genomes of bread wheat
Bartos et al.,
1 Centre of the Region Hana for Biotechnological and Agricultural Research, Institute of Experimental Botany, Sokolovska 6, Olomouc, CZ-77200, Czech Republic
2 Institute of Molecular Genetics, Videnska 1083, Praha, CZ-14220, Czech Republic
... We extracted 1 kb sequence upstream to start codon for each coding sequence found at 3DS-
and 3B-specific loci. We predicted polymerase II promoters, transcription start sites and
TATA-box positions using TSSP [31] at http://linux1.softberry.com/berry.phtml webcite. ...
Plant Molecular Biology
Volume 81, Issue 1-2 , pp 119-138 DOI: 10.1007/s11103-012-9986-y
Trichome-specific expression of the amorpha-4,11-diene 12-hydroxylase (cyp71av1) gene, encoding a key enzyme of artemisinin biosynthesis in Artemisia annua, as reported by a promoter-GUS fusion
Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
1. School of Natural Sciences, Linnaeus University, 39182, Kalmar, Sweden
... At present, we cannot conclude if the four cyp71av1 genes encode proteins of different
length. Attempts to predict the transcription start site (TSS) of the cyp71av1 promoters using
the TSSP software (http://linux1.softberry.com/berry.phtml) failed. ...
Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI: 10.1007/s11033-012-2169-8
Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree
Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India
2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India
... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter)
program pre- dicted promoter position has been numbered ?1 and the upstream sequences have
been numbered from -1 whereas the downstream nucleotides have been ...
PLoS ONE
7(9): e46021. doi:10.1371/journal.pone.0046021
A Candidate-Gene Association Study for Berry Colour and Anthocyanin Content in Vitis vinifera L.
Cardoso S, Lau W, Eiras Dias J, Fevereiro P, Maniatis N
1 Laboratory of Plant Cell Biotechnology, Instituto de Tecnologia Quimica e Biologica, Oeiras, Portugal, 2 Department of Genetics, Evolution and Environment, University College London, London, United Kingdom,
... promoter region. According to the TSSP promoter prediction program for plant genes
available on SoftBerry network server (http://www.softberry.com), s90 is located only
4 bp upstream of the transcription start site (TSS). Two ...
Protoplasma
May 2012 DOI
10.1007/s00709-012-0417-3
Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera
Himanshu Tak hsjtak@barc.gov.in (1)
Minal Mhatre minalmhatre@yahoo.com (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding
site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml?
topic0tssp&group0 programs&subgroup0promoter) database. ...
Biologia Plantarum
Volume 56, Issue 4 , pp 699-704 DOI
10.1007/s10535-012-0132-0
Salt- and osmotic stress-induced choline monooxygenase expression in Kochia scoparia is ABA-independent
E. B. Kalinina (1)
B. K. Keith (1)
A. J. Kern (2)
W. E. Dyer (1)
1. Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT, 59717, USA
2. Department of Biology, Northland College, Ashland, WI, 54806, USA
... was conducted by Geneway Company (Hayward, CA, USA) using lambda forward and reverse
primers (Promega) and sequence-specific primers designed using Primer3 software (Table 1).
Canonical promoter sequences were identified using the Softberry TSSP package ...
Protoplasma
August 2012 DOI
10.1007/s00709-012-0442-2
Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum
Himanshu Tak (1)
Minal Mhatre (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Further the upstream flanking region was used for identification of RNA pol II binding site
and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml?
Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...
BMC Plant Biology
2012, 12:166 doi:10.1186/1471-2229-12-166
The study of two barley Type I-like MADS-box genes as potential targets of
epigenetic regulation during seed development
Aliki Kapazoglou et al.,
1 Institute of Agrobiotechnology (INA), CERTH, Thermi-Thessaloniki GR-
57001, Greece
2 Department of Genetics and Plant Breeding, Aristotle University of
Thessaloniki, Thessaloniki GR-54124, Greece
... The prediction of the putative cis acting elements was accomplished using the TSSP /Prediction
of PLANT Promoters algorithm (Using RegSite Plant DB, Softberry Inc.) in the SoftBerry database
(http://linux1.softberry.com/cgi-bin/programs/promoter/tssp.pl) and PlantCARE ...
Plant Molecular Biology Reporter
June 2012, Volume 30, Issue 3, pp 556-565 DOI
10.1007/s11105-011-0364-8
The Role of a Gibberellin 20-Oxidase Gene in Fruit Development in Pepper (Capsicum annuum)
Aphrodite Tsaballa (1)
Konstantinos Pasentsis (2)
Athanasios S. Tsaftaris (1) (2)
1. Department of Genetics and Plant Breeding, School of Agriculture, Aristotle University of Thessaloniki, Thessaloniki, 541 24, Greece
2. Institute of Agrobiotechnology (INA), CERTH, 6th km Charilaou-Thermis Road, Thermi, 570 01, Greece
... quenced several times with diverse primer sets. The analysis of the 5? upstream
sequences was done using the TSSP/ Prediction of PLANT Promoters application
at Softberry (http://linux1.softberry.com/berry.phtml). Based ...
African Journal of Biotechnology
Vol.10 . (55), pp. 11477-11482, 21 September, 2011 DOI:
Characterization of upstream sequences from the 8S globulin gene of Vigna radiata
Yue-Ning Yang et al.,
Department of Biotechnology, Jinan University, Guangzhou 510632, China.
... PLACE (http://www.dna.affrc.go.jp/database/) was used for transcription elements prediction;
while transcription start site and TATA box were predicted with software TSSP (prediction of
start of transcription sequences) of Softberry (http://www.softberry.com). ...
PLoS ONE
(2011), 6(12): e28073. doi:10.1371/journal.pone.0028073
Evolution of MicroRNA Genes in Oryza sativa and Arabidopsis thaliana: An Update of the Inverted Duplication Model.
Zhang Y, Jiang W-k, Gao L-z
Plant Germplasm and Genomics Center, Kunming Institute of Botany, The Chinese Academy of Sciences, Kunming, China, Graduate School, Chinese Academy of Science, Beijing, China
... Promoters (TATA box) and enhancers of miRNA genes were
identified from upstream 1 kb regions of pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...
Plant Cell Rep.
2011 Apr;30(4):539-49. doi: 10.1007/s00299-010-0964-z.
Isolation and characterization of a rice glutathione S-transferase gene promoter regulated by herbicides and hormones
Hu et al.,
Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, 400044 Chongqing, People's Republic of China
... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml)
and Berkeley Neural Network Promoter Prediction (http:// www.fruitfly.org/seq_tools/promoter.
html) web servers. Construction of OsGSTL2 promoter::GUS fusions ...
Agricultural Sciences in China
Volume 10, Issue 9, September 2011, Pages 1336–1345
In silico Detection of Novel MicroRNAs Genes in Soybean Genome
Yong-xin LIU a, *, , , Wei CHANG a, *, Ying-peng HAN a, Quan ZOU b, Mao-zu GUO c, Wen-bin LI a
a Key Laboratory of Soybean Biology, Chinese Ministry of Education/Soybean Research Institute, Northeast Agricultural University, Harbin 150030, P.R.China
b School of Information Science and Technology, Xiamen University, Xiamen 361005, P.R.China
. al. 2005). TSSP of Softberry was adopted for supplemental predictions (http://www.
Softberry.com, Solovyev and Shahmuradov 2003). The distribution of novel miRNAs
was analyzed by Mapchart 2.1 (Voorrips 2002). Furthermore ...
Theoretical and Applied Genetics
Volume 122, Issue 1 , pp 211-223 DOI: 10.1007/s00122-010-1437-z
Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.)
Zhenqi Su, Chenyang Hao, Lanfen Wang, Yuchen Dong, Xueyong Zhang
1. Key Laboratory of Crop Germplasm Resources and Utilization, Ministry of Agriculture, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing, 100081, China
... The promoter elements were identified using the TSSP program (http://www.softberry.
com). ... The core elements of the promoter were predicted with the TSSP program (http://
www.softberry.com), and the TATA box was identified at ...
Plant Cell Reports
Volume 30, Issue 12 , pp 2187-2194 DOI: 10.1007/s00299-011-1124-9
Characterization of a chalcone synthase (CHS) flower-specific promoter from Lilium orential ‘Sorbonne’
Liu et al.,
1. College of Forestry, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China
3. Key Laboratory of Horticulture Plant Germplasm Utilization in Northwest China of Ministry of Agriculture, Yangling, 712100, Shaanxi, People’s Republic of China
... DQ471951). The putative transcription start site (TSS), predicted by the Softberry database
(http://linux1. softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter),
is located at 46 bp upstream of the ATG translation start codon. ...
Journal of Integrative Plant Biology
53: 814–823. doi: 10.1111/j.1744-7909.2011.01070.x
Induced Pib Expression and Resistance to Magnaporthe grisea are Compromised by Cytosine Demethylation at Critical Promoter Regions in Rice.
Li et al.,
1 Key Laboratory of Molecular Epigenetics of MOE and The Institute of Genetics & Cytology, Northeast Normal University, Changchun 130024, China
2 Department of Agronomy, Jilin Agricultural University, Changchun 130118, China
... By a computational program Softberry-TSSP (http://www.softberry.com), two TATA boxes at
positions 1 995 nt and 3 496 nt respectively, and two putative enhancers at positions 1 350 nt
and 3 630 nt respectively, were identified (Figure 2, upper panel), further verifying its identity ...
The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x
A soybean b-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses.
Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China
... accession number FJ461673). In silico analysis of the promoter sequence was
performed using the software programs tssp-tcm (Shahmuradov et al., 2005),
nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...
American Journal of Plant Sciences
Volume 2 Issue 4 Pages: 619-628 2011 DOI: 10.4236/ajps.2011.24073
Trichome-Specific Expression of Amorpha-4,11-Diene Synthase, a Key Enzyme of Artemisinin Biosynthesis in Artemisia annua L., as Reported by a Promoter-GUS Fusion
H Wang, L Olofsson, A Lundgren
Linnaeus University, Faculty of Science and Engineering, School of Natural Sciences
... The transcription start site (TSS) of the cloned promoter was predicted using the TSSP software
(http://linux1. softberry.com/berry.phtml). A putative TSS of ADS (la- beled +1 in Figure 1) was
predicted 51 bp upstream of the translation initiation ATG-codon. ...
Mol. Plant
(2011) 4 (2): 300-309. doi: 10.1093/mp/ssq076
Characterization of Xanthomonas oryzae-Responsive cis-Acting Element in the Promoter of Rice Race-Specific Susceptibility Gene Xa13
Ting Yuan, Xianghua Li, Jinghua Xiao and Shiping Wang 1
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... Promoter Sequence Analysis. The TATA boxes of promoters P Xa13 and P xa13 were predicted
using the computer programs TSSP provided at the Softberry website (www.softberry.com) and
PROSCAN (http://bimas.dcrt.nih.gov/molbio/proscan). Statistical Analysis. ...
Molecular Biology Reports
2011, Volume 38, Issue 6 , pp 4023-4035 DOI: 10.1007/s11033-010-0521-4
Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells
Upendra K. Singh Shekhawat, Thumballi R. Ganapathi, Lingam Srinivas
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India
... Also, a 76 nucleotide long 50 UTR has been pre- dicted based on the sequence of
50 end of the EST DN239172 and the analysis of 50 proximal sequence (obtained
using TAIL-PCR) by TSSP program hosted at www.softberry.ru. ...
Journal of Plant Physiology
Volume 167, Issue 12, 15 August 2010, Pages 1003-1008 doi:10.1016/j.jplph.2010.01.021
Expression of the 26S proteasome subunit RPN10 is upregulated by salt stress in Dunaliella viridis
Xiaobin Sun a, 1, Xiangzong Meng b, 1, Zhengkai Xu a, b and Rentao Song a
a Shanghai Key Laboratory of Bio-energy Crops, School of Life Sciences, Shanghai University, 99 Shangda Road, Shanghai 200444, China
b Institute of Plant Physiology & Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China
... gov/BLAST/). Gene prediction was carried out using SoftBerry TSSP (http://www.
softberry.com/berry.phtml?topic=ann2) and GENSCAN (http://genes.mit.edu/
GENSCAN.html) (Burge and Karlin, 1997). Sequence alignments ...
Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x
Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)
Xia YANG 1,
Hong CUI 2,
Zu-Li YUAN 2,
Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China
2 Henan Agricultural University, Zhengzhou 450002, China
... To predict the promoter regions and the transcription start sites, genomic regions upstream of
the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region
and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ...
Plant Physiology
153:1239-1249 (2010) First published online May 3, 2010; 10.1104/pp.110.157123
Identification and Application of a Rice Senescence-Associated Promoter
Liu et al.,
National Key Laboratory of Crop Genetic Improvement and National Centre of Plant Gene Research, Huazhong Agricultural University, Wuhan 430070, People's Republic of China (L.L., Y.Z., X.L., Y.L.); Department of Plant Sciences, University of California, Davis, California 95616 (L.L., M.W.S.)
... sativa sp. japonica). The promoter region of this gene was predicted using the software
TSSP, provided at the Softberry Web site (http://linux1.softberry.com/berry.phtml?topic%
810%867=case_study_plants). The regulatory elements ...
Gene
Volume 459, Issues 1-2, 1 July 2010, Pages 24-31 doi:10.1016/j.gene.2010.03.009
Molecular characterization and methylation study of matrix gla protein in articular cartilage from pig with osteochondrosis
Helga Sauerwein, Karl Schellander
a Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Germany
b Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai, Thailand
... was performed by the CEQ8000 sequencer system (Beckman Coulter). A sequence
of transcription start site (TSS) was predicted using TSSP (http://www.softberry.ru).
The published sequences (NC_010447) of the 5?-flanking ...
Genome
Volume 53, Number 7, 1 July 2010 , pp. 533-544(12)
Comparison of gene order of GIGANTEA loci in yellow-poplar, monocots, and eudicots
Liang Haiying; et al.,
... 2006). Exon–intron splice sites, start codons, and transcription start sites were predicted by
NetPlantGene (Hebsgaard et al. 1996), NetStart 1.0 (Ped- ersen and Nielsen 1997), and the
TSSP engine developed by SoftBerry (Solovyev and Shahmuradov 2003), respec- tively. ...
Plant Science
Volume 179, Issue 4, October 2010, Pages 390-398 doi:10.1016/j.plantsci.2010.06.018
Comparison of gene order in the chromosome region containing a TERMINAL FLOWER 1 homolog in apricot and peach reveals microsynteny across angiosperms
Haiying Liang et al.,
a Department of Genetics and Biochemistry, Clemson University, Clemson, SC 29634, United States
b Department of Horticulture, University of Georgia, Athens, GA 30602, United States
... Exon/intron splicing sites were determined by aligning with a full-length coding
sequence obtained from the peach cultivar Springprince . Transcription start sites
were predicted by TSSP engine developed by SoftBerry [39]. ...
Planta
2010 Apr;231(5):1211-27. Epub 2010 Mar 6 DOI: 10.1007/s00425-010-1127-8
Identification and organization of chloroplastic and cytosolic L-myo-inositol 1-phosphate synthase coding gene(s) in Oryza sativa: comparison with the wild halophytic rice, Porteresia coarctata
Ray et al.,
Plant Molecular and Cellular Genetics, Bose Institute (Centenary Campus), Kolkata, India
... 1999) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/html/). Predictions
of eukaryotic promoter and transcription initiation sites were performed using the TSSP/Prediction
of PLANT Promoters (Using RegSite Plant DB, Softberry Inc.). ...
J. Exp. Bot.
2010 61 (11): 2991-3002. doi: 10.1093/jxb/erq124
Cold acclimation and low temperature resistance in cotton: Gossypium hirsutum phospholipase Da isoforms are differentially regulated by temperature and light
Kargiotidou A, Kappas I, Tsaftaris A, Galanopoulou D, Farmaki T.
1Institute of Agrobiotechnology, Centre for Research and Technology, 6th km Charilaou - Thermi Rd. 570 01, Thessaloniki, Greece
2Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki 54006, Greece
... Promoter prediction of GrPLD and GaPLD The TSSP (promoter prediction program
for plant genes), http://linux1.softberry.com/berry.phtml (Shahmuradov et al., 2005)
was used. A promoter was predicted for GrPLD and GaPLD . ...
Methods Mol Biol.
2010;592:149-61
MicroRNA promoter analysis
Megraw M, Hatzigeorgiou AG
Department of Genetics, Center for Bioinformatics, School of Medicine, University of Pennsylvania, Philadelphia, PA, USA
... events. 3. The first cited source provides a web-based interface that accepts regions
of sequence for promoter prediction (http:// softberry.com/berry.phtml?topic =
tssp&group = programs& subgroup = promoter). The second
The Plant Cell
22:349-363 (2010) 10.1105/tpc.108.064816
The Arabidopsis thaliana STYLISH1 Protein Acts as a Transcriptional Activator Regulating Auxin Biosynthesis
Eklund et al.,
a Department of Plant Biology and Forest Genetics, Uppsala BioCenter Swedish University of Agricultural Sciences, 750 07 Uppsala, Sweden
b Research Institute of Genome-Based Biofactory, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305-8562, Japan
... The yeast one-hybrid analysis showed the ability of STY1 to bind a 207-bp region directly
upstream of a predicted TATA box (YUC4-1; TSSP at http://www.softberry.com/berry.phtml) but
not to DNA from the more proximal promoter region or the presumptive 5' untranslated ...
Planta
Volume 230, Number 5 / October, 2009, pp. Volume 230, Number 5 / October, 2009
Genome-wide survey of rice microRNAs and microRNA–target pairs in the root of a novel auxin-resistant mutant
Meng et al.,
(1) State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China
(2) Department of Bioinformatics, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China
... Both the transcription start site (TSS) and the TATA-box in miRNA promoters were
searched by using TSSP (http://www. softberry.com/berry.phtml?topic=tssp&group=
programs& subgroup=promoter) (Shahmuradov et al. 2003). ...
Plant Production Science
Vol. 12 (2009) , No. 3 341-344
Genetic Transformation of a High Molecular Weight Glutenin (Glu-1Dx5) to Rice cv. Fatmawati
Yoshiharu Wada 2), Nono Carsono 1), Anas 1), Ly Tong 2) and Tomohiko Yoshida 2)
1) Faculty of Agriculture, Padjadjaran University
2) Faculty of Agriculture, Utsunomiya University
... To confirm the existence of the promoter in the full-length of 8.2 kb Glu- 1Dx5, we examined the
DNA sequence with TSSP- Prediction of Plant Promoter Software (Softberry Inc.), and found at
least 4 promoters or enhancers on the basis of TATA box prediction, suggesting that ...
BMC Plant Biol.
2009 Jul 17;9:93.
Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.
Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.
... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter
recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih.
gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...
BMC Plant Biology
2009, 9:126 doi:10.1186/1471-2229-9-126
Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae
Francois Fauteux, Martina V Stromvik
1
Department of Plant Science, McGill University, Ste-Anne-de-Bellevue, Canada
2
McGill Centre for Bioinformatics, McGill University, Montre'al, Canada
... literature [20, 35, 60-77]. The transcription start sites were predicted in 13 promoters for which
transcriptional start data was unavailable in GenBank or literature, using the TSSP software
from Softberry Inc. (http://www.softberry.ru). One representative ...
Plant Tissue Cult. & Biotech.
18(2): 123-130, 2008 (December)
Identification of Drosophila Promoter Using Positional
Differential Matrix and Support Vector Machine from
Sequence Data
Azizul Haque et al.,
Institute of Information Technology, University of Dhaka, Dhaka-1000, Bangladesh
... Program used (%) NNPP threshold (0.8) SoftBerry (TSSP) ProScan Vers. 1.7 Dragon Pro?moter
Finder Vers. 1.4 Promoter 2.0 Pred. Server ... The proposed method exhibits better accuracy
compared to other two methods NNPP (Reese et al. 1996) and SoftBerry(TSSP). ...
Plant Biotechnology
25, 000–000 (2008)
Genome-wide comparative analysis of Oryza sativa (japonica)
and Arabidopsis thaliana 5 -UTR sequences for translational
regulatory signals
M. Shashikanth, A. R. Krishna, G. Ramya, Geeta Devi, K. Ulaganathan
Center for Plant Molecular Biology, Osmania University, Hyderabad-500007, A. P., India
... 5 -UTR-genomic sequences longer than 150 base pairs were submitted to the promoter
finding tool, TSSP (Softberry), available online at http://www.softberry.com ...
Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065
Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)
Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece
2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece
... elements was performed using the database available at: http://softberry.com. TSSs
were determined using the TSSP program available at the site. NSITE-PL was ...
New Phytologist
2008 Volume 179 Issue 3, Pages 722 - 737
Comparative analysis of orthologous cellulose synthase promoters from Arabidopsis, Populus and Eucalyptus: evidence of conserved regulatory elements in angiosperms
Nicole Marie Creux, Martin Ranik, David Kenneth Berger and Alexander Andrew Myburg
1 Department of Genetics , 2 Department of Plant Science, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South Africa
... The transcriptional start site (TSS) prediction program, TSSP (Shahmuradov et al.,
2005, available at http://www.softberry.com), is trained on plant promoters ...
BMC Bioinformatics
2008, 9:414 doi:10.1186/1471-2105-9-414
Pol II promoter prediction using characteristic 4-mer motifs: a
machine learning approach
Firoz Anwar et al.,
Department of Computer Science and Engineering, East West University, Bangladesh, 2Department of Genetic Engineering and
Biotechnology, University of Dhaka, Bang
... Other prominent promoter prediction tools use either a statistical approach
or Neural Network such as SoftBerry (TSSP). However, ...
Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072
The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants
S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia
... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters
(using the RegSite plant database, Softberry, http://www.softberry.com). ...
Gene
Volume 409, Issues 1-2, 15 February 2008, Pages 1-10
Molecular evolution of the MLO gene family in Oryza sativa and their functional divergence
Qingpo Liua
and Huiqin Zhu
School of Agriculture and Food Science, Zhejiang Forestry University, Hangzhou, Lin'an 311300, PR China
bDepartment of Agronomy, Zhejiang University, Hangzhou 310029, PR China
cDepartment of Agronomy, Qinghai University, Xining 810003, PR China
... Further, we have identified promoters for OsMLOs using the plant promoter
prediction program TSSP that was developed by Softberry Inc. ...
TAG Theoretical and Applied Genetics
Volume 116, Number 2 / January, 2008 Pages 179-192
Does sequence polymorphism of FLC paralogues underlie flowering time QTL in Brassica oleracea?
H. Razi, E. C. Howell, H. J. Newbury and M. J. Kearsey
(1) School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK
(2) Department of Crop Production and Plant Breeding, College of Agriculture, Shiraz University, Shiraz, 71441-65186, Iran
... Higo et al. 1999), the TSSP (Softberry, http://www.soft- berry.com) and the
TSSP-TCM (Shahmuradov et al. 2005). Results The B. oleracea ...
Plant, Cell & Environment
Volume 31 Issue 1 Page 86-96, January 2008
Identification of novel pathogen-responsive cis-elements and their binding proteins in the promoter of OsWRKY13, a gene regulating rice disease resistance
MENG CAI et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... The promoter region of OsWRKY13 was predicted with the computer programs TSSP provided
at the Softberry website (http://www.softberry.com), and PROSCAN (http ...
Genetics
Vol. 176, 2541-2549, August 2007
The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus
Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences,
South China Agricultural University, Guangzhou, 510642, China and
Key Biotechnology Laboratory of State Ethnic Affairs Commission,
College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China
... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH,
respectively (http://www.softberry.com/berry.html). ...
PLoS Comput Biol
2007, 3(3): e37 doi:10.1371/journal.pcbi.0030037
Characterization and Identification of MicroRNA Core Promoters in Four Model Species
Zhou X, Ruan J, Wang G, Zhang W
Department of Computer Science and Engineering, Washington University in Saint Louis, Saint Louis, Missouri, United States of America, Department of Genetics, Washington University in Saint Louis, Saint Louis, Missouri, United States of America
... In comparison, TSSP (SoftBerry, http: / /www.softberry.com), which is one of the
best promoter prediction methods for plants, only identified 39 (60 ...
Plant Biotechnology Journal
5 (5), 664–674
A rice promoter containing both novel positive and negative cis-elements for regulation of green tissue-specific
gene expression in transgenic plants
Meng Cai, Jun Wei, Xianghua Li, Caiguo Xu, Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Centre of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China
... The promoter region of D54O was predicted using the computer programs TSSP, provided
at the Softberry website (http://www.softberry.com), and PROSCAN (http ...
Forestry Studies in China
June 20, 2007, pp. 95-106
Isolation and analysis of a TIR-specific promoter from poplar
Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China
... out with the BLAST search program in NCBI Transcriptional start site of the obtained
DNA sequence, was predicted with the online program TSSP in Softberry. ...
... Cis-acting regulatory elements located at the promoter region were predicted by
using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...
Journal of Zhejiang University - Science B
August 27, 2007 pp. 661-665
Cloning, sequencing and expression analysis of the NAR promoter activated during hyphal stage of Magnaporthe grisea
Lu Jian-ping Contact Information, Duan Zhi-bing , Liu Tong-bao and Lin Fu-cheng
Department of Biology, School of Life Sciences, Zhejiang University, Hangzhou, 310058, China
Biotechnology Institute, Zhejiang University, Hangzhou, 310029, China
... fruitfly.org/seq_tools/promoter.html, version 2.2), TSSP (http://www.softberry.com/
berry.phtml, pre- diction of plant promoters), and TFSCAN (http:// bioweb ...
Genome
Volume 49, Number 3, 1 March 2006, pp. 209-218(10)
Molecular structure and organization of the wheat genomic manganese superoxide dismutase gene
Baek, Kwang-Hyun; Skinner, Daniel Z.; Ling, Peng; Chen, Xianming
... 2002; Takai and Jones 2003) for CpG island prediction; TSSP (http://www.
softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) for plant ...
The Plant Cell
18:2929-2945 (2006)
The Balance between the MIR164A and CUC2 Genes Controls Leaf Margin Serration in Arabidopsis
Krisztina Nikovicsa et al.,
Laboratoire de Biologie Cellulaire, Institut Jean Pierre Bourgin, Institut National de la Recherche Agronomique, 78026 Versailles Cedex, France
...Analysis of the pri-miRNAs
We performed 3' and 5' RACE for each gene with the GeneRacer cDNA amplification kit (Invitrogen).
We used two or three rounds of nested PCR to amplify the 3' and 5' ends of the three pri-miR164s.
The miR164A-15, miR164A-17, and miR164A-18 primers were used for the 3' end of pri-miR164A,
and miR164A-16 and miR164A-7 were used for the 5' end. The miR164B-13, miR164B-15,
and miR164B-16 primers were used for the 3' end of pri-miR164B, and miR164B-5 and miR164B-14
were used for the 5' end. We used miR164A-15 and miR164C-1 for the 3' end of pri-miR164A and
miR164C-3 and miR164C-5 for the 5' end. Following gel electrophoresis, RACE reaction products
were inserted into the pGEM-T Easy vector (Promega), and the two strands were sequenced.
Two to four independent 5' clones and 5 to 10 independent 3' clones were analyzed for each gene.
Promoter and transcription start sites were predicted by
the TSSP program ( http://www.softberry.com/berry.phtml?topic=tsspandgroup=programsandsubgroup=promoter).
The pri-miRNA secondary structure was determined with the Mfold program
(Mathews et al., 1999; Zuker, 2003) ( http://www.bioinfo.rpi.edu/applications/mfold/old/rna/)....
Genetica
(2006), 128, 395-407
Isolation and characterization of a novel semi-lethal Arabidopsis thaliana mutant of gene for pentatricopeptide (PPR) repeat-containing protein
Tomas Kocabek, Jana Repkova, Marketa Dudova, Klara Hoyerova and Lukas Vrba
Institute of Plant Molecular Biology, Biological Centre of the Academy of Sciences of the Czech Republic,
Branisovska 31, CZ-370 05 Ceske Budejovice, Czech Republic
Applied TSSP software... TSSP-TCM software suitable for plant pro-. moters searching (Shahmuradov et al. ...
Plant Science
Volume 168, Issue 6, June 2005, Pages 1571-1579
Functional analysis of GUS expression patterns and T-DNA integration characteristics in rice enhancer trap lines
Peng et al.,
Biotechnology Research Institute, The Chinese Academy of Agricultural Sciences, Beijing 100081, PR China
... promoter systems, rice genomic sequences located upstream the GAL4/VP16-UAS apparatus
were used for promoter prediction analysis (TSSP, http://www.softberry.com
Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1731, Issue 3, 20 December 2005, Pages 202-208
T-DNA tagging and characterization of a cryptic root-specific promoter in Arabidopsis
C. Sivanandan, T.P. Sujatha, Anand Mohan Prasad, R. Resminath, Dhiraj R. Thakare, S.R. Bhat and Srinivasan
National Research Center on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110012, India
... using a web-based program, Plant Cis-Acting Regulatory Elements (Plant CARE) [21]
and TSSP/Prediction of PLANT Promoters (Using RegSite Plant DB, Softberry Inc ...
BMC Bioinformatics
2005 6:114 doi:10.1186/1471-2105-6-114
CAGER: classification analysis of gene expression regulation using multiple information sources
Jianhua Ruan and Weixiong Zhang
1Department of Computer Science and Engineering, Washington University, St. Louis, MO 63130, USA and Department of Genetics,
Washington University School of Medicine, St. Louis, MO 63110, USA
... For Arabidopsis ORFs, the upstream sequences were used as inputs to a promoter prediction program, TSSP [63],
to predict transcription start sites (TSSs). ...
Bioinformatics
2005 21(14):3074-3081
Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana
Weixiong Zhang et al.,
Department of Computer Science and Engineering, Washington University in Saint Louis Saint Louis, MO 63130, USA
... sites (TSSs). To predict TSSs, we combined an A.thaliana cDNA database and a software, TSSP (SoftBerry, http://www.softberry.com). As ...
Acta Biochimica Polonica
Vol. 52 No. 1/2005 117-128
Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol)
lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits
Frantz Liszewska, Dali Gaganidze and Agnieszka Sirko
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warszawa, Poland
... ments production. Location of the potential plant promoter was computed by
the TSSP program [http://www. softberry.com]. Phylo- genies ...
Nucleic Acids Research
2005, Vol. 33, No. 3 1069–1076
Plant promoter prediction with confidence estimation
I. A. Shahmuradov(1), V. V. Solovyev(1,2,*) and A. J. Gammerman(1)
(1)Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK and (2)Softberry Inc., 116 Radio Circle,
Suite 400, Mount Kisco, NY 10549, USA
Accurate prediction of promoters is fundamental to
understanding gene expression patterns, where confidence
estimation is one of the main requirements.
Using recently developed transductive confidence
machine (TCM) techniques, we developed a new program
TSSP-TCM for the prediction of plant promoters
that also provides confidence of the prediction.
The Plant Journal
(2004) 37 (4), 517-527
Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein
X Sun et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China
.... Promoter regions of the Xa26 family members were analyzed with the promoter prediction
programs tssp (http://www.softberry.com/berry.phtml), nnpp (http://www ...
Plant Physiology
136:3023-3033 (2004)
Utility of Different Gene Enrichment Approaches Toward Identifying and Sequencing the Maize Gene Space
Nathan Michael Springer, Xiequn Xu and W. Brad Barbazuk
Center for Plant and Microbial Genomics, Department of Plant Biology, University of Minnesota, St. Paul, Minnesota 55108 (N.M.S.); and Donald Danforth Plant Sciences Center, St. Louis, Missouri 63132 (X.X., W.B.B.)
...upstream sequence, 10 of the 33 genes had at least 1 kb
of upstream sequence, and the longest extension was
2.2 kb. This sequence is likely to contain 5# UTRs and
promoters. We attempted to determine how often
a putative PolII promoter recognition sequences could
be found using the Softberry TSSP package (Mount
Kisco, NY; http://www.softberry.com; Shahmuradov
et al., 2003), which uses characteristics of known factor
binding sites to predict potential transcription start
sites in plant DNA sequence. Putative promoters were
predicted in 13 of the 26 upstream sequences assayed,
and putative TATA boxes were identified in 9 (70%) of...
Nucleic Acids Research
2003, Vol. 31, No. 1 114-117
PlantProm: a database of plant promoter sequences
Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA
... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based
on discriminant analysis has been created by Softberry Inc. ...
TSSG
Journal of Biochemical Technology,
Vol 4, No 1 (2012)
Analysis of diabetic retinopathy biomarker VEGF gene by computational approaches
Jayashree Sadasivam, N Ramesh, K Vijayalakshmi, Vinni Viridi, Shiva prasad
... Gene promoters TSSG www.softberry.com/berry.tssp& group=programs&subgroup=pro moter
Proteins Data PDB www.rcsb.org Tandem repeats TRF finder http://tandem.bu.edu/trf/trf.sub
mit.options.html Docking Clusproprotei n-protein dock. Cluspro.bu.edu Page 3. ...
Nature Communications
4, Article number: 2739 doi:10.1038/ncomms3739
Genome-wide association study implicates NDST3 in schizophrenia and bipolar disorder
Lencz et al.,
Division of Research, Department of Psychiatry, The Zucker Hillside Hospital Division of the North Shore—Long Island Jewish Health System, Glen Oaks, New York 11004, USA
Center for Psychiatric Neuroscience, The Feinstein Institute for Medical Research, Manhasset, New York 11030, USA
... TATA boxes were predicted by TSSG (Softberry Inc) and the predicted TATA box locations were
depicted with vertical arrows (red on plus strand and blue on minus strand of chromosome 4).
In cross-species genomic sequence alignment, high sequence similarity was depicted ...
Gene
Volume 527, Issue 2, 25 September 2013, Pages 606–615 DOI:10.1016/j.gene.2013.05.078
Novel polymorphisms in UTR and coding region of inducible heat shock protein 70.1 gene in tropically adapted Indian zebu cattle (Bos indicus) and riverine buffalo (Bubalus bubalis)
M. Sodhi, M. Mukesh, A. Kishore, B.P. Mishra 1, R.S. Kataria, B.K. Joshi
National Bureau of Animal Genetic resources, Karnal 132001, India
... Microsatellite repeats were identified using Gramene software (http://www.gramene.org/db/markers/
ssrtool).The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.
gov/molbio/proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ...
J Biol Chem.
2012 Dec 19. [Epub ahead of print] DOI: 10.1074/jbc.M112.419168
MiR-125b Functions as a Key Mediator for Snail-Induced Stem Cell Propagation and Chemoresistance
Zixing Liu et al.,
1 University of South Alabama, United States;
2 Central South University, China;
... Western blotting. Luciferase Reporter Assay — The miR-125b promoter pGL3 basic
luciferase vector was constructed according to the literature and TSSG prediction
(http://linux1.softberry.com/berry.phtml? topic=products). pGL3 ...
Plant Biology,
14: 714–724. doi: 10.1111/j.1438-8677.2011.00556.x
Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula
Bucsenez, M., Ruping, B., Behrens, S., Twyman, R. M., Noll, G. A. and Prufer, D.
1
Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Aachen, Germany
2
Institut fur Biologie und Biotechnologie der Pflanzen, Westfalische Wilhelms-Universitat Munster, Munster, Germany
... MATERIAL AND METHODS In silico identification of the transcriptional start site and TATA box
The putative transcriptional start site and TATA box of the MtSEO-F1 promoter were predicted
using the Transcriptional Start Site Prediction (TSSP) tool from Softberry (http:// www ...
Mol Biol Rep.
2011 Aug;38(6):4153-7. doi: 10.1007/s11033-010-0535-y. Epub 2010 Nov 24.
Identification of the transcriptional promoters in the proximal regions of human microRNA genes
Long et al.,
Key Laboratory of Neurogenetics and Channelopathies of Guangdong Province and the Ministry of Education of China, Institute of Neuroscience and the Second Affiliated Hospital of Guangzhou Medical University, 250 Chang-gang-dong Road, Guangzhou, 510260, China
... It is shown that TSSG (http://www.softberry.ru/berry.phtml, Softberry) is a good promoter prediction
program with few false positive pre- dictions comparing to other promoter finding programs [17,
20]. Therefore, we used this program to predict the promoter regions and TSSs. ...
Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015
Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes
Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/
proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software
(http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...
BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51
Identification of a novel temperature sensitive promoter in cho cells
Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria
2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria
... Computational analysis of this region was performed using several freely available online
prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/
berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...
Hum Genet.
2010 Jan 12. [Epub ahead of print]
PD1 as a common candidate susceptibility gene of subacute sclerosing panencephalitis
Ishizaki et al.,
Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, 812-8582, Japan
... 2004). The values from three separate assays were compared between constructs. The
putative promoter region of PD1 gene was predi- cated using the TSSG (http://www.softberry.
com/berry. phtml?topic=tssg&group=programs&subgroup=promoter). ...
Glycobiology
Advance Access published November 22, 2010
Conservation of the ST6Gal I gene and its expression in the mammary gland
Jovana Maksimovic, Julie A. Sharp, Kevin R. Nicholas, Benjamin G. Cocks, Keith Savin
Centre for Reproduction and Development, Monash Institute of Medical Research, Clayton 3168 Australia
Biosciences Research Division, Department of Primary Industries, Bundoora 3083 Australia
Institute for Technology Research and Innovation, Deakin University, Geelong 3214 Australia
... TRANSCOMPEL (Kel-Margoulis, OV, Kel, AE, et al. 2002) database, as well as mononucleotide
position weight matrices for individual TFBS collected in TRANSFAC. Transcription start sites
were predicted using TSSG (Softberry). Page 24. 24 Acknowledgments ...
Acta Biochim Biophys Sin (Shanghai).
2009 Apr;41(4):309-15.
Identification and characterization of the minimal promoter of Mipu1: the role of GC boxes in the regulation of basal transcription
Lv B et al.,
Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha 410078, China.
... rat/). The Mipu1 gene transcription start site was predicted using Dragon GC + Promoter
Finder (http://sdmc.lit.org.sg/promoter/CGrich1_0/CGRICH.htm) and TSSG
(http://www.softberry.com/berry.phtml?topic=promoter). Promoterscan ...
European Journal of Cell Biology
Volume 88, Issue 12, December 2009, Pages 731-742
Molecular mechanisms underlying the pro-inflammatory synergistic effect of tumor necrosis factor ? and interferon ? in human microvascular endothelium
Lombardi et al.,
aDepartment of Clinical Physiopathology, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, Viale Pieraccini 6, I-50139 Florence, Italy
bDepartment of Internal Medicine, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, I-50139 Florence, Italy
... A 5-kb region upstream from the TNFa-RII and the IFNg-R open reading frames was analyzed
using the promoter identification programs promoter predictions (http://www.fruitfly.org/seq_tools/
promoter) and TSSG (http://softberry.com/berry.phtml?topic=tssg&group ...
Endocrinology
2009 Vol. 150, No. 4 1870-1878
Hypothalamic Expression of Eap1 Is Not Directly Controlled by Ovarian Steroids
Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa and Sergio R. Ojeda
Division of Neuroscience (V.M., S.R.O.), Oregon National Primate Research Center, Beaverton, Oregon 97006; and Department of Physiology and Pharmacology (C.M., R.A.S., D.M.D.), Oregon Health and Science University, Portland, Oregon 97239
... The position of a TSS was predicted using several search tools including Promoter 2.0 Prediction
server (http://www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder version 1.5
(http://research.i2r.a-star.edu.sg/promoter/promoter1_5/DPF.htm), and Softberry TSSG (http ...
Endocrinology
2008, doi:10.1210/en.2008-0779
Hypothalamic expression of Eap1 is not directly controlled by ovarian steroids
Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa, and Sergio R. Ojeda
Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon, USA; and Department of Physiology & Pharmacology, Oregon Health & Science University, Portland, Oregon, USA
... www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder v1.5 (http://research.
i2r.a- star.edu.sg/promoter/promoter1_5/DPF.htm) and Softberry TSSG (http://www ...
Endocrinology
2008, Vol. 149, No. 9 4256-4266
Seladin-1 Is a Fundamental Mediator of the Neuroprotective Effects of Estrogen in Human Neuroblast Long-Term Cell Cultures
Luciani et al.,
Endocrine Unit, Department of Clinical Physiopathology, Center for Research, Transfer and High Education on Chronic, Inflammatory, Degenerative and Neoplastic Disorders for the Development of Novel Therapies (P.L., C.D., F.R., S.B., I.C., F.D., M.M., G.D., M.S., A.P.), Department of Anatomy, Histology, and Forensic Medicine (G.B.V.), University of Florence, 50139 Florence, Italy
... A 6-kb region upstream seladin-1 open reading frame was analyzed using eukaryotic
promoter identification programs (http://www.softberry.com/berry.phtml?topic=tssg&group=programs&subgroup=promoter ...
Animal Genetics
39(5):531-543, October 2008.
Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST
Meyers, S. N.; Beever, J. E.
... Putative promoter sequences and transcriptional start sites (TSSs) were predicted
using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...
Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95
Cloning and functional analysis of the promoter region of the human Disc large gene
Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy
bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina
... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research
Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...
Cancer Research
68, 8976-8985, November 1, 2008. doi: 10.1158/0008-5472.CAN-08-0769
Roles for MicroRNAs, miR-93 and miR-130b, and Tumor Protein 53–Induced Nuclear Protein 1 Tumor Suppressor in Cell Growth Dysregulation by Human T-Cell Lymphotrophic Virus 1
Yeung et al.,
Molecular Virology Section, Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland; 2 Laboratory of Virus Immunology, Institute for Virus Research, Kyoto University, Shogoin Kawahara-cho, Sakyo-ku, Kyoto, Japan;
... luciferase (f-luc) reporter gene. The putative promoter of miR-130b was predicted
by TSSG promoter prediction program. 6 PCR primers (sense ...
Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208
Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes
Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy
... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter,
Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.),
"TSSG" and "TSSW" ... 1999–2005, www.softberry.com); ...
BMC Genomics
2007, 8:203 doi:10.1186/1471-2164-8-203
In silico comparative genomic analysis of GABAA receptor transcriptional
regulation
Christopher J Joyce1§
1Faculty of Biological Sciences, The University of Leeds, Leeds, UK
Table 1 - Gene Regulation Prediction Software utilised
...TSSG TSS Prediction www.softberry.com ...
Nature and Science,
4(3), 2006
An In Silico Investigation into the Discovery of
Novel Cis-acting Elements within the Intronic Regions of Human PAX7
Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan
University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center),
New York City, New York 10021, USA
The names and functions of the programs used are:
...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) -
This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) -
TSSG is the most accurate mammalian cis element prediction program.
DNA and Cell Biology
Jun 2006, Vol. 25, No. 6 : 346 -358
Cloning and Characterization of the BRD7 Gene Promoter
Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Hunan, People's Republic of China
... The transcriptional initiation site was identified using the TSSG program
(http://www.softberry.com/berry.phtml?topic promoter) and Dragon GC Promoter Finder ...
Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223
GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis
ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.
... Consistent with this result, sequence analysis using TSSG and TSSW softwares (
http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ... )
TSSW
International Journal of Fisheries and Aquatic Studies
2016; 4(3): 378-383
Isolation, characterization and activity analysis of selected promoters of mud crab, Scylla serrata
Mani, M. K., Neeli-Venkata, R., Kondadhasula, R., & Majumdar, K. C.
Post-Harvest Technology, Central Institute of Fisheries Education, Mumbai, India; Department Of Signal Processing, Tampere University Of Technology, Finland
.. Histone3 -R GGCGCTAGCTAGCTTCCTTCTT 2.3 Promoter nucleotide sequences analysis The
sequences thus obtained were analysed for potential transcription factor binding sites specific
for promoters using TSSW (http://linux1.softberry.com/berry.phtml) and ...
International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573
The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53
Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China
... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools:
NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp.
duke.edu/generegulation/McPromoterMMII/), and Softberry programs
FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...
J. Virol. June
2012 vol. 86 no. 12 6688-6700 DOI: 10.1128/JVI.07037-11
Feline Tetherin Is Characterized by a Short N-Terminal Region and Is Counteracted by the Feline Immunodeficiency Virus Envelope Glycoprotein
Celestino et al.,
aDepartment of Molecular Medicine, University of Padua, Padua, Italy
bRetrovirus Center and Virology Section, Department of Experimental Pathology, University of Pisa, Pisa, Italy
... The transcription initiation start site and the different cis-acting elements present in the putative
cBST2 promoter region were predicted by using the following programs: the TSSW prediction
program (Softberry), TFsitescan (MIRAGE [Molecular Informatics Resource for the ...
PLoS ONE
(2011), 6(10): e26944. doi:10.1371/journal.pone.0026944
A Common Genetic Variant (97906C>A) of DAB2IP/AIP1 Is Associated with an Increased Risk and Early Onset of Lung Cancer in Chinese Males.
Yang et al.,
The Institute for Chemical Carcinogenesis, The State Key Lab of Respiratory Disease, Guangzhou Medical University, Guangzhou, People's Republic of China
Department of Pathology, Yale University School of Medicine, New Haven, Connecticut, United States of America
...We used the TSSW program (http://www.softberry.ru/berry.phtml) to predict promoter region and found that the 4000 bp 5?-upstream region of DAB2IP gene are potential promoter region. ...
Molecular and Cellular Biology
January 2009, p. 570-581, Vol. 29, No. 2 doi:10.1128/MCB.01275-08
CUX1 and E2F1 Regulate Coordinated Expression of the Mitotic Complex Genes Ect2, MgcRacGAP, and MKLP1 in S Phase
Seguin et al.,
... sequences immediately upstream of the transcription start sites were analyzed with
the Genomatix suite (www.genomatix.de) and TSSW software (www.softberry.com ...
Animal Genetics
39(5):531-543, October 2008.
Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST
Meyers, S. N.; Beever, J. E.
... Putative promoter sequences and transcriptional start sites (TSSs) were predicted
using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...
Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95
Cloning and functional analysis of the promoter region of the human Disc large gene
Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy
bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina
... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research
Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...
BMC Bioinformatics.
2008; 9: 113.
Human Pol II promoter recognition based on primary sequences and free energy of dinucleotides
Jian-Yi Yang, Yu Zhou, Zu-Guo Yu, Vo Anh, and Li-Qian Zhou
1School of Mathematics and Computational Science, Xiangtan University, Hunan 411105, China
2School of Mathematical Sciences, Queensland University of Technology, GPO Box 2434, Brisbane, Q 4001, Australia
... of promoter prediction tools, which are available on-line, namely Neural Network
Promoter Prediction (NNPP version 2.2) [27], Soft Berry (TSSW) [28], Dragon ...
Mol. Cell. Biol.
doi:10.1128/MCB.01275-08
CUX1 and E2F1 regulate coordinated expression of the mitotic complex genes Ect2, MgcRacGAP and MKLP1 in S-phase
Seguin et al.,
INSERM U749, Faculte' de Pharmacie Paris XI, 92296 Cha^tenay-Malabry, France; and Molecular Oncology Group, McGill University, Montreal, Quebec, H3A 1A1, Canada
... with the genomatix suite (www.genomatix.de) and TSSW softwares (www.softberry.com).
These analyses did not identify consensus TATA boxes in these 3 promoters. ...
Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208
Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes
Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy
... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter,
Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.),
"TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...
Lung Cancer
2007 Volume 57, Issue 2, Pages 143-151
Polymorphisms of cytosolic serine hydroxymethyltransferase and risk of lung cancer: A case–control analysis
L. Wang, J. Lu, J. An, Q. Shi, M. Spitz, Q. Wei
Department of Epidemiology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77230-1439, United States.
.. fcgi%3Fdb=Snp), of which two SNPs were found to be located in the SHMT1 promoter
region as predicted by the online software TSSW (http://www.softberry.com/berry ...
Human Molecular Gene
2005 14(11):1465-1474; doi:10.1093/hmg/ddi156
Identification and characterization of a novel gene Saf transcribed from the opposite strand of Fas
Ming-De Yan et al.,
1Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan, ROC
... 1). After analysis with program TSSW (http://www.softberry.com), one promoter
was predicted upstream of the transcription start site. ...
Genomics
Volume 86, Issue 4, October 2005, Pages 489-494
L3mbtl, the mouse orthologue of the imprinted L3MBTL, displays a complex pattern of alternative splicing and escapes genomic imprintingstar, open
Li et al.,
aDepartment of Haematology, Cambridge Institute for Medical Research, University of Cambridge, Hills Road, Cambridge CB2 2XY, UK
bDepartment of Anatomy, University of Cambridge, Downing Street, Cambridge CB2 3DY, UK
... which were predicted by promoter prediction programs including PROSCAN 1.7
(http://bimas.cit.nih.gov/molbio/proscan/) and TSSW (http://www.softberry.com/berry ...
J. Biol. Chem
Vol. 279, Issue 34, 35183-35192, August 20, 2004
STAT6 and Ets-1 Form a Stable Complex That Modulates Socs-1 Expression by Interleukin-4 in Keratinocytes
Julia Travagli, Martine Letourneur, Jacques Bertoglio, and Josiane Pierre
From the INSERM U461, Faculte de pharmacie, 5 Rue J. B. Clement, 92296-Chatenay-Malabry, France
... The transcriptional start site was determined by computational analysis (TSSW using
Softberry Software) and predicted to be located at nucleotide -16 from ...
Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223
GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis
ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.
... Consistent with this result, sequence analysis using TSSG and TSSW softwares (
http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ...
Genomics
2004 Sep;84(3):577-86.
Cloning, genomic structure, and expression profiles of TULIP1 (GARNL1), a brain-expressed candidate gene for 14q13-linked neurological phenotypes, and its murine homologue
Schwarzbraun T et al.,
Institute of Medical Biology and Human Genetics, Medical University of Graz, Harrachgasse 21/8, A-8010 Graz, Austria.
... Putative promoter regions were detected from human and murine genomic sequences
using the eukaryotic promoter prediction program TSSW from Softberry, Inc., http ...
Archives of Biochemistry and Biophysics
Volume 409, Issue 2, 15 January 2003, Pages 287-297
Mitochondrial and nucleocytoplasmic isoforms of O-linked GlcNAc transferase encoded by a single mammalian gene
Hanover et al.,
Laboratory of Cell Biochemistry and Biology, NIDDK, National Institutes of Health, Building 8, Room 402, 8 Center Drive, MSC 0850, NIH, Bethesda, MD 20892-0850, USA
... Ensembl, Fgenesh ++, and the TSSW Promoter Prediction algorithms
(http://www.softberry.com/berry.phtml) were initially employed. ...
3D-Match
Protein Science
Volume 19, Issue 3, pages 372–382, March 2010
Pyrroline-5-carboxylate synthase and proline biosynthesis: From osmotolerance to rare metabolic disease
Perez-Arellano, I., Carmona-Alvarez, F., Martinez, A. I., Rodriguez-Diaz, J. and Cervera, J
1. Molecular Recognition Laboratory. Centro de Investigacion Principe Felipe, Valencia, Spain
2. Centro de Investigacion Biomedica en Red de Enfermedades Raras (CIBERER-ISCIII), Valencia, Spain
... maritima (PDB ID 1O20) forms a tetramer made up of a dimer of dimers in which both the dimeric
and the tetrameric contacts are extensive.35 These two 3D structures superim- pose with an RMSD
of 1.8 A over 214 residues (pre- dicted by using 3D-Match by Softberry, Inc.) [Fig ...
CYS_REC
Turkish Journal of Biology
2016, 40(3), p.623-633. .
Modeling of PrnD protein from Pseudomonas fluorescens RajNB11 and its comparative structural analysis with PrnD
proteins expressed in Burkholderia and Serratia
SINGH, R. N., SINGH, R. P., SHARMA, A., & SAXENA, A. K.
... hydropathy (GRAVY) (Kyte and Doolittle, 1982). The sulfide bond pattern (SS) and
linkages were predicted by the CYS_REC (http://linux1.softberry.com/
berry.phtml/topic) tool. PSIPRED v3.3 (http://bioinf. cs.ucl.ac.uk/psipred ...
Journal of Biotech Research [ISSN: 1944-3285]
2016, 7, 1-10.
Computational characterization and structure prediction of chitinase gene of beauveria bassiana using proteomic tools
Sood, S., Sandhu, S. S., Kumar, A. K., Gupta, A., Mukherjee, T. K.
1 Department of Biotechnology, Maharishi Markandeshwar University, Mullana
, Ambala 133207, India.
2 Department of Biological Sciences, R. D. University, Jabalpur 482001, (MP) India.
... Disulphide linkages are important in functional characterization and bonds are predicted by the
tool CYS_REC (http://sunI.softberry.com/berry.phtml?topic), which helps to identify the positions
and total number of cysteines, and predicts the most probable "SS" bond pattern of ...
PloS one
2016, 11(1), e0145745. http://dx.doi.org/10.1371/journal.pone.0145745
Cloning and Expression of Phytase appA Gene from Shigella sp. CD2 in Pichia pastoris and Comparison of Properties with Recombinant Enzyme Expressed in E. coli.
Roy, M. P., Mazumdar, D., Dutta, S., Saha, S. P., Ghosh, S.
Department of Biotechnology, University of North Bengal, Siliguri, India
... The amino acid sequence encoded by the ORF was analyzed for the presence of signal peptide
by SignalP 4.1 Server(http://www.cbs.dtu.dk/services/SignalP) [17] and for disulphide bond in
the tertiary structure by using Softberry CYS_REC online services (www.softberry.com). ...
Applied biochemistry and biotechnology
2015, 176(3), 712-729. DOI: 10.1007/s12010-015-1606-2
1. Department of Animal Biotechnology, Faculty of Biotechnology, Jeju National University, Jeju Do, 690-756, Republic of Korea
2. Animal Genetic Resources Station, National Institute of Animal Science, Rural Development Administration, Namwon, Republic of Korea
Ghosh, M. et al.,
Department of Animal Biotechnology, Faculty of Biotechnology, Jeju National University
... The CYS_REC tool (www.?softberry.?com/?berry.?phtml??topic=?cys_?rec&?
group=?programs&?subgroup=?propt) published by Softberry was used to predict
the most probable SS bond pattern in the sequences [28]. ...
International Journal of Pharmaceutical Sciences and Research
2015, 6(4), 1727-1735. DOI: 10.13040/IJPSR.0975-8232.6(4).1727-35
COMPUTATIONAL MODELLING AND FUNCTIONAL CHARACTERIZATION OF HDAC-11
Samant, L. R., Sangar, V. C., Gulamaliwala, A., Chowdhary, A. S.
Systems Biomedicine Division 1, Department of Virology & Immunology 2, Haffkine Institute for Training, Research & Testing, Acharya Donde Marg, Parel, Mumbai - 400012. India.
... Functional characterization was computed using RaptorX, HMMTOP and SoftBerry Server's
CYS_REC tool which predicted the secondary structure composition, presence of transmembrane
proteins and the presence of cysteine residues respectively. Full Text. Keywords: ...
Asian Journal of Pharmaceutical & Clinical Research
Apr 2013 Supplement 2, Vol. 6, p265-268
SYNTHESIS AND MOLECULAR DOCKING STUDIES OF 2 CHOLROMETHYL-3-METHYL-1-PHENYL SULFONYL-1H-INDOLE COMPOUND
B., SARAVANAN; UPGADE, AKHILESH; BHASKAR, ANUSHA; V., MANIVANNAN
... The presence of SS bond and their bonding patterns were predicted by CYS_REC (16) and
RASMOL server. CYS_REC (http://linux1.softberry.com/berry ... 23 283 16. CYS_REC.http://sun1.
softberry.com/berry.phtml?topic=cys_rec &group=help &subgroup-propt. (27/10/2006) 17. ...
Structural Biology
Volume 2013 (2013), Article ID 370820, 10 pages http://dx.doi.org/10.1155/2013/370820
In Silico Characterization and Homology Modeling of a Cyanobacterial Phosphoenolpyruvate Carboxykinase Enzyme
Aubrey A. Smith and Amanda Caruso
Department of Biology, Montgomery College-Rockville Campus, 51 Mannakee Street, Rockville, MD 20850, USA
... disulfide patterns of each cyanobacterial PEPCK are tabulated in Table 3. The presence of
disulfide bridges was analyzed using the CYS-REC tool which predicts the most probable bonding
patterns between available cysteine residues (http://linux1.softberry.com/berry.phtml). ...
INT. J. BIOAUTOMATION,
2012, 16(4), 225-238
In silico Characterization of Plant and Microbial Antifreeze Proteins
Md. Musharaf Hossain et al.,
Department of Genetic Engineering and Biotechnology
Shahjalal University of Science and Technology
Sylhet-3114, Bangladesh
... particular protein. The presence of SS bond and their bonding pairs were predicted
by CYS_REC (http://linux1.softberry.com/berry phtml?topic) and “What If” server (identify
SS bonds from 3D structure of a protein). The secondary ...
World Journal of Fish and Marine Sciences
5 (4): 426-429, 2013 DOI:10.5829/idosi.wjfms.2013.05.04.7427
Comparative in Silico Analysis of Mbl Homologues of Teleosts
Chirag Goel 1, Ashoktaru Barat 1, Veena Pande 2 and P.K. Sahoo 1
1 Molecular Genetics Laboratory, Directorate of Coldwater Fisheries Research (ICAR), Bhimtal-263136, Nainital, Uttarakhand, India
2 Department of Biotechnology, Kumaun University, Nainital, Uttarakhand, India
... test tube. There are certain dipeptides, the occurrence of structure (protein sequence data) by
the tool CYS_REC which is significantly different in the unstable protein (http://sunI.
softberry.com/ berry.phtml?topic). CYS_REC compared with those in the stable ones. This method ...
Bioinformation.
2013; 9(16): 802–807. DOI: 10.6026/97320630009802
in-silico characterization of b-(1, 3)-endoglucanase (ENGL1) from Aspergillus fumigatus by homology modeling and docking studies
Rizwan Ahmed, 1 Swatantra Kumar Jain, 2 and Praveen Kumar Shukla 1
1Medical Mycology lab, Division of Microbiology, CSIR-Central Drug Research Institute, Sitapur Road, Lucknow-226001, India
2Department of Biotechnology, Jamia Hamdard University, New Delhi, India
... Protein Topology prediction: Secondary structure of the protein ENGL1 from Aspergillus fumigatus
was calculated with PSIPRED (http: //bioinf.cs.ucl.ac.uk/ psipred) and disulfide bonds were
predicted by the Cys_REC tool (http://sunl.softberry.com/berry.phtml?topic). ...
Journal of PROTEINS AND PROTEOMICS
Vol 3, No 3 (2012)
IN SILICO CHARACTERIZATION OF BOVINE (BOS TAURUS) ANTIAPOPTOTIC PROTEINS
V G Vidhya, Akhilesh Upgade, Anusha Bhaskar, Dipanjana Deb
State
... RASMOL server. CYS_REC (http://linux1. softberry.com/berry.phtml) identified the
position of a cysteine, total number of cystiene presented along with the most probable
–SS- bond pairs in the protein sequences. The latter tool ...
Bioinformation
2013; 9(13): 680–684. DOI:10.6026/97320630009680
Insight from the structural molecular model of cytidylate kinase from Mycobacterium tuberculosis
Nitin Kumar Verma 1,2,* and Balwinder Singh 3
1Department of Bioscience, Shri Ram College, Muzaffarnagar
2Uttarakhand Technical University, Dehradun
3Department of Science, Ek Onkar Scholar Degree College, Shahbjnagar, Shahjahanpur
... The results are showing in Table 2 (see supplementary material). Functional
characterization: CYC_REC (http://sunl.softberry.com/berry.phtml?topic) was used
to locate “SS bond” between the pair of cystein residue, if present. ...
International Journal of Pharma & Bio Sciences
Jul-Sep2013, Vol. 4 Issue 3, pB-181-B-193. 13p.
IN SILICO CHARACTERIZATION OF HUMAN TYROSINASE USING COMPUTATIONAL TOOLS AND SERVERS
SEN GUPTA; PARTH SARTHI; BUDDHADEV MONDAL; BANDYOPADHYAY AMAL KUMAR
... Prot. Chem. 23 283 35. CYS_REC.http://sun1.softberry.com/berry.ph tml?topic=
cys_rec&group=help&subgroup= propt. (27/10/2006) 36. Lambert C, Leonard N, De
Bolle X and Depiereux E 2002 Bioinformatics 18 1250 37. Lovell. ...
INT.J. BIOAUTOMATION,
2012, 16(4), 225-238
In silico Characterization of Plant and Microbial Antifreeze Proteins
Hossain et al.,
Department of Genetic Engineering and Biotechnology Shahjalal University of Science and Technology Sylhet-3114, Bangladesh
... particular protein. The presence of SS bond and their bonding pairs were predicted
by CYS_REC (http://linux1.softberry.com/berry phtml?topic) and “What If” server (identify
SS bonds from 3D structure of a protein). The secondary ...
International Current Pharmaceutical Journal (ICPJ)
2012, Volume 1, Issue 2, pp 18-26 DOI
Fish antifreeze proteins: Computational analysis and physicochemical characterization
Md. Musharaf Hossain
.. Disulphide bonds are very essential in determining the functional linkage and the stability of a
particular protein. The presence of SS bond and their bonding patterns were predicted by
CYS_REC and What If server. CYS_REC (http://linux1.softberry.com/berry.phtml? ...
J Glob Infect Dis.
2012 Jan-Mar; 4(1): 43–54.
doi: 10.4103/0974-777X.93761
Analyzing a Potential Drug Target N-Myristoyltransferase of Plasmodium falciparum Through In Silico Approaches
Amit Kumar Banerjee, Neelima Arora, and USN Murty
Bioinformatics Group, Biology Division, Indian Institute of Chemical Technology, Tarnaka, Uppal Road, Hyderabad, Andhra Pradesh, India
... of 0.05 and number of possible pseudomotifs predicted was kept 3. CYSREC
(http://linux1.softberry.com/) was used to predict the cysteine pairing pattern. As some
proteins are known to contain several unstructured or disordered ...
PLoS ONE
7(12): e50900. doi:10.1371/journal.pone.0050900
Molecular Cloning and Characterization of Novel Morus alba Germin-Like Protein Gene Which Encodes for a Silkworm Gut Digestion-Resistant Antimicrobial Protein
Patnaik et al.,
Division of Plant Biotechnology, College of Agriculture and Life Sciences, Chonnam National University, Gwangju, South Korea
... and NetPhosK 1.0 server respectively [36]–[39]. Disulfide bonds were predicted
by the Cys_REC tool (version 2.0) from Softberry (http://linux1.softberry.com/berry.
phtml/). The superfamily and the conserved domains including ...
Bioinformation
8(17): 807-811 (2012)
Homology Modeling and Functional Characterization of PR-1a Protein of Hordeum vulgare subsp. Vulgare
Vahid Aslanzadeh 1
* & Mostafa Ghaderian 2, 3
1Department of Biotechnology, Research Institute of Physiology and Biotechnology, University of Zanjan, Zanjan, Iran;
2Department of Chemistry, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia;
... Protein was further subjected to CYS_REC program(http://linux1.softberry.com/berry.
phtml?topic=cys_rec&gro up=programs&subgroup=propt) for locating SS-bonding
states of cysteines and disulphide bridges in proteins, if present. ...
J Proteomics Bioinform
2012, 5:9
http://dx.doi.org/10.4172/jpb.1000238
Homology Modeling and Structural Analysis of NHX Antiporter of
Leptochloa fusca (L.)
Panahi et al.,
1Department of Biotechnology and Plant Breeding, Ferdowsi University of Mashhad, Mashhad, Iran
2Department of Biotechnology, University of Isfahan, Iran
...CYS_REC (http://sunl.softberry.com/
berry.phtml?topic) was used to locate “SS bond” between the pair of
cysteinee residues, if present. ...
IJPSR,
2012; Vol. 3(7): 2050-2056
IN-SILICO ANALYSIS AND HOMOLOGY MODELING OF TARGET PROTEINS FOR CLOSTRIDIUM BOTULINUM
Chirag Prajapati*1 and Chintan Bhagat 2
Department of Computer Science (Bioinformatics) 1, Department of Biotechnology 2, Veer Narmad South Gujarat University, Surat, Gujarat, India
... Disulphide bonds are important in determining functional linkages. Table 4 shows prediction
of “SS” bonds using primary structure (protein sequence data) by tool CYS_REC
http://linux1.softberry.com/berry.phtml?topic=cys_rec &group=programs&subgroup=propt. ...
Bioinformation
2011; 6(8): 315–319. PMCID: PMC3134781
Structure prediction and functional characterization of secondary metabolite proteins of Ocimum
Roy et al.,
Biotechnology Division, Central Institute of Medicinal and Aromatic Plants, (Council of Scientific and Industrial Research), Kukrail Picnik Spot Road, P.O. CIMAP, Lucknow - 226015, India
... protparam.html). The results are shown in (see Table 4). Functional characterization.
CYS_REC (http://sunl.softberry.com/berry.phtml? topic) was used to locate “SS bond”
between the pair of cystein residues, if present. The tool ...
Current Research Journal of Biological Sciences
3(1): 35-41, 2011 DOI:
Physiochemical, Functional and Structural Characterization of Wheat Germin Using In silico Methods
Vinita Hooda
Department of Botany, M.D. University, Rohtak -124001, Haryana, India
... For functional characterization disulfide bonds were predicted by the Cys_REC tool
from softberry, secondary structures were calculated with SOPMA (Self Optimized
Prediction Method with Alignment) (Geourjon and Deleage, 1995). ...
Journal of Applied Sciences in Environmental Sanitation
Volume 6, Number 3: 357-366, September, 2011
Structural Analysis and 3D-Modelling of Fur Protein from Bradyrhizobium japonicum
Singh et al.,
1National Bureau of Agriculturally Important Microorganisms (ICAR), Kushmaur, Kaithauli, Mau Nath
Bhanjan, Uttar Pradesh-275101, India.
2Department of Botany and Microbiology, Gurukul Kangri University, Haridwar, Uttrakhand-249404, India.
... The sulphide (SS) bond pattern is predicted by using the tool CYS_REC
(http://linux1.softberry.com/berry.phtml?topic), has shown that fur protein has three
cysteine residues at position 19, 53 and 141, and have no SS bonding. ...
POJ
4(7):354-363 (2011)
In silico approaches in comparative genomics, structure prediction and functional
characterization of secondary metabolite proteins of Mentha sp
Roy et al.,
1Biotechnology Division, Central Institute of Medicinal and Aromatic Plants, Council of Scientific and Industrial
Research, Lucknow - 226015, India
2
IIDS Center of Bioinformatics, Nehru Science Center, University of Allahabad, Allahabad - 211001, India
... Disulphide bridges were find using Cys_REC tool from softberry (Table 7). Domain and fold
recognition ... Functional characterization of disulfide bonds present in secondary metabolite proteins
of Mentha species were done by Cys_REC tool from Softberry. Page 9. 362 ...
Journal of Applied Sciences in Environmental Sanitation
2011, 6 (4): 485-494.
Homology Modeling and
Sequence Analysis of a Highly Thermostable Endo-(1,4)-Beta-Mannase from the Marine Bacterium Rhodothermus
Marinus.
ZRaghvendra Pratap Singh, Alok R. Rai, Kunal Roychoudhury and R.C. Dubey .
1Department of Botany and Microbiology, Gurukul Kangri University, Haridwar, Uttrakhand-249404,
India
2Department of Microbiology, Seth Kesarimal Porwal College, Kamptee Maharashtra 441002, India
... The sulphide (SS) bond pattern is predicted by employing the tool CYS_REC
(http://linux1.softberry.com/berry.phtml?topic), has shown that 1,4-?-D-mannanase protein
has three cysteines residues at position 255,265 have no SS bonding. ...
J Proteomics Bioinform
2010 Volume:3 Issue:5 pp. 148-154 doi:10.4172/jpb.1000134
In silico Analysis and Homology Modelling of Antioxidant Proteins of Spinach
Archna Sahay ; Madhvi Shakya
1 Department of Bioinformatics, MANIT, Bhopal-462051 M.P., India
2 Department of Mathematics, MANIT, Bhopal-462051, M.P., India
... Journal of Proteomics & Bioinformatics - Open Access www.omicsonline.com CYS_REC
(http://sunI.softberry.com/berry.phtml?topic). CYS_REC identifies the position of cysteins, total
number of cysteins present and pattern, if present, of pairs in the protein sequence. ...
Asian J. Exp. Sci.,
Vol. 22, No. 3, 2008; 265-274
In silico Characterization of Silk Fibroin Protein using Computational
Tools and Servers
K.V. Ashokan and M.M. Pillai
Department of Biological Science,
P.V.P College, K. Mahnakl, Sangli - 416405 (Maharashtra); India.
Department of Biotechnology, KIT’s College of Engineering,
Gokul Shirgaon, Kolhapur (Maharashtra); India.
... using CLC free workbench tool Page 4. 268 CYS_REC (http://sunI.softberry.
com/ berry.phtml?topic). CYS_REC identifies the position of ...
J. Chem. Sci.,
Vol. 119, No. 5, September 2007, pp. 571–579.
In silico characterization of antifreeze proteins using computational
tools and servers
K SIVAKUMAR, S BALAJI and GANGARADHAKRISHNAN
1Department of Chemistry, Sri Chandrasekharendra Saraswathi Viswa Maha Vidyalaya
(Deemed University), Enathur, Kanchipuram 631 561
2EXCEL and Polymer Science Labs, Central Leather Research Institute, Adyar, Chennai 600 020
... CYS_REC
identifies the positions of cysteines, total number of
cysteines present and predicts the most probable SS
bond pattern of pairs in the protein sequence. ...
GetAtoms
Cambridge University Press 2006
Essential Bioinformatics
J Xiong
... 9. Perform comprehensive homology modeling using the GetAtoms server (www.softberry.
com/berry.phtml?topic=getatoms&group=programs& subgroup=propt). 10. ...
NNSSP
Plant Physiology
132:1391-1404 (2003)
Interacting Transcription Factors from the Three-Amino Acid Loop Extension Superclass Regulate Tuber Formation
Hao Chen, Faye M. Rosin, Salome Prat and David J. Hannapel
Interdepartmental Plant Physiology Major (H.C., D.J.H.) and Molecular, Cellular, and Developmental Biology Major (F.M.R., D.J.H.), Department of Horticulture, Iowa State University, Ames, Iowa 50011–1100; and Department of Plant Molecular Genetics, National Center of Biotechnology, Consejo Superior de Investigaciones Cientificas, Cantoblanco Campus University of Madrid, Madrid, Spain (S.P.)
... of the sequence structure was derived by using three software programs for amino
acid sequence analysis: sspal, ssp, and nnssp (http://www.softberry.com/berry ...
Pdisorder
BMC Bioinformatics
2012, 13:153 doi:10.1186/1471-2105-13-153
Molecular evolution of dihydrouridine synthases
Joanna M Kasprzak 2, Anna Czerwoniec 2 and Janusz M Bujnicki 1,2
1 Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology, Trojdena 4, PL-02-109, Warsaw, Poland
2 Institute of Molecular Biology and Biotechnology, Adam Mickiewicz University, Umultowska 89, PL-61-614, Poznan, Poland
... residues were made using MetaDisorder (http://iimcb.genesilico.pl/metadisorder/ webcite; [40],
a meta-method which combines the predictions of the following primary methods: DisEMBL [41],
DISPROT(VSL2) [42], GlobPlot [43], IUPred [44], PDISORDER (SoftBerry, http://linux1 ...
Molecular Genetics and Genomics
January 2012, Volume 287, Issue 1, pp 39-54
Molecular characterization and functional analysis by heterologous expression in E. coli under diverse abiotic stresses for OsLEA5, the atypical hydrophobic LEA protein from Oryza sativa L.
Shuai He et al.,
1. Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing, 400044, China
... Secondary structure predictions were run with the DSSP, PSIPRED (http:// www.ibi.vu.nl/
programs) (Jones 1999; Kabsch and Sander 1983), PDISORDER (http://linux1.softberry.com),
and DisEMBL (http://dis.embl.de/) programs (Linding et al. 2003). ...
Applied Biochemistry and Biotechnology
January 2012, Volume 166, Issue 1, pp 222-233 10.1007/s12010-011-9418-5
Molecular Analysis of OsLEA4 and Its Contributions to Improve E. coli Viability
Tingzhang Hu et al.,
1. Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, Chongqing, 400044, People’s Republic of China
2. School of Life Science and Engineering, Chongqing Three Gorges University, Chongqing, 404100, People’s Republic of China
... InterProScan/). Secondary structure predictions were run with the DSSP, PSIPRED
(http://www.ibi.vu.nl/programs) [20, 21], PDISORDER (http://linux1.softberry.com),
and DisEMBL (http://dis.embl.de/) programs [22]. Analysis ...
The EMBO Journal
2007, 26, 5071-5082, doi:10.1038/sj.emboj.7601916
A conserved function for a Caenorhabditis elegans Com1/Sae2/CtIP protein homolog in meiotic recombination
A. Penkner et al.,
1 Department of Chromosome Biology and Max F. Perutz Laboratories, Center for Molecular Biology, University of Vienna, Vienna, Austria
2 Developmental Genetics, TU Braunschweig, Germany
3 Bioinformatics Group, Research Institute of Molecular Pathology, Vienna, Austria
... They are mostly disordered and low-complex (Pdisorder; www.softberry.com) except
for the C-terminal 70-100 aa corresponding to the region of highest sequence ...
BMC Bioinformatics 2005, 6:22 doi:10.1186/1471-2105-6-22
Research article Open Access
Proteins with two SUMO-like domains in chromatin-associated complexes: The RENi (Rad60-Esc2-NIP45) family
Maria Novatchkova*1, Andreas Bachmair3, Birgit Eisenhaber2 and
Frank Eisenhaber2
Address: 1Gregor Mendel-Institut GMI, Austrian Academy of Sciences, Vienna Biocenter, A-1030 Vienna, Austria, 2Research Institute of Molecular Pathology, Dr. Bohr-Gasse 7, A-1030 Vienna, Austria and 3Max Planck Institute for Plant Breeding Research, Carl-von-Linne-Weg 10, D-50829 Cologne, Germany
...Initial analysis of its sequence complexity shows that the disordered N-terminal half of the protein is
followed by a likely globular segment (predicted using Pdisorder by Softberry, Inc)...
PSSFinder
Frontiers in plant science
2014, 5: 26. DOI:10.3389/fpls.2014.00026
Plant 4/1 protein: potential player in intracellular, cell-to-cell and long-distance signaling
Morozov S. Y. et al.,
1 A. N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Moscow, Russia
2 Department of Virology, Faculty of Biology, Moscow State University, Moscow, Russia
... PHYSICO-CHEMICAL PROPERTIES OF 4/1 PROTEIN. The Nt-4/1 protein is predicted
by PSSFinder (Soli et al., 2009) (http://linux1.softberry.com/berry.phtml) to form six
long alpha-helices and two short beta-sheet structures. ...
Australian Journal of Grape and Wine Research
Volume 19, Issue 2, pages 193–207, June 2013 DOI:10.1111/ajgw.12029
Polymorphisms in VvPel associate with variation in berry texture and bunch size in the grapevine
Vargas, A.M., Fajardo, C., Borrego, J., De Andres, M.T. and Ibanez, J.
1Instituto Madrileno de Investigacion y Desarrollo Rural, Agrario y Alimentario (IMIDRA), Alcala de Henares, Madrid, Spain
2Instituto de Ciencias de la Vid y del Vino (CSIC, Gobierno de La Rioja, Universidad de La Rioja), Complejo Cientifico Tecnologico, Logrono, Spain
... Prediction of secondary structure. The amino acid sequence for each haplotype was obtained,
and secondary structure was predicted by means of the software PSSFinder, both implemented
in Softberry, Inc. (NY, USA; http://linux1.softberry.com/berry.phtml). ...
Biochimie
Volume 95, Issue 7, July 2013, Pages 1360–1370 DOI:10.1016/j.biochi.2013.02.015
Subcellular localization and self-interaction of plant-specific Nt-4/1 protein
Solovyev A.G. et al.,
a A.N. Belozersky Institute of Physico-Chemical Biology, Moscow State University, Chochlova Str. 1, 119992 Moscow, Russia
b M.M. Shemyakin & Yu.A. Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, 16/10 Miklukho-Maklaya Str., Moscow 117997, Russia
... 2) [6]. Predictions of the protein secondary structure carried out for Nt-4/1-CC-II using SSP and
PSSFinder prediction methods available at the SoftBerry website (http://linux1.softberry.com/berry.
phtml) revealed that the Pro residues introduced in Nt-4/1-CC-II precluded formation ...
Biochimie
Volume 93, Issue 10, October 2011, Pages 1770–1778 DOI: 10.1016/j.biochi.2011.06.018
Orthologues of a plant-specific At-4/1 gene in the genus Nicotiana and the structural properties of bacterially expressed 4/1 protein
Makarova et al.,
a Department of Virology, Biological Faculty, Moscow State University, Moscow 119992, Russia
b M. M. Shemyakin and Yu. A. Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, 16/10 Miklukho-Maklaya Str., Moscow 117997, Russia
... For computer-assisted secondary structure prediction, the PSSFinder server (http://linux1.softberry.
com/berry.phtml) [20], the PCOIL server (http://toolkit.tuebingen.mpg.de/pcoils) [21] and [22] and
the MARCOIL server (http://www.isrec.isb-sib.ch/webmarcoil/webmarcoilC1.html ...
BMC Pharmacology
2009, 9:4doi:10.1186/1471-2210-9-4
Bioinformatics’ characterizations and prediction of K+ and Na+ ion channels effector toxins
Rima Soli 1, a, Belhassen Kaabi 1, a, *, Mourad Barhoumi 1, Mohamed El-Ayeb2 , and Najet Srairi-Abid 2
1) Laboratory of Epidemiology and Ecology of Parasites, Institut Pasteur de Tunis, Tunis, Tunisia. (2) Laboratory of Venom and Toxins, Institut Pasteur de Tunis, Tunis, Tunisia
... The 2D structure of all the sequences (training and test datasets) was determined based on the
program PHD [36-38] using neural network approach, and the Softberry's software PSSfinder
[39], which uses Markov chains probabilistic model. Phylogenetic analysis ...
BMC Molecular Biology
2008, 9:88 doi:10.1186/1471-2199-9-88
Computational modeling and in silico analysis of differential
regulation of myo-inositol catabolic enzymes in Cryptococcus
neoformans
Emalee A Mackenzie and Lisa S Klig
1Life Sciences Department, Irvine Valley College, Irvine, CA, USA and 2Department of Biological Sciences, California State University,
Long Beach, CA, USA
... 35. PSSFinder [http://www.softberry.ru/berry.phtml?topic=pps&group=programs&subgroup
=propt] 36. SAM_T02 [http://www.softberry.com/all.htm] 37. ...
SSPAL
Plant Physiology
132:1391-1404 (2003)
Interacting Transcription Factors from the Three-Amino Acid Loop Extension Superclass Regulate Tuber Formation
Hao Chen, Faye M. Rosin, Salome Prat and David J. Hannapel
Interdepartmental Plant Physiology Major (H.C., D.J.H.) and Molecular, Cellular, and Developmental Biology Major (F.M.R., D.J.H.), Department of Horticulture, Iowa State University, Ames, Iowa 50011–1100; and Department of Plant Molecular Genetics, National Center of Biotechnology, Consejo Superior de Investigaciones Cientificas, Cantoblanco Campus University of Madrid, Madrid, Spain (S.P.)
... of the sequence structure was derived by using three software programs for amino
acid sequence analysis: sspal, ssp, and nnssp (http://www.softberry.com/berry ...
SSP
Molecular Plant Pathology
Volume 9 Issue 4 Page 511-523, July 2008
Natural variation reveals key amino acids in a downy mildew effector that alters recognition specificity by an Arabidopsis resistance gene
REBECCA L. ALLEN et al.,
Warwick HRI, Warwick University, Wellesbourne, Warwick CV35 9EF, UK
Department of Evolutionary Biology, University of Munich, Gro?haderner Str. 2, 82152 Planegg-Martinsried, Germany
... html). Prediction of alpha helix was by the SSP program (http://softberry.
com/berry.phtml?topic=sspgroup=programssubgroup=propt). ...
Plant Physiology
132:1391-1404 (2003)
Interacting Transcription Factors from the Three-Amino Acid Loop Extension Superclass Regulate Tuber Formation
Hao Chen, Faye M. Rosin, Salome Prat and David J. Hannapel
Interdepartmental Plant Physiology Major (H.C., D.J.H.) and Molecular, Cellular, and Developmental Biology Major (F.M.R., D.J.H.), Department of Horticulture, Iowa State University, Ames, Iowa 50011–1100; and Department of Plant Molecular Genetics, National Center of Biotechnology, Consejo Superior de Investigaciones Cientificas, Cantoblanco Campus University of Madrid, Madrid, Spain (S.P.)
... of the sequence structure was derived by using three software programs for amino
acid sequence analysis: sspal, ssp, and nnssp (http://www.softberry.com/berry ...
FindTerm
Current microbiology
2016, 72(3), 235-241. DOI: 10.1007/s00284-015-0935-2
Isolation and Comparative Genomic Analysis of T1-Like Shigella Bacteriophage pSf-2
Jun, J. W. et al.,
1. College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, 151-742, South Korea
2. Departments of Rheumatology, Bundang Jesaeng Hospital, Seongnam, 463-774, South Korea
... html) (mini- mum promoter score: 0.9). Rho-independent transcription terminators
were identified using FindTerm programs (http://www.softberry.com) (energy threshold
value: -11). Additional characteristics of the putative protein ...
Toxins
2016, 8(4), 113. doi:10.3390/toxins8040113
Identification and Characterization of the HicAB Toxin-Antitoxin System in the Opportunistic Pathogen Pseudomonas aeruginosa
Li, G. et al.,
Department of Microbiology, Third Military Medical University, Chongqing 400038, China
... The putative promoter and terminator were predicted by BPROM (http://linux1.softberry.com/berry.
phtml) and FindTerm (http://www.softberry.com/berry.phtml?topic=findterm&group=
programs&subgroup=gfindb), respectively. 4.3. DNA Extraction, RNA Purification and RT-PCR. ...
Frontiers in microbiology
2016, 7: 545. doi: 10.3389/fmicb.2016.00545
Genomics of three new bacteriophages useful in the biocontrol of Salmonella
Bardina, C. et al.,
Departament de Genetica i de Microbiologia, Molecular Microbiology, Universitat Autonoma de Barcelona, Barcelona, Spain
... Potential promoter regions and transcription terminators were predicted using the
Softberry programs BProm (http://linux1.softberry.com/berry.phtml), FindTerm (Solovyev
and Salamov, 2011), and TransTerm (Ermolaeva et al., 2000). ...
Microbiology
April 2013 vol. 159 no. Pt 4 665-677 DOI:10.1099/mic.0.063396-0
The regulatory mechanism of 2,4,6-trichlorophenol catabolic operon expression by HadR in Ralstonia pickettii DTP0602
Torii et al.,
1Department of System Science, Graduate School of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan
2Department of Biomedical Engineering, Faculty of Engineering, Okayama University of Science, 1-1 Ridaicho, Kita-ku, Okayama 700-0005, Japan
... The rho-independent terminator was predicted with FindTerm (Softberry; http://linux1.
softberry.com/berry.phtml). ... The presence of rho-independent terminator in the R1 and
R10 regions was sought using FindTerm (Softberry), but not located. ...
Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7
Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage
Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China
... DNASTAR software package was employed to detect direct and inverted repeats.
Putative promoter and terminator predictions were analyzed with BPROM and
FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...
Antonie van Leeuwenhoek
Volume 104, Issue 6 , pp 941-948 DOI:10.1007/s10482-013-0013-3
An Lrp-type transcriptional regulator controls expression of the Bacillus subtilis chromate transporter
Aguilar-Barajas et al.,
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Mich., Mexico
3. Genomica Alimentaria, Universidad de la Cienega, Sahuayo, Mich., Mexico
2. Depto. Bioquimica, Facultad de Medicina, Universidad Nacional Autonoma de Mexico, Mexico, D.F., Mexico
... bin/seq_tools/promoter.pl). Rho-independent bacterial terminators were searched
using the program FindTerm (Softberry Inc., New York, NY, USA). Cloning of the
ywrC-chr3N-chr3C gene cluster. The ywrC-chr3N-chr3C gene ...
Microbiology
November 2013 mic.0.073783-0 DOI:10.1099/mic.0.073783-0
Expression of the Six CHR Chromate Ion Transporter Homologues of Burkholderia xenovorans LB400
Acosta-Navarrete et al.,
1 Universidad Michoacana;
2 Laboratorio Estatal de Salud Publica
... Putative promoter sequences were identified employing PromScan software 109
(http://molbiol-tools.ca/promscan/). Rho-independent bacterial terminators were 110 searched
using the program FindTerm (Softberry Inc.). 111 112 Bacterial growth and susceptibility tests ...
Microbiology
April 2013 vol. 159 no. Pt 4 691-700 DOI:10.1099/mic.0.064741-0
A Q-like transcription factor regulates biofilm development in Escherichia coli by controlling expression of the DLP12 lysis cassette
Karl-Gustav Rueggeberg 1, Faustino A. Toba 1, Mitchell G. Thompson 1, Bryan R. Campbell 1 and Anthony G. Hay 1,2
1Department of Microbiology, Cornell University, Ithaca, NY 14853, USA
2Institute for Comparative and Environmental Toxicology, Cornell University, Ithaca, NY 14853, USA
... Antiterminator predictions. essDp sequence encompassing 400 bp upstream of the translation
start site was analysed for the presence of putative Rho-independent transcriptional terminators
using FindTerm software from Softberry (Hagen et al., 2010). ...
Research in Microbiology
Volume 164, Issue 10, December 2013, Pages 979–986 DOI:10.1016/j.resmic.2013.08.007
Characterization and complete genome sequence of the Shigella bacteriophage pSf-1
Jun et al.,
a Laboratory of Aquatic Biomedicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 151-742, Republic of Korea
b Korea Institute of Ocean Science & Technology, Ansan 426-744, Republic of Korea
... promoter.html) (minimum promoter score: 0.9). Rho-independent transcription
terminators were identified using FindTerm programs (http://www.softberry.ru) (energy
threshold value: ?11). Additional characteristics of the putative ...
Microbiology
May 2013 mic.0.063776-0 DOI:10.1099/mic.0.063776-0
Isolation, characterization and complete genome sequence of PhaxI: a phage of Escherichia coli O157:H7
Shahrbabak et al.,
1 Tehran University of Medical Sciences;
2 University of Helsinki;
3 Laval University
... 2004; Schattner et al., 2005). To find Rho-independent terminators, TransTerm 230 (Ermolaeva
et al., 2000) and FindTerm (SoftBerry) were used. PHIRE was also used 231 to find phage
regulatory elements (Lavigne et al., 2004). The genomic map was 232 ...
Current Microbiology
Volume 66, Issue 6 , pp 535-543 DOI:10.1007/s00284-013-0308-7
Characterization and Genome Sequencing of Phage Abp1, a New phiKMV-Like Virus Infecting Multidrug-Resistant Acinetobacter baumannii
Huang et al.,
1. Department of Microbiology, Third Military Medical University, Chongqing, 400038, China
2. Institute of Burn Research, Southwest Hospital, Third Military Medical University, Chongqing, China
... Bacte- riophage-specific promoters were determined using Neural Network Promoter
Prediction [29] and PHIRE [30]. Tran- scriptional termination sites were determined using
the FindTerm program (http://www.softberry.ru/berry.phtml). ...
PloS one
(2013). 8(5), e62933. DOI:10.1371/journal.pone.0062933
Genomic and Proteomic Analyses of the Terminally Redundant Genome of the Pseudomonas aeruginosa Phage PaP1: Establishment of Genus PaP1-Like Phages
Lu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing, China
...Predicted promoter regions were identified using neural network promoter prediction [51],
and putative terminator structures were identified using the web tool FindTerm (http://linux1.softberry.com/berry.phtml)....
BMC genomics
(2013). 14(1), 849. DOI:10.1186/1471-2164-14-849
The Clostridium small RNome that responds to stress: the paradigm and importance of toxic metabolite stress in C. acetobutylicum
Venkataramanan et al.,
1 Department of Chemical and Biomolecular Engineering, University of Delaware, Newark, DE, USA
2 Delaware Biotechnology Institute, University of Delaware, Newark, DE, USA
...Rho independent terminators were predicted using RNAmotif [90], Erpin [91] and Findterm (http://www.softberry.com webcite). ...
World Journal of Microbiology and Biotechnology
Volume 28, Issue 3 , pp 865-869 DOI
10.1007/s11274-011-0883-3
The ChrA homologue from a sulfur-regulated gene cluster in cyanobacterial plasmid pANL confers chromate resistance
Esther Aguilar-Barajas (1) (2)
Paulina Jeronimo-Rodriguez (1)
Martha I. Ramirez-Diaz (1)
Christopher Rensing (2)
Carlos Cervantes (1)
1. Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Edificio B-3, Ciudad Universitaria, 58030, Morelia, Michoacan, Mexico
2. Department of Soil, Water, and Environmental Science, University of Arizona, Tucson, AZ, USA
... Promoter sequences were searched with the Neural Network Promoter Predic- tion
(http://www.fruitfly.org/cgi-bin/seq_tools/promoter.pl software. Rho-independent
terminators were predicted with the FindTerm (Softberry Inc.) program. ...
Archives of Virology
Volume 157, Issue 2 , pp 391-395 DOI
10.1007/s00705-011-1175-9
Complete genomic sequence of a T4-like bacteriophage, phiAS4, infecting Aeromonas salmonicida subsp. salmonicida
J. H. Kim et al.,
1. Laboratory of Aquatic Animal Medicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, 151-742, Korea
2. Basic Science Institute for Cell Damage Control, Sogang University, Seoul, 121-742, Korea
... 13]. Rho-independent transcription terminators were also pre- dicted using the
FindTerm program (http://www.softberry.ru/ berry.phtml?topic=findterm&group=
programs&subgroup= gfindb) (energy threshold value: -11). Additional ...
BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10
Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production
Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain
2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain
... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters
in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm
software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...
Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002
IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes
Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany
2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile
... to GenBank sequences. Additional searches for genes, operons, promoters, and
terminators were done using FGENESB, BPROM, and FindTerm at www.softberry.
com (Softberry, Mount Kisco, NY, USA). The sequence data ...
PLoS ONE
7(5): e38283. (2012) doi:10.1371/journal.pone.0038283
Molecular Characterization of Podoviral Bacteriophages Virulent for Clostridium perfringens and Their Comparison with Members of the Picovirinae.
Volozhantsev NV et al.,
1 State Research Center for Applied Microbiology and Biotechnology, Obolensk, Moscow region, Russian Federation, 2 Poultry Microbiology Safety Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, Athens, Georgia, United States of America,
...Protein-encoding genes (ORFs) were predicted using GeneMark.hmm for prokaryotes version 2.4 (http://opal.biology.gatech.edu/GeneMark) [73] and SoftBerry FGENESB (http://linux1.softberry.com/berry.phtml; Mount Kisco, NY, USA) programs.
...
Putative promoters were analyzed by using Martin Reese's neural network prediction program at http://www.fruitfly.org/seq_tools/promot?er.html and BPROM (Softberry, Inc., Mount Kisco, NY, USA) at its website http://linux1.softberry.com/berry.phtml. Potential transcriptional terminators were assessed using the software programs TransTerm at the Nano+Bio-Center (http://nbc3.biologie.uni-kl.de) and FindTerm (Softberry, Inc., Mount Kisco, NY, USA) at the web site http://linux1.softberry.com/berry.phtml.
...
Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002
Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes
M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico
b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico
... Rho-independent bacterial terminators were searched using the program FindTerm
(Softberry Inc.). ... Search for genomic islands was made using CpG finger program from
Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...
RNA Biology
Volume 8, Issue 1 January/February 2011 Pages 11 - 13 DOI: 10.4161/rna.8.1.13346
ARNold: A web tool for the prediction of Rho-independent transcription terminators
Magali Naville, Adrien Ghuillot-Gaudeffroy, Antonin Marchais and Daniel Gautheret
Univ. Paris-Sud, Institut de Genetique et Microbiologie, Orsay Cedex, France
... search to intergenic regions, which makes it unfit for certain applications, including detection
of transcriptional attenuators that occur after gene starts. Other available tools include com-
mercial programs such as Softberry's Findterm (www.softberry. ...
Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142
Complete genome sequence of the lytic
Pseudomonas fluorescens phage fjIBB-PF7A
Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological
Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga,
Portugal
... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/
tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly.
org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ...
...Terminators
were predicted using FindTerm http://linux1.softberry.
com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...
Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050
The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay
Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China
b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China
... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM
and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening
of serotype-specific gene. Cross-hybridization experiments ...
FEMS Microbiology Letters
(2011), 324: 117–124. doi: 10.1111/j.1574-6968.2011.02394.x
Genetic analysis of the capsular polysaccharide synthesis locus in 15 Streptococcus suis serotypes.
Wang, K., Fan, W., Cai, L., Huang, B. and Lu, C.
1Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing, China
2College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China
... Sequence annotation and bioinformatic analysis. The promoters and terminators of the sequenced
cps locus were predicted using the bprom and findterm program (http://linux1.softberry.com/berry.
phtml), respectively. ORFs were analyzed using the vectornt? program. ...
International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019
Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus
Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France
... Presence of putative promoters, terminators and operons was evaluated using BPROM
(http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter.
html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...
BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198
Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny
Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden
... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70-
promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were
identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...
Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166
Antisense RNA associated with biological regulation of a restriction–modification system
Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences
... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator
prediction were performed using the BPROM and FindTerm software, respectively
(http://www.softberry.com/all.htm). RNA secondary structure ...
Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921
The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1
YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture
... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the
& independent terminators were predicted using the BPROM and the FindTerm program
respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...
J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11
A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550
Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland
2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy
... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique
terminator region downstream of TTHA1327 were identified using BPROM and
FindTerm (Softberry), respectively. Those findings showed that ...
PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108
Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence
Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and
bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611
...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the
BProm and TermFind/RNAFold programs (Softberry)....
Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09
The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry
Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany
.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators
were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK
(21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...
Plasmid
Volume 63, Issue 2, March 2010, Pages 108-117
Sequence analysis of plasmid pIR52-1 from Lactobacillus helveticus R0052 and investigation of its origin of replication
Hagen et al.,
a Department of Research and Development, Institut Rosell Inc., 6100 Avenue Royalmount, Montreal, Que., Canada H4P 2R2
b Department of Biology, Utah State University, Logan, UT 84322-5305, USA
... To predict the presence of rho-independent terminators, the Softberry FindTerm program
(version 2.8) was used (http://www.softberry.ru/berry.phtml?group=programs&subgroup=
gfindb&topic=findterm). 2.7. Analysis of repA genes for repeat sequences. ...
Journal of Bacteriology
October 2010, p. 5441-5453, Vol. 192, No. 20 doi:10.1128/JB.00709-10
Brochothrix thermosphacta Bacteriophages Feature Heterogeneous and Highly Mosaic Genomes and Utilize Unique Prophage Insertion Sites
Samuel Kilcher, Martin J. Loessner, and Jochen Klumpp
Institute of Food, Nutrition and Health, ETH Zurich, 8092 Zurich, Switzerland
... Rho-independent bacterial transcription terminators were predicted by using Softberry
FindTerm (http://www.softberry.ru/berry.phtml?topic=findterm&group=programs&subgroup=
gfindb) using an energy threshold value of –11 (default setting). ...
Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10
Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9
Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2
... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc.,
234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator
236 sequences using BPROM and FindTerm programs (Softberry Inc.). ...
Genomics
Volume 96, Issue 3, September 2010, Pages 167-172 doi:10.1016/j.ygeno.2010.06.001
Identification of lytic bacteriophage MmP1, assigned to a new member of T7-like phages infecting Morganella morganii
Zhu et al.,
Department of Microbiology, College of Basic Medical Science, Third Military Medical University, Chongqing 400038, China
... Bacteriophage-specific promoters were determined using Neural Network Promoter
Prediction [32] and PHIRE [33]. Transcrptional termination sites were determined using
FindTerm programs (http://www.softberry.ru/berry.phtml). ...
Microbiology
156 (2010), 2305-2315; DOI 10.1099/mic.0.038760-0
Detection and quantification of intergenic transcription in Mycoplasma hyopneumoniae
Stuart W. Gardner 1,2 and F. Chris Minion 1
1 Department of Veterinary Microbiology and Preventive Medicine, Interdepartmental Microbiology Program, Iowa State University, Ames, IA 50011, USA
2 Department of Statistics, Iowa State University, Ames, IA 50011, USA
... To identify stem–loop structures in the ig-072, ig-106, ig-282, ig-682 and ig-684 IG regions,
SoftBerry FindTerm software was used. Heat-shock experimental design and data analysis. ...
putative stem–loop structure as predicted by SoftBerry FindTerm software. ...
BMC Microbiology
2010, 10:301doi:10.1186/1471-2180-10-301
Characterization of JG024, a pseudomonas aeruginosa PB1-like broad host range phage under simulated infection conditions
Garbe et al.,
1 Institute of Microbiology, Technische Universitat Braunschweig, Spielmannstr. 7, 38106 Braunschweig, Germany
2 DSMZ, German Collection of Microorganisms and Cell Cultures, Inhoffenstr. 7B, 38124 Braunschweig, Germany
... Two promoter regions were identified in this way. Rho-independent terminator structures were
identified using the TransTerm [46] and FindTerm (Softberry, Inc.) software tools. The program
MEME was used for identification of conserved intergenic motifs in phage JG024 [47]. ...
Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010
Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...
Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035
Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...
BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153
Transcriptome analysis of the mobile genome ICEclc in Pseudomonas knackmussii B13
Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland
... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were
predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map
of ICEclc was designed from SeqBuilder of the Lasergene software package ...
Food Microbiology
Volume 26, Issue 1, February 2009, Pages 52-57
Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis
Emmanuel Coton and Monika Coton
aADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France
... Prokaryotic promoter prediction was performed using the Internet site http://www.fruitfly.org/
seq_tools/promoter.html; while, transcription terminators were predicted using the FindTerm
program at http://www.softberry.ru. 3. Results and discussion. 3.1. ...
Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080
Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing
Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA
... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table
2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent
terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...
Research in Microbiology
Volume 160, Issue 6, July-August 2009, Pages 401-408
Characterization of salivaricin CRL 1328, a two-peptide bacteriocin produced by Lactobacillus salivarius CRL 1328 isolated from the human vagina
Esteban Vera Pingitore, Elvira Maria Hebert, Maria Elena Nader-Macias and Fernando Sesma
aCentro de Referencia para Lactobacilos (CERELA–CONICET), Chacabuco 145 (T4000ILC), San Miguel de Tucuman, Tucuman, Argentina
... The presence of putative promoter elements was predicted by Neural Network Promoter
Prediction (http://www.fruitfly.org/seq_tools/promoter.html). Transcriptional terminators were
predicted with the FindTerm algorithm (http://www.softberry.ru/berry.phtml). ...
Journal of Bacteriology
February 2009, p. 1056-1065, Vol. 191, No. 3
Transcription of clpP Is Enhanced by a Unique Tandem Repeat Sequence in Streptococcus mutans
Jiaqin Zhang 1,2, Anirban Banerjee 1, and Indranil Biswas 1*
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160,1 Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong 250012, China2
... 55). The intergenic region between clpP and SMU.1671, which is 115 bp long,
encodes a putative -independent terminator located between bp 85 and 109 that
was identified by the FindTerm program (Softberry, Inc.). Figure ...
Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10
Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii
Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504
... gordonii genome sequence were detected using the BProm and FindTerm modules of the
fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...
Journal of Bacteriology
doi:10.1128/JB.01436-08 JB Accepts, published online ahead of print on 1 December 2008
Transcription of clpP is enhanced by a unique tandem repeat sequence in Streptococcus mutans
Jiaqin Zhang, Anirban Banerjee, and Indranil Biswas
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, KS 66160; Department of Parasitology, Shandong University School of Medicine, 44# Wenhua Xi Road, Jinan, Shandong, 250012, P R China
... encodes a putative ?-independent terminator located between 85- and 109-bp that
was identified 18 by FindTerm program (Softberry Inc.). 19 ...
Food Microbiology
doi:10.1016/j.fm.2008.07.009
Evidence of horizontal transfer as origin of strain to strain variation of the tyramine production trait in Lactobacillus brevis
Emmanuel Coton and Monika Coton
ADRIA Normandie, Boulevard du 13 juin 1944, 14310 Villers-Bocage, France
... site http://www.fruitfly.org/seq_tools/promoter.html; while, transcription terminators
were predicted using the FindTerm program at http://www.softberry.ru. ...
Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0
Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes
Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA
... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry.
com), were used for operon and gene predictions. RESULTS. ...
Nucleic Acids Research
doi:10.1093/nar/gkm836 published online on October 16, 2007
Characterization of bacterial operons consisting of two tubulins and a kinesin-like gene by the novel Two-Step Gene Walking method
Martin Pilhofer et al.,
Lehrstuhl fur Mikrobiologie, Technical University Munich, Am Hochanger 4, D-85354 Freising, Germany
... The prediction of Rho-independent terminators was performed with the
program FindTerm
(www.softberry.com/berry.phtml?topic=findterm&group=programs&subgroup ...
Microbiology
153 (2007), 2148-2158;
ss-Dependent carbon-starvation induction of pbpG (PBP 7) is required for the starvation-stress response in Salmonella enterica serovar Typhimurium
William J. Kenyon et al.,
Department of Biomedical Sciences, University of South Alabama, Mobile, AL 36688, USA
... Relevant nucleotide sequences were retrieved using the NCBI's Entrez server. Bacterial
terminator analysis was done using FindTerm (http://www.softberry.com/). ...
Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54
Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520
Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China
... Promoter and terminator predictions were performed using BPROM and FindTerm,
respectively (http://www.softberry.com/berry.phtml). ...
Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753
Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture
Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States
... the sequences for bacterial promoters and rho-independent transcription termination
sites was performed using BPROM and FindTerm, available at www.softberry.com ...
Journal of Bacteriology,
June 2006, p. 4362-4372, Vol. 188, No. 12
Characterization of a Novel Partition System
Encoded by the d and w Genes from the Streptococcal Plasmid pSM19035
Micha Dmowski,* Izabela Sitkiewicz, and Piotr Cegowski
Department of Microbial Biochemistry, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawiskiego 5A, 02-106 Warsaw, Poland
... Despite the presence of a putative rho-independent terminator (FindTerm; Softberry)
(positions 6281 to 6337 in pBT233), we wanted to confirm that and ...
Molecular Microbiology, Volume 59, Number 2, January 2006, pp. 541-550(10)
A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.
... promoter sequences and rho-independent terminators that could result in
an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...
Journal of Bacteriology, January 2006, p. 160-168, Vol. 188, No. 1
Identification of the syr-syp Box in the Promoter Regions of Genes Dedicated to Syringomycin and Syringopeptin Production by Pseudomonas syringae pv. syringae B301D
Nian Wang,1, Shi-En Lu,1, Qingwu Yang,2 Sing-Hoi Sze,3 and Dennis C. Gross1*
Department of Plant Pathology and Microbiology,1 Department of Computer Science,2 Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 778433
... typical rho-independent terminators, located after the syrP-syrD-sypA-sypB operon
and the syrC gene, were identified by the FindTerm program (Softberry) (Fig. ...
Journal of Bacteriology, January 2006, p. 202-210, Vol. 188, No. 1
Reconstruction and Regulation of the Central Catabolic Pathway in the Thermophilic Propionate-Oxidizing Syntroph Pelotomaculum thermopropionicum
Tomoyuki Kosaka,1 Taku Uchiyama,1 Shun-ichi Ishii,1 Miho Enoki,1,2 Hiroyuki Imachi,3 Yoichi Kamagata,2 Akiyoshi Ohashi,3 Hideki Harada,3 Hiroshi Ikenaga,1 and Kazuya Watanabe1*
Laboratory of Applied Microbiology, Marine Biotechnology Institute, Kamaishi, Iwate 026-0001,1 Japan3
... were manually checked. Terminator sequences were analyzed using the FindTerm
program (SoftBerry). Molecular weights and isoelectric ...
Molecular Microbiology, Volume 59, Number 2, January 2006, pp. 541-550(10)
A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis
Grieshaber, N.A.(1); Grieshaber, S.S.(1); Fischer, E.R.(2); Hackstadt, T.
1: Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.
... promoter sequences and rho-independent terminators that could result in an 120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...
BestPal
Genetica
Volume 131, Number 3 / November 2007 p. 255-265
Isolation, gene structure, and comparative analysis of the S-layer gene sslA of Sporosarcina ureae ATCC 13881
Pavel M. Ryzhkov, , Kai Ostermann and Gerhard Rodel
Institut fu"r Genetik, Technische Universita"t Dresden, Helmholtzstr. 10, 01062 Dresden, Germany
... sequences and promoter regions were identified by means of BestPal and Bprom programs
from ''SoftBerry'' software package (http://www.softberry.com). ...
FoldRNA
PLoS ONE
7(5): e36709. doi:10.1371/journal.pone.0036709
The mbo Operon Is Specific and Essential for Biosynthesis of Mangotoxin in Pseudomonas syringae
Carrion VJ, Arrebola E, Cazorla FM, Murillo J, de Vicente A
Instituto de Hortofruticultura Subtropical y Mediterranea “La Mayora” (IHSM-UMA-CSIC), Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Malaga, Spain
Laboratorio de Patologia Vegetal, ETS de Ingenieros Agronomos, Universidad Publica de Navarra, Pamplona, Spain
...The promoter (BPROM) and terminator (FindTerm and FoldRNA) prediction was performed using SoftBerry online programmes (http://www.softberry.com, Mount Kisco, NY, USA). ...
PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108
Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence
Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and
bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611
...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the
BProm and TermFind/RNAFold programs (Softberry)....
Nature Protocols
ISSN 1750-2799 2009 DOI: 10.1038/nprot.2009.15
Efficient in silico Designing of Oligonucleotides for Artificial Gene Synthesis.
Garg, Abhishek D.
Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, United Kingdom
... 1. DNA mfold v.3.2 URL: http://frontend.bioinfo.rpi.edu/applications/mfold/cgi-bin/dna-form1.cgi.
2. FoldRNA URL: http://www.softberry.com/berry.phtml?topic=foldrna&group=programs&subgroup=
rnastruct. 3. Gene Design ?2.0 URL: http://baderlab.bme.jhu.edu/gd/. ...
FindMiRNA
Open Journal of Genetics
Vol.4 No.3(2014), Article ID:47053,12 pages DOI:10.4236/ojgen.2014.43020
Microsatellites and the Polyploid Guarana Plant: Diversity under a Sea of Alleles
da Silva Angelo P. C. et al.,
1Embrapa Western Amazon, Manaus, Brazil
2CNPq Fellowship at Embrapa Western Amazon, Manaus, Brazil
...On the other hand, the same TA repeat block displays a predicted potential to function as a
TATA box (Softberry-TSSP) and to promote the transcription of smRNAs located downstream. ...
...Finally, there is at least one predicted pre-miRNA
(Softberry-findmirna) in the MFT 3’-UTR, which could generate 21 or 24 nucleotides long mature miRNAs with the sequence 5’-ugccaggcguaauauauauau(aua)-3’ (Figure 4(b)). ...
PLoS ONE
(2013), 8(3): e56694. doi:10.1371/journal.pone.0056694
De novo Transcriptome Sequencing Reveals a Considerable Bias in the Incidence of Simple Sequence Repeats towards the Downstream of ‘Pre-miRNAs’ of Black Pepper.
Joy N, Asha S, Mallika V, Soniya EV
Plant Molecular Biology, Rajiv Gandhi Center for Biotechnology, Thiruvananthapuram, Kerala, India
... From the identified transcripts bearing SSRs, the 'unannotated transcripts' which were considered
as non-coding alone were chosen and subjected to miRNA predictions using 'findMiRNA'
programme [35]of Softberry (www.softberry.com. Accessed 2013 Jan 17). ...
Functional & Integrative Genomics
Volume 12, Issue 2 , pp 387-395 DOI
10.1007/s10142-012-0267-2
Identification of an miRNA candidate reflects the possible significance of transcribed microsatellites in the hairpin precursors of black pepper
Nisha Joy (1)
Eppurathu Vasudevan Soniya (1)
1. Plant Molecular Biology, Rajiv Gandhi Centre for Biotechnology, Thycaud P O, Poojappura, Thiruvananthapuram, 695 014, Kerala, India
... Hence, the sequence was analysed miRNA prediction tools like 'findMiRNA'
programme (Adai et al. 2005) of Softberry (www.softberry. ... b The predicted position
of pre- miRNA and mature miRNA using 'findMiRNA' of Softberry. ...
Journal of Bioinformatics and Sequence Analysis
Vol. 3(2), pp. 11-22, February 2011
Avian influenza and micro RNA: Role of bioinformatics
Pankaj Koparde 1 and Shailza Singh 2 *
1
Institute of Bioinformatics and Biotechnology, University of Pune, Pune -411007, India.
2National Centre for Cell Science, Pune University Campus, Pune -411007, India.
... Also, prediction of metazoan miRNAs for NS1 homologous proteins from humans was also
carried out. This was done using Softberry findmiRNA, miReval, TargetScanS and DIANA
microT web tools. ... Softberry findmiRNA http://www.softberry.com/ ...
OligoZip
Genome Res.
2011. 21: 2224-2241 DOI: 10.1101/gr.126599.111
Assemblathon 1: A competitive assessment of de novo short read assembly methods
Earl et al.,
1Center for Biomolecular Science and Engineering, University of California, Santa Cruz, California 95064, USA;
2Biomolecular Engineering Department, University of California, Santa Cruz, California 95064, USA;
25Softberry Inc., Mount Kisco, New York 10549, USA;
...and OligoZip (http://linux1.softberry.com/berry.phtml?topic=OligoZip). ...
MolQuest
BMC Genomics
2016,17:657 DOI: 10.1186/s12864-016-3017-3
Transcriptome analysis of smooth cordgrass (Spartina alterniflora Loisel), a monocot halophyte, reveals candidate genes involved in its adaptation to salinity
Bedre, R., Mangu, V. R., Srivastava, S., Sanchez, L. E., & Baisakh, N.
School of Plant, Environmental and Soil Sciences, Louisiana State University Agricultural Center; Department of Genetics and Biochemistry, Clemson University
... The positions
of the SSRs on open reading frames of the genes were determined by using gene finding
software MolQuest (FGENESH+; http://linux1.softberry.com/berry.phtml). ...
Fungal Biology
2016 doi:10.1016/j.funbio.2016.06.005
Cytochrome P450 complement (CYPome) of Candida oregonensis, a gut-associated yeast of bark beetle, Dendroctonus rhizophagus
Hernandez-Martinez, F., Briones-Roblero, C. I., Nelson, D. R., Rivera-Orduna, F. N., & Zuniga, G.
a Departamento de Zoologia, Escuela Nacional de Ciencias Biologicas, Instituto Politecnico Nacional, Prolongacion de Carpio y Plan de Ayala, Col. Sto. Tomas, Mexico D.F. CP 11340, Mexico
b Department of Microbiology, Immunology and Biochemistry, University of Tennessee Health Science Center, 858 Madison Ave. Suite G01, Memphis, TN 38163, USA
... in both processes have been documented (DiGuistini et al., 2011, Adams et al., 2013, Lah et
al., 2013 and Xu et al., 2016). ... based (HMM) gene structure prediction was performed using the
Fgenesh program (Solovyev 2007) in the MolQuest package v 2.4.5.1135 (SoftBerry Inc. ...
Fish & shellfish immunology
2016, 49, 110-121. doi:10.1016/j.fsi.2015.12.022
Septin genes in channel catfish (Ictalurus punctatus) and their involvement in disease defense responses
Fu, Q. et al.,
a State Key Laboratory of Estuarine and Coastal Research, East China Normal University, Shanghai, 200062, China
b The Fish Molecular Genetics and Biotechnology Laboratory, Aquatic Genomics Unit, School of Fisheries, Aquaculture and Aquatic Sciences, Auburn University, Auburn, AL, 36849, USA
... with a cutoff E-value of 1e ?10 . Fgenesh program of Molquest software (Softberry
Int.) was used to predict the genes from retrieved genomic scaffold sequences [56].
The simple modular architecture research tool (SMART http ...
Molecular biology reports
2014, 1-12. DOI:10.1007/s11033-014-3360-x
GhPSY, a phytoene synthase gene, is related to the red plant phenotype in upland cotton (Gossypium hirsutum L.)
Cai C. et al.,
1. State Key Laboratory of Crop Genetics & Germplasm Enhancement, Hybrid Cotton R & D Engineering Research Center, Ministry of Education, Nanjing Agricultural University, Nanjing, 210095, Jiangsu, China
... Gene prediction was performed using the Fgenesh program in MolQuest software v1.3.1
(http://?linux1.?softberry.?com/?berry.?phtml), and predicted genes and their GO (Gene Ontology)
categories were annotated with the Blast2GO program ([ 18 ], http://?www.?blast2go ...
American Journal of Molecular Biology
2013, 3, 115-130 DOI:10.4236/ajmb.2013.32016
Genome sequencing and next-generation sequence data analysis: A comprehensive compilation of bioinformatics tools and databases
Jose C. Jimenez-Lopez 1, Emma W. Gachomo 2,3, Sweta Sharma 2,3, Simeon O. Kotchoni 2,3
1Department of Biochemistry, Cell and Molecular Biology of Plants, Estacion Experimental del Zaidin, High Council for Scientific Research (CSIC), Granada, Spain
2Department of Biology, Rutgers University, Camden, USA
3Center for Computational and Integrative Biology (CCIB), Rutgers University, Camden, USA
Example of tools used for gene prediction are: 1) Glimmer, a system for finding genes in microbial DNA, especially the genomes of bacteria,
archaea, and viruses (http://www.ncbi.nlm.nih.gov/genomes/MICROBES/glimmer_3.cgi),
2) FgenesB, a package developed by Soft- berry Inc. for automatic annotation of bacterial genomes
(http://www.molquest.com/help/2.3/programs/FgenesB/about.html),
BMC Genomics
2013, 14:695 doi:10.1186/1471-2164-14-695
Histoplasma yeast and mycelial transcriptomes reveal pathogenic-phase and lineage-specific gene expression profiles
Edwards et al.,
1 The Department of Microbiology, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA
2 The Department of Microbial Infection and Immunity, Ohio State University, 484 W. 12th Ave., Columbus, OH 43210, USA
... Separately, the RNA-seq short reads were assembled into transcript contigs de novo (ie,
independent of the reference genome sequence) using Inchworm [39] and open reading frames
extracted from the transcripts with BestORF (Molquest package, Softberry). ...
Int. J. Mol. Sci.
2013, 14(7), 13559-13576; doi:10.3390/ijms140713559
First Insights into the Large Genome of Epimedium sagittatum (Sieb. et Zucc) Maxim, a Chinese Traditional Medicinal Plant
Liu et al.,
1 Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China
2 University of Chinese Academy of Sciences, Beijing 100039, China
... protein database (NR) [72]. Secondly, ab initio gene prediction was performed on
the ENS dataset using the FGENESH feature (Dicot plants-Arabidopsis) of the
MolQuest software package (softberry) [73]. Thirdly, a local BLAST ...
J Oral Microbiol.
2013; 5: 10.3402/jom.v5i0.19729. DOI:10.3402/jom.v5i0.19729
Cryptic Streptococcus mutans 5.6-kb plasmids encode a toxin–antitoxin system for plasmid stabilization
Anke Rheinberg, 1 Izabela Jadwiga Swierzy, 1 Tuan Dung Nguyen, 1 Hans-Peter Horz, 1,2 and Georg Conrads 1
1Division of Oral Microbiology and Immunology, Department of Operative and Preventive Dentistry & Periodontology, RWTH Aachen University Hospital, Aachen, Germany
2Department of Medical Microbiology, RWTH Aachen University Hospital, Aachen, Germany
... DNA and protein sequences were analyzed with the software programs GeneDoc
(www.psc.edu/biomed/genedoc), Pfam (Sanger Institute, Cambridge, England), MOTIFsearch
(GenomeNet, Kyoto, Japan), Softberry (MolQuest, Mount Kisco, USA), EMBOSS (European ...
PLoS Pathog
8(4): e1002643. doi:10.1371/journal.ppat.1002643
Sequential Delivery of Host-Induced Virulence Effectors by Appressoria and Intracellular Hyphae of the Phytopathogen Colletotrichum higginsianum.
Kleemann et al.,
Department of Plant-Microbe Interactions, Max-Planck-Institute for Plant Breeding Research, Cologne, Germany
Central Microscopy Max-Planck-Institute for Plant Breeding Research, Cologne, Germany
...ORFs were predicted from EST contigs with the Fusarium matrix of BESTORF (Molquest package, Softberry). ...
PLoS Pathog
8(9): e1002952. doi:10.1371/journal.ppat.1002952
Comparative Pathogenomics Reveals Horizontally Acquired Novel Virulence Genes in Fungi Infecting Cereal Hosts
Gardiner DM et al.,
Commonwealth Scientific and Industrial Research Organization (CSIRO) Plant Industry, Queensland Bioscience Precinct, Brisbane, Queensland, Australia
Plant Pathology, Institute of Integrative Biology, ETH Zurich, Zurich, Switzerland
...Protein coding genes were ab initio predicted in the F. pseudograminearum genome
using FGENESH [52] based on the F. graminearum gene models as part of the
MolQuest2 package from Softberry, AUGUSTUS [53] and GeneMark-ES...
Australasian Plant Disease Notes
April 2012 DOI
10.1007/s13314-012-0048-8
Clitoria yellow mottle virus: a tobamovirus from Northern Australia
Kejun Wei (1)
Adrian Gibbs (2)
Anne Mackenzie (3)
1. Faculty of Applied Science, University of Canberra, Canberra, ACT, 2617, Australia
2. Australian National University Emeritus Faculty, Canberra, ACT, 0200, Australia
3. CSIRO Division of Plant Industry, Canberra, ACT, 2601, Australia
... The genome of CYMV has the same structure as most other tobamoviruses (Stobbe
et al. 2011). The MolQuest- Softberry viral gene detector (http://www.softberry.com)
found four open reading frames (ORFs) in the CYMV sequence. ...
International Journal of Evolutionary Biology
Volume 2012 (2012), Article ID 970920, 8 pages
doi:10.1155/2012/970920
Purifying Selection Bias against Microsatellites in Gene Rich Segmental Duplications in the Rice Genome
P. C. Sharma, 1 Manish Roorkiwa l,1,2 and Atul Grover 1,3
1University School of Biotechnology, Guru Gobind Singh Indraprastha University, Sector 16C, Dwarka, New Delhi 110078, India
2Centre of Excellence in Genomics, International Crops Research Institute for the Semi-Arid Tropics, Patancheru, Hyderabad 502324, India
.. [7]. A simple sequence with repeat motif length of 1–6 bp spanning a minimal length
of 20 bp was considered as a microsatellite. Genes were predicted using MolQuest
ver. 1.6.2 (Softberry; http://www.molquest.com/). Following ...
J Gen Virol
November 2011 vol. 92 no. 11 2679-2690 DOI: 10.1099/vir.0.033852-0
The enigmatic genome of Chara australis virus
Gibbs et al.,
Research School of Biological Science, Australian National University, Canberra, ACT 0200, Australia
...ORFs were predicted by using the MolQuest-Softberry viral gene detector, ...
Eukaryotic Cell
January 2010, p. 164-172, Vol. 9, No. 1 doi:10.1128/EC.00194-09
Evolutionary Dynamics of Mating-Type Loci of Mycosphaerella spp. Occurring on Banana
Mahdi Arzanlou, 1,2,3 Pedro W. Crous, 1,2 and Lute-Harm Zwiers 1
Evolutionary Phytopathology, CBS-KNAW Fungal Biodiversity Center, Utrecht 3508 AD, The Netherlands,1 Wageningen University and Research Center (WUR), Laboratory of Phytopathology, Wageningen 6708 PB, The Netherlands,2
... reading frames (ORFs) and intron positions were predicted by comparing the sequence data
with known MAT sequences from other filamentous fungi, as well as by means of the FGENESH
gene prediction module from the MOLQUEST software package (Softberry, Inc., Mount ...
Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010
Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...
Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035
Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system
Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria
... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were
predicted by the BProm and FindTerm modules of the FGenesB gene prediction
program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...
J Bacteriol.
2008 May;190(9):3362-73. Epub 2008 Feb 29.
The sim operon facilitates the transport and metabolism of sucrose isomers in Lactobacillus casei ATCC 334
Thompson J, Jakubovics N, Abraham B, Hess S, Pikis A.
Microbial Biochemistry and Genetics Unit, NIDCR, National Institutes of Health, Bldg. 30, Rm. 325, Convent Dr. MSC-4350, Bethesda, MD 20892, USA
... The structure of operons was predicted by automated genome annotation using
the fgenesB module of the MolQuest software (Softberry Inc.). ...
Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10
Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii
Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504
... gordonii genome sequence were detected using the BProm and FindTerm modules of the
fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...
Fungal Genetics and Biology
Volume 44, Issue 5, May 2007, Pages 415-429
Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum
Ioannis Stergiopoulos et al.,
Laboratory of Phytopathology, Wageningen University and Research Centre, Binnenhaven 5, 6709 PD Wageningen, The Netherlands
... Barcelona, Spain) and the FEX (Solovyev et al., 1994) and FGENESH (Salamov and Solovyev,
2000) programs from the MOLQUEST software package (Softberry Inc. ...
Applied and Environmental Microbiology,
April 2007, p. 2290-2296, Vol. 73, No. 7
The SAR92 Clade: an Abundant Coastal Clade of Culturable Marine Bacteria Possessing Proteorhodopsin
Ulrich Stingl, Russell A. Desiderio, Jang-Cheon Cho, Kevin L. Vergin, and Stephen J. Giovannoni
Oregon State University, Department of Microbiology, Nash Hall 220, Corvallis, Oregon 97331, Division of Life and Marine Sciences, Inha University, Incheon 402-751, Republic of Korea
... of retinal, the chromophore of PR. Operon prediction using MolQuest (SoftBerry,
Inc., Mt. Kisco, NY) software indicated that the ...
Human-mouse synteny
Methods In Molecular Biology™
2008 Volume 426 Structural Proteomics: High-throughput Methods (June 10) pp. 37-47 10.1007/978-1-60327-058-8
Target Selection: Triage in the Structural Genomics Battlefield
James Raftery
School of Chemistry, The University of Manchester, Manchester, UK
... events. A mouse-human comparison can be seen at http://www.softberry.
com/berry.phtml?topic=human- mouse&prg=none 1.3. Filters ...
Human-mouse-rat synteny
Gene
Volume 316, 16 October 2003, Pages 47-56
The human SUMF1 gene, required for posttranslational sulfatase modification, defines a new gene family which is conserved from pro- to eukaryotes
Jobst Landgrebe1, Thomas Dierks1, Bernhard Schmidt and Kurt von FiguraCorresponding Author Contact Information
Abt. Biochemie II, Universitat Gottingen, Heinrich-Duker-Weg 12, 37073, Gottingen, Germany
... resources (http://www.ncbi.nlm.nih.gov/genome/guide/), the Human-Mouse Homology
Map (http://www.ncbi.nlm.nih.gov/Homology/) and Softberry's Human–Mouse–Rat Synteny (http://www.softberry.
com/). ...
Rat-mouse synteny
Mammalian Genome
Volume 18, Number 5 / May, 2007 pp. 300-309
Mammary tumor modifiers in BALB/cJ mice heterozygous for p53
Koch et al.,
(1) The University of Texas Graduate School of Biomedical Sciences and the Department of Cancer Genetics, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA
(2) Department of Epidemiology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, USA
... SoftBerry’s (http:// www.softberry.com/berry.phtml) Rat-Mouse Synteny for chromosome
1 of rat was used to determine regions of syntenic conservation between ...
Various programs
PloS one
2016, 11(4), e0153962. http://dx.doi.org/10.1371/journal.pone.0153962
Fine Mapping and Candidate Gene Analysis of the Leaf-Color Gene ygl-1 in Maize
Guan, H. et al.,
Maize Research Institute, Shandong Academy of Agricultural Sciences, Jinan, China, Key Laboratory of Biology and Genetic Improvement of North Summer Maize, Ministry of Agriculture, Jinan, China, National Maize Improvement Sub-Center, Jinan, China
.. Gene prediction and annotation within the located region was conducted by
Softberry and according to the Maize Genetics and Genomics Database. ...
Nucleic acids research
2016, 44(6), 2646-2660. doi: 10.1093/nar/gkv1331
Natural C-independent expression of restriction endonuclease in a C protein-associated restriction-modification system
Rezulak, M., Borsuk, I., & Mruk, I.
Department of Microbiology, University of Gdansk, Wita Stwosza 59, 80-308 Gdansk, Poland
... possibility of translational coupling. Moreover, the sequence analysis indicated a
potential Rho-independent transcription terminator in the 152-nt intergenic region
separating csp231IR and csp231IM genes (www.softberry.com). ...
Archives of Virology
2016, 1-8. doi:10.1007/s00705-016-3003-8
Molecular epidemiology of J-subgroup avian leukosis virus isolated from meat-type chickens in southern China between 2013 and 2014
Lin, W. et al.,
Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding, Key Laboratory of Chicken Genetics, Breeding and Reproduction, College of Animal ScienceSouth China Agricultural University, Ministry of Agriculture
Key Laboratory of Animal Health Aquaculture and Environmental Control
South China Collaborative Innovation Center for Poultry Disease Control and Product Safety
... This deletion was similar to the mutation in the 30 UTRs of Chinese ALV-J isolates SCDY1 (Fig.
3). Transcriptional regulation elements were identified in the U3 region of all ALV-J isolates using
SoftBerry software, including C/EBP, E2BP, NFAP-1, CArG box, Y box and CAAT. ...
PloS one
2016, 11(7), e0158159. doi: 10.1371/journal.pone.0158159
Expression Patterns of Three UGT Genes in Different Chemotype Safflower Lines and under MeJA Stimulus Revealed Their Potential Role in Flavonoid Biosynthesis
Guo, D. D. et al.,
Department of Pharmacognosy, College of Pharmacy, Second Military Medical University, 200433, Shanghai, China
... The 3D structures of three UGT proteins were predicted by SWISS
model (beta.swissmodel.expasy.org) (Fig 5). The nucleotide sequence and the deduced amino
acid sequence of three UGTs were predicted (linux1.softberry.com). ...
Scientific reports
2016, 6: 21047. doi: 10.1038/srep21047
Multiple functions of Na/K-ATPase in dopamine-induced salivation of the Blacklegged tick, Ixodes scapularis
Kim, D., Urban, J., Boyle, D. L., Park, Y.
1Department of Entomology, Kansas State University, 123 Waters Hall, Manhattan, KS 66506, USA
2Division of Biology, Microscopy Facility, Kansas State University, Ackert Hall, Manhattan, Kansas 66506, USA
... its homology with other arthropod Na/K-ATPases and
determining the translation initiation site prediction via GeneFinder (www.softberry.com ...
Developmental & Comparative Immunology
2016, 61, 116-125 doi:10.1016/j.dci.2016.03.011
A genome-wide survey of expansive NLR-C subfamily in miiuy croaker and characterization of the NLR-B30.2 genes
Li, J., Chu, Q., Xu, T.
Laboratory of Fish Biogenetics & Immune Evolution, College of Marine Science, Zhejiang Ocean University, Zhoushan, 316022, China
... Che et al., 2014) and whole genome database (Xu et al., 2016) by local BLASTn and tBLASTn
programs. To further confirm the accuracy of miiuy croaker NLR-B and NLR-C subfamily
sequences, the corresponding identified scaffolds were predicted by softberry software. ...
Gene
2016 doi:10.1016/j.gene.2016.07.018
Isolation and molecular characterization of a stationary phase promoter useful for gene expression in Gordonia
Singh, P., Chachan, S., Singhi, D., Srivastava, P.
Department of Biochemical Engineering and Biotechnology, Indian Institute of Technology, Delhi, India
... The secondary structure was predicted by RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.
cgi) and the promoter prediction software used was http://linux1.softberry.com/berry ...
Sains Malaysiana
2016, 45(5), 717-727.
Isolation and Characterization of Full-Length Cellulose Synthase Gene (HsCesA1) from Roselle (Hibiscus sabdariffa L. var. UMKL).
Seyedi, S. S., Tan, S. G., Namasivayam, P., Yong, C. S. Y.
Institute
.. PROMOTER ANALYSIS The promoter
sequence was analyzed using prediction plant promoter (http://linux1.softberry.com/berry.
phtml), neural network promoter prediction (http://www.fruitfly. ...
Molecular plant pathology
2016 DOI: 10.1111/mpp.12444
Fungal phytopathogens encode functional homologues of plant rapid alkalinisation factor (RALF) peptides
Thynne, E. et al.,
Plant Sciences Division, The Australian National University, Canberra, Australia
Evolution, Ecology and Genetics Division, Research School of Biology, The Australian National University, Canberra, Australia
... Masachis et al. (2016) grew plants for inoculation in vermiculite with no plant nutrients provided
and it is possible ... 2013; Nemri et al. 2014). Where annotations were not present or were different,
the online Softberry server (http://linux1.softberry.com/berry.phtml) ...
Arch Virol
2016 doi:10.1007/s00705-016-2965-x
Isolation, identification and evolution analysis of a novel subgroup of avian leukosis virus isolated from a local Chinese yellow broiler in South China
Li, X. et al.,
College of Animal Science, South China Agricultural University
Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding and Key Laboratory of Chicken Genetics, Breeding and Reproduction, Ministry of Agriculture
.. The transcriptional regulatory elements in the non-coding regions of the genome
were analyzed using Softberry (Softberry, Mount Kisco, NY, USA). ...
Plant Physiology and Biochemistry
2016, 108, 241-250. doi:10.1016/j.plaphy.2016.07.016
Molecular cloning and functional characterization of DkMATE1 involved in proanthocyanidin precursor transport in persimmon (Diospyros kaki Thunb.) fruit
Yang, S. et al.,
a Key Laboratory of Horticultural Plant Biology, Huazhong Agricultural University, Wuhan 430070, Hubei, China
b Hubei Collaborative Innovation Center for the Characteristic Resources Exploitation of Dabie Mountains, Huanggang 438000, Hubei, China
c Graduate School of Bioagricultural Sciences, Nagoya University, Nagoya 464-8601, Japan
... Translation
of gene sequences was performed using SoftBerry (http://linux1.softberry.com/). ...
Gene
2016, 316, 47-56 doi:10.1016/S0378-1119(03)00746-7
The human SUMF1 gene, required for posttranslational sulfatase modification, defines a new gene family which is conserved from pro-to eukaryotes
Landgrebe, J., Dierks, T., Schmidt, B., von Figura, K.
Abt. Biochemie II, Universitat Gottingen, Heinrich-Duker-Weg 12, 37073 Gottingen, Germany
.. and
mouse genome resources (http://www.ncbi.nlm.nih.gov/genome/guide/), the Human–Mouse
Homology Map (http://www.ncbi.nlm.nih.gov/Homology/) and Softberry's Human–Mouse ...
BMC genetics
2016, 17(1), 1. DOI: 10.1186/s12863-016-0350-0
DHPLC technology for high-throughput detection of mutations in a durum wheat TILLING population
Colasuonno, P. et al.,
Department of Soil, Plant and Food Sciences, section of Genetic and Plant Breeding, University of Bari "Aldo Moro"
... All these sequences were subjected to bioinformatic analysis via Aegilops tauschii genome
sequence database [42] and CerealsDB site [43] to distinguish the A and B genome
homoeologous copies, and via SoftBerry [44] to predict the gene structures. ..
Research in microbiology
2016, 167(5), 403-412. doi:10.1016/j.resmic.2016.03.005
The arginine deiminase system facilitates environmental adaptability of Streptococcus equi ssp. zooepidemicus through pH adjustment
Xu, B. et al.,
a College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China
b Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China
... According to the results of in silico analysis (Softberry, www.softberry.com), a promoter and a
terminator were predicted to be located in the intergenic region between arcB and arcD, which
indicated that arcA, orf2 and arcB, or arcD, arcT and arcC might also be transcribed as an ...
Advanced Science Letters
2016, 10(1), 146-152. DOI: http://dx.doi.org/10.1166/asl.2012.3743
Cloning and Bioinformatics Analysis of a Peroxidase Gene from Camellia Oleifera Seed
Chen, H., Tan, X., Shao, G.
Institute
... Second Structure Analysis and 3D Structure Prediction The Softberry Platform figured out that
-helix and -sheet were the main components in the second structure of Co-POD, and there ... IP:
93.91.26.12 On: Sun, 20 Mar 2016 03:18:59 Copyright: American Scientific Publishers ...
Gene
Volume 580, Issue 1, 10 April 2016, Pages 8–16 doi:10.1016/j.gene.2015.12.069
Molecular cloning, expression and characterization of acylpeptide hydrolase in the silkworm, Bombyx mori
Fu, P., Sun, W., Zhang, Z.
School of Life Sciences, Chongqing University, Chongqing 400044, China
... Therefore, we re-predicted the APH gene in the scaffold 2829 on the 17th chromosome of silkworm
using softberry (www.softberry.com). Based on the nucleotide sequence of the putative APH gene,
the specific primers were designed to clone the gene (Table S1). ...
Tree Genetics & Genomes
2016, 12(2), 1-11. DOI: 10.1007/s11295-016-0976-0
ADH and PDC genes involved in tannins coagulation leading to natural de-astringency in Chinese pollination constant and non-astringency persimmon (Diospyros kaki Thunb.)
Mo, R. et al.,
1. Key Laboratory of Horticultural Plant Biology (MOE), Huazhong Agricultural University, Wuhan, 430070, China
2. Hubei Collaborative Innovation Center for the Characteristic Resources Exploitation of Dabie Mountains, Huanggang, 438000, China
... The gene sequences were confirmed with BLAST in GenBank. The ORFs of genes were predicted
using online software (http://?linux1.?softberry.?com/?). Sequence identity analysis was
performed with ClustalW2 (Khater et al. 2012). RNA extraction and qRT-PCR analysis. ...
Scientific reports
2016, 6: 19104. doi: 10.1038/srep19104
A Novel Naturally Occurring Class I 5-Enolpyruvylshikimate-3-Phosphate Synthase from Janibacter sp. Confers High Glyphosate Tolerance to Rice
Yi, S. Y. et al.,
1State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
2National Key Laboratory of Crop Genetic Improvement and National Centre of Plant Gene Research, Huazhong Agricultural University, Wuhan 430070, China
... Sequence analysis. The inserted fragment from the plasmid pZY3 was sequenced by the
Genescript Company (Nanjing, China), and the nucleotide sequences were analyzed using
the Softberry Gene Finding Tool (http://linux1.softberry.com/berry). ...
Developmental & Comparative Immunology
2016, 61, 116-125. doi:10.1016/j.dci.2016.03.011
A genome-wide survey of expansive NLR-C subfamily in miiuy croaker and characterization of the NLR-B30. 2 genes
Li, J., Chu, Q., Xu, T.
Laboratory of Fish Biogenetics & Immune Evolution, College of Marine Science, Zhejiang Ocean University, Zhoushan, 316022, China
... To further confirm the accuracy of miiuy croaker NLR-B and NLR-C subfamily sequences, the
corresponding identified scaffolds were predicted by softberry software. The cDNA sequences
were aligned with the obtained scaffold using MAFFT (Katoh and Standley, 2013). 2.5. ...
FEMS microbiology letters
2016, 363(8), fnw063. DOI: http://dx.doi.org/10.1093/femsle/fnw063
Overexpression of two stress-responsive, small, non-coding RNAs, 6S and tmRNA, imparts butanol tolerance in Clostridium acetobutylicum
Jones, A. J., Venkataramanan, K. P., Papoutsakis, T.
1Department of Biological Sciences, University of Delaware, 15 Innovation Way, Newark, DE 19711, USA
2Molecular Biotechnology Laboratory, Delaware Biotechnology Institute, University of Delaware, 15 Innovation Way, Newark, DE 19711, USA
... The larger bands present in both tmRNA and 6S RNA northern blots are believed to be
transcriptional products from additional promoters on the p94MCS vector backbone located
upstream of its cloning site; using the Softberry promoter prediction tool (Solovyev and Salamov ...
Frontiers in plant science
2016, 7: 156. doi: 10.3389/fpls.2016.00156
Isolation and Characterization of DkPK Genes Associated with Natural Deastringency in C-PCNA Persimmon
Guan, C. et al.,
1Key Laboratory of Horticultural Plant Biology, Huazhong Agricultural University, Wuhan, China
2Institute of Horticultural Sciences, Jiangxi Academy of Agricultural Sciences, Nanchang, China
... The sequences of the primers used for RACE, genome walking and cloning are described in
Supplementary Table S1. The gene sequences were translated with online software
(http://linux1.softberry.com/) and confirmed with BLAST methods in GenBank (Benson et al., 2000). ...
Journal of Integrative Agriculture
2016 Doi: 10.1016/S2095-3119(15)61295-3
Isolation and molecular characterization of the FLOWERING LOCUS C gene 2 promoter sequence in radish (Raphanus sativus L.).
Rong-hua, L. U. O., Li-wang, L. I. U.
1National Key Laboratory of Crop Genetics and Germplasm Enhancement; Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (East China), M
inistry of Agriculture of P.R.China; College of Horticulture, Nanjing Agricultural University, Nanjing 210095, P.R. China.
2 Department of Plant Sciences, North Dakota State University, Fargo, ND 58108, USA.
... The promoter's' transcription start sites (TSS) were predicted by the Softberry databases ...
Research in microbiology
2016, Volume 167, Issue 5, June 2016, Pages 403–412 doi:10.1016/j.resmic.2016.03.005
The arginine deiminase system facilitates environmental adaptability of Streptococcus equi ssp. zooepidemicus through pH adjustment
Xu, B. et al.,
a College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China
b Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China
... According to the results of in silico analysis (Softberry, www.softberry.com), a promoter and a
terminator were predicted to be located in the intergenic region between arcB and arcD, which
indicated that arcA, orf2 and arcB, or arcD, arcT and arcC might also be transcribed as an ...
PloS one, 11(3), e0151657. http://dx.doi.org/10.1371/journal.pone.0151657
2016
KatG, the Bifunctional Catalase of Xanthomonas citri subsp. citri, Responds to Hydrogen Peroxide and Contributes to Epiphytic Survival on Citrus Leaves
Tondo, M. L. et al.,
Molecular Biology Division, Instituto de Biologia Molecular y Celular de Rosario, Consejo Nacional de Investigaciones Cientificas y Tecnicas, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, Rosario, Santa Fe, Argentina
Planta Piloto de Procesos Industriales Microbiologicos, Consejo Nacional de Investigaciones Cientificas y Tecnicas, San Miguel de Tucuman, Tucuman, Argentina
... bp upstream of the 5' end to 22 bp downstream of the 3' end of the ORF was amplified using the
primer pair ckatG-F and ckatG-R (Table 1). The amplified sequence included the putative promoter
sequence of the katG gene, previously predicted with SoftBerry (www.softberry ...
Horticultural Plant Journal
2016, Volume 2, Issue 1, Pages 16–25 doi:10.1016/j.hpj.2016.02.001
Evolution of TWIN SISTER of FT (TSF) Genes in Brassicaceae
Hu, Y. et al.,
Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China
... syntenic intergenic regions). Residues present in intergenic regions were
re-annotated using SoftBerry (http://linux1.softberry.com/). 3. Results. 3.1. Identification
of FT and TSF genes in Brassicaceae genomes. FT orthologs in ...
Scientific reports
2016, 6: 20532. doi: 10.1038/srep20532
Transcriptional Regulation of Atp-Dependent Chromatin Remodeling Factors: Smarcal1 and Brg1 Mutually Co-Regulate Each Other
Haokip, D. T. et al.,
1Chromatin Remodeling Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi 110067.
... gene was analyzed for its regulatory sequences. Bioinformatic analysis using
Softberry promoter prediction software (www.softberry.com) as well as information
from Huang et al. 23 showed that a putative promoter sequence was present upstream of the translation start
sequence and the promoter region was enriched in CpG islands....
Planta
2016, 1-11. DOI 10.1007/s00425-016-2511-9
Identification and functional characterization of the NAC gene promoter from Populus euphratica
Wang, J. Y., Wang, J. P., Yang, H. F.
1. Biotechnology Research Institute of the Chinese Academy of Agricultural Sciences, No. 12 Zhong Guan Cun South Street, 100081, Beijing, China
2. Tianjin University of Science and Technology, No. 29 13th Avenue, Tianjin Economic and Technological Development Area, 300457, Tianjin, China
... The transcription start site was analyzed using available online tools (http://?www.?Softberry.?
com). ... The elements were identified using PLACE. The transcription start site analysis was
completed using online tools (http://?www.?Softberry.?com). ...
Plant Physiology and Biochemistry
2016, 105, 90-101. doi:10.1016/j.plaphy.2016.04.011
Genome-wide identification and expression analysis of the metacaspase gene family in Hevea brasiliensis
Liu, H. et al.,
a Key Laboratory of Biology and Genetic Resources of Rubber Tree, Ministry of Agriculture, Rubber Research Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou 571737, China
b College of Agriculture, Hainan University, Haikou 570228, China
... Redundant sequences were removed after similarity comparison. The open reading frames
(ORFs) of candidate mRNA or genome DNA sequences were determined by NCBI ORF Finder
(http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and Softberry (http://linux1.softberry.com/). ...
Pakistan Journal of Agricultural Sciences
2016, 53(1), 27-33.
Characterization of ERD15 gene from cultivated tomato (Solanum lycopersicum).
Ziaf, K. et al.,
... Bioinformatics analyses: The sequencing results were used to get predicted peptide for SlERD15
using Genescan (MIT, Cambridge, MA) and Softberry. Intron in the genomic DNA was computed
by the Splign tool at NCBI (http://www.ncbi.nlm.nih.gov/sutils/splign/splign.cgi). ...
Virus Genes
2016, Volume 52, Issue 3 , pp 432-435 DOI: 10.1007/s11262-016-1300-7
Complete genome sequence of the cold-active bacteriophage VMY22 from Bacillus cereus
Qin K. et al.,
1. Faculty of Environmental Science and Engineering, Kunming University of Science and Technology, Kunming, 650500, China
2. Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming, 650500, China
... The Tandem Repeats Finder program was used to test for the presence of tandem repeats. Open
reading frames (ORFs) were predicted using program Softberry and RAST. ... The program Softberry
was used to predict promoter and transcription termination sites. ...
Proceedings of the National Academy of Sciences, India Section B: Biological Sciences
June 2013 DOI:10.1007/s40011-013-0192-8
Organization and Classification of Cytochrome P450 Genes in Castor (Ricinus communis L.)
Maryada Shailendar Kumar, Peram Ravindra Babu, Khareedu Venkateswara Rao, Vudem Dashavantha Reddy
1. Centre for Plant Molecular Biology, Osmania University, Hyderabad, 500007, India
... The CYP proteins which are below 300 and above 600 amino acids were validated
by using Softberry gene prediction tool (http://linux1.softberry. com/berry.phtml) by
increasing the scaffold size to 2,000 bp upstream of 50 end. ...
Gene
Volume 528, Issue 2, 10 October 2013, Pages 170–177 DOI: 10.1016/j.gene.2013.07.022
PLC-?1-Lf, a novel N-terminal extended phospholipase C-?1
Kim et al.,
a Department of Aquatic Life Medicine, Pukyong National University, Busan 608-737, South Korea
b Department of Embryology, Carnegie Institution for Science, Baltimore, MD 21218, USA
... The promoter region was predicted from the genomic DNA sequence using BIMAS Promoter
Scan Version 1.7 (http://bimas.dcrt.nih.gov/molbio/proscan/), Softberry (http://www.softberry.com/),
Promoter 2.0 Prediction (http://www.cbs.dtu.dk/services/Promoter/), and MOTIF Search ...
Molecular Biology Reports
April 2013, Volume 40, Issue 4, pp 2887-2896 DOI:10.1007/s11033-012-2304-6
Comparative characterization of sweetpotato antioxidant genes from expressed sequence tags of dehydration-treated fibrous roots under different abiotic stress conditions
Yun-Hee Kim, Jae Cheol Jeong, Haeng-Soon Lee, Sang-Soo Kwak
1. Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Gwahak-ro 125, Yuseong-gu, Daejeon, 305-806, Republic of Korea
... The isoelectric point (pI), molecular weight, and signal sequences of deduced proteins were
predicted using the ExPasy (http://www.expasy.org/tools), PSORT (http://psort.ims.u-tokyo.ac.
jp), and SoftBerry (http://www.softberry.com) programs. Stress treatment. ...
Current Microbiology
Volume 66, Issue 3 , pp 259-265 DOI: 10.1007/s00284-012-0266-5
Identification of Regulatory Sequences and Expression Analysis of OmpR Gene Under Different Stress Conditions in the Antarctic Bacterium Psychrobacter sp. G
Weizhi Song, Xuezheng Lin, Shuai Che
1. Key Lab of Marine Bioactive Substances, First Institute of Oceanography, SOA, Xianxialing Road 6, Qingdao, 266061, China
... Bioinformatics Analysis of OmpR503 The regulatory sequences, ie, -10 region, -35
region, ribosomal binding site (RBS), and open reading frame (ORF) were analyzed
using the Softberry (http://linux1. softberry.com/berry.phtml ...
J. Agric. Food Chem.
2013, 61 (26), pp 6423–6429
DOI: 10.1021/jf401537q
A Vigna radiata 8S Globulin ?? Promoter Drives Efficient Expression of GUS in Arabidopsis Cotyledonary Embryos
Chen et al.,
† College of Life Science, Jinan University, Guangzhou 510632, China
‡ School of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, China
... The transcription start site and TATA box were 126 predicted with software Softberry
(http://www.softberry.com). ... 32 Putative 188 cis-elements were identified and analyzed using
several promoter analysis software including 189 plantCARE, PLACE and Softberry. ...
World Journal of Microbiology and Biotechnology
September 2013 DOI:10.1007/s11274-013-1477-z
Cloning and characterization of squalene synthase gene from Poria cocos and its up-regulation by methyl jasmonate
Wang et al.,
1. Department of Bioengineering, College of Food Science, South China Agricultural University, 482 Wu-Shan Road, Tian-He District, Guangzhou, 510642, Guangdong, China
3. Guangdong VTR Bio-Tech Co., Ltd., Zhuhai, China
... Further analyses of the sequences were performed by using Recognition of Regulatory Motifs
with statistics in the softberry software (http://www.softberry.rn/berry.html) and PLACE Web
Signal Scan (http://www.dna.affrc.go.jp/PLACE/signalscan.html). ...
Appl. Environ. Microbiol.
October 2013 vol. 79 no. 19 6176-6179 DOI:10.1128/AEM.02015-13
Clostridium acidurici Electron-Bifurcating Formate Dehydrogenase
Shuning Wang a,b, Haiyan Huang a, Jorg Kahnt a and Rudolf K. Thauer a
Max Planck Institute for Terrestrial Microbiology, Marburg, Germanya
State Key Laboratory of Microbial Technology, Shangdong University, Jinan, People's Republic of Chinab
... terminator. Bioinformatics analysis was performed with Softberry software (Softberry,
Inc., NY) and the software provided by the ARNold finding terminators at IGM-Web
Server (http://rna.igmors.u-psud.fr/toolbox/arnold/index.php). ...
AAC
00423-13 May 2013, doi: 10.1128/AAC.00423-13
Complete Sequence of pOZ176, a 500-kb IncP-2 Plasmid Encoding IMP-9-mediated Carbapenem Resistance, from Outbreak Isolate Pseudomonas aeruginosa 96
Xiong et al.,
aDept. of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, ON, Canada
bPublic Health Ontario Laboratories, Toronto, ON, Canada
cCentre de Recherche en Infectiologie, CHU de Quebec, Quebec, QC, Canada
... Additional software, including IS finder 119 (http://www-is.biotoul.fr/is.html) and various Softberry
programs 120 (http://linux1.softberry.com/berry.phtml), were used for analysis of specific plasmid
genetic 121 features, such as IS elements and pathogenicity islands. ...
Functional & Integrative Genomics
Volume 13, Issue 4 , pp 425-434 DOI:10.1007/s10142-013-0333-4
Genes encoding the production of extracellular polysaccharide bioflocculant are clustered on a 30-kb DNA segment in Bacillus licheniformis
Yan et al.,
1. Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361005, People’s Republic of China
2. Key Laboratory for Chemical Biology of Fujian Province, Xiamen University, Xiamen, 361005, People’s Republic of China
... DNA sequencing was performed by Majorbio BioTechnologies Co., Ltd. (Shanghai, China).
The open reading frames (ORFs) and predicted genes in the DNA sequences were identified
using the SoftBerry program (http:// linux1.softberry.com/berry.phtml). ...
PloS one
April 09, 2013DOI: 10.1371/journal.pone.0060717
Klebsiella Phage vB_KleM-RaK2 — A Giant Singleton Virus of the Family Myoviridae
Simoliunas et al.,
Department of Molecular Microbiology and Biotechnology, Institute of Biochemistry, Vilnius University, Vilnius, Lithuania
... sequences was performed using extractUpStreamDNA (http://lfz.corefacility.ca/extractUpStre?
amDNA/), MEME analysis [36] at http://meme.sdsc.edu/meme/cgibin/meme.cg?i as well as
PePPER (http://pepper.molgenrug.nl/index.php/pep?per-tools) and SoftBerry (http://linux1 ...
Neurosignals
2013;21:129-149 (DOI:10.1159/000343672)
Brain-Site-Specific Proteome Changes Induced by Neuronal P60TRP Expression
Manavalan A. a, b · Mishra M. a, b · Sze S.K. a · Heese K. c
aSchool of Biological Sciences and bInstitute of Advanced Studies, Nanyang Technological University, Singapore, Singapore; cDepartment of Biomedical Engineering, Hanyang University, Seoul, Korea
... picture [10]. We used online databases, eg Panther (www.pantherdb.org), UniProt,
NCBI, and 'softberry' (http://linux1.softberry.com/ berry.phtml), to classify the functions
of the iTRAQ-identified p60TRP-regulated proteins. STRING ...
Genes & Genomics
Volume 35, Issue 1 , pp 47-58 DOI:10.1007/s13258-013-0068-6
Cloning and characterization of Tc1 family-derived PPTN related transposons from ridged-eye flounder (Pleuronichthys cornutus) and inshore hagfish (Eptatretus burgeri)
Sang Jung Ahn et al.,
1. Department of Biotechnology, Pukyong National University, Busan, 608-737, South Korea
2. Department of Embryology, Carnegie Institution for Science, Baltimore, MD, 21218, USA
... and Ensembl Multi blastview. Promoter regions in transposons were identified using
BIMAS Promoter Scan Version 1.7 (http://bimas.dcrt. nih.gov/molbio/proscan/),
Softberry (http://www.softberry. com/),Promoter 2.0 Prediction ...
Journal of Asia-Pacific Entomology
Volume 16, Issue 3, September 2013, Pages 257–261 DOI:10.1016/j.aspen.2013.03.004
Characterization of a novel mosquitocidal strain of Bacillus thuringiensis serovar aizawai which harbors a rolling-circle replication plasmid, pBt1–3
Liu et al.,
a Department of Agricultural Biotechnology, College of Agriculture and Life Science, Seoul National University, Seoul 151-742, Republic of Korea
b Division of Medical Entomology, Korea National Institute of Health, Chungbuk 363-951, Republic of Korea
... nih.gov/gorf/gorf.html) and Softberry (http://linux1.softberry.com/berry.phtml) were utilized to predict
the putative open reading frames (ORFs) of pBt1-3. The plasmid pBt1-3 nucleotide sequence
determined in this paper has been deposited in the GenBank database under the ...
Scientia Horticulturae
Volume 156, 7 June 2013, Pages 29–37 DOI:10.1016/j.scienta.2013.03.003
Functional analysis of female gametophyte specific promoters in Chinese cabbage
Soo-Yun Kim a, Hee-Ju Yu b, Joon Ki Hong c, Jong Gyu Woo a, Yul Kyun Ahn a
a Vegetable Research Division, National Institute of Horticultural and Herbal Science, RDA, Suwon 440-706, Republic of Korea
b Department of Life Sciences, the Catholic University of Korea, Buxheon 420-743, Republic of Korea
... Sequence information of At5g40260 was obtained from the National Center for Biotechnology
Information (NCBI) (http://www.ncbi.nlm.nih.gov/). Hypothetical coding sequences of At5g40260
and BRA0029160 were predicted using Softberry program (www.softberry.com). ...
Journal of Agricultural Science and Technology
Article 16, Volume 16, Issue 1, January 2014, Page 191-202
Isolation and Characterization of DBR2 Gene Promoter from Iranian Artemisia annua
R. Sarvestani; S. A. Peyghambary; A. Abbasi
Department of Agronomy and Plant Breeding, Agricultural College, University of Tehran, Karaj, Islamic Republic of Iran.
... DNA sequencing was performed on an ABI 373A automated sequence. Then, promoter prediction,
characterization, and search for the putative cis-acting elements were carried out using different
databases: Softberry, PlantCARE [23] and PLACE [24]. Page 4. ...
Applied Biochemistry and Biotechnology
Volume 169, Issue 3 , pp 950-959 DOI: 10.1007/s12010-012-0060-7
Selective n-Butanol Production by Clostridium sp. MTButOH1365 During Continuous Synthesis Gas Fermentation Due to Expression of Synthetic Thiolase, 3-Hydroxy Butyryl-CoA Dehydrogenase, Crotonase, Butyryl-CoA Dehydrogenase, Butyraldehyde Dehydrogenase, and NAD-Dependent Butanol Dehydrogenase
Vel Berzin, Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA
2. Ajinomoto–Genetika Research Institute, 1st Dorozhny pr. 1-1, 117545, Moscow, Russia
... Promoter and terminator sequences for the components of all vectors were identified using
SoftBerry Bacterial Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/).
Electrotransformation procedure [7] was used in modification. ...
PloS one
March 29, 2013DOI: 10.1371/journal.pone.0059802
Truncated Cotton Subtilase Promoter Directs Guard Cell-Specific Expression of Foreign Genes in Tobacco and Arabidopsis
Lei Han, Ya-Nan Han, Xing-Guo Xiao
State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing, China
... Online analysis using SoftBerry (http://linux1.softberry.com) and PLACE (http://www.dna.affrc.
go.jp/htdocs/PLACE/) [60] of the regulatory fragment revealed the presence of 1 TATA box
(?31) and 10 Dof protein-targeted cis-acting elements “(T/A)AAAG” (Fig. ...
Experimental & Molecular Medicine
2013) 45, e39; doi:10.1038/emm.2013.76 Published online 6 September 2013
Brain site-specific proteome changes in aging-related dementia
Manavalan et al.,
1School of Biological Sciences, Nanyang Technological University, Singapore, Singapore
2Department of Obstetrics and Gynecology, University of California Irvine, Irvine, CA, USA
... In addition, we used online databases (for example, Panther (Protein Analysis Through
Evolutionary Relationship) at www.pantherdb.org, UniProt, NCBI and 'softberry' http://linux1.
softberry.com/berry.phtml) to classify the functions of the iTRAQ-identified proteins modulated ...
J. Exp. Zool. (Mol. Dev. Evol.) .
9999:1–11 DOI: 10.1002/jez.b.22527
Transcriptional activity of transposable elements in coelacanth
Forconi et al.,
1Dipartimento di Scienze della Vita e dell'Ambiente, Universita Politecnica delle Marche, Ancona, Italy
2Institut de Genomique Fonctionnelle de Lyon, ENS Lyon, France
tools, such as Censor (Jurka et al., 1996, 2005), BLAST (Altschul et al., 1990), Softberry
(http://linux1.softberry.com/berry.phtml), RNAfold (http://rna.tbi.univie.ac.at), and MUSCLE ...
Plant Science
Volume 213, December 2013, Pages 106–113 DOI:10.1016/j.plantsci.2013.09.005
The tonoplast intrinsic aquaporin (TIP) subfamily of Eucalyptus grandis: Characterization of EgTIP2, a root-specific and osmotic stress-responsive gene
Marcela I. Rodrigues, Juliana P. Bravo, Flavio T. Sassaki, Fabio E. Severino, Ivan G. Maia
UNESP, Instituto de Biociencias, Departamento de Genetica, Botucatu, SP, Brazil
... and [27]. The transcriptional start site (TSS) prediction program [28] available at Softberry
(www.softberry.com) was used to predict the TSS position of EgTIP2. 2.11. Generation
of transgenic tobacco plants. The resulting pCAMBIAEgTIPpromo ...
The Crop Journal
Volume 1, Issue 1, October 2013, Pages 2–14 DOI:10.1016/j.cj.2013.07.007
Identification and fine mapping of two blast resistance genes in rice cultivar 93-11
Lei et al.,
a Institute of Crop Science, Chinese Academy of Agricultural Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Beijing 100081, China
b Key Laboratory of Crop Genetics and Germplasm Enhancement, Jiangsu Provincial Center of Plant Gene Engineering, Nanjing Agricultural University, Nanjing, Jiangsu 210095, China
... Ltd., Beijing. DNA and protein sequences were predicted using the softberry program
(http://linux1.softberry.com/), and then aligned with Nipponbare homologues using the
Gramene and EBI needle programs (http://www.ebi.ac.uk/). Table 4. ...
Journal of Integrative Plant Biology
DOI:10.1111/jipb.12144
SbHKT1;4, a member of the high affinity potassium transporter gene family from Sorghum bicolour, functions to maintain optimal Na+/K+ balance under Na+ stress
Wang et al.,
1The Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing, China
2College of Life Sciences, Capital Normal University, Beijing, China
... bright border fluorescence, which was consistent with the cell membrane-localised prediction
by TMHMM server and the softberry online database (www.softberry.com). To determine whether
the expression of the SbHKT1;4 was modulated by the external ...
Plant Molecular Biology Reporter
Volume 31, Issue 5 , pp 1176-1183 DOI:10.1007/s11105-013-0576-1
Structural and Transcriptional Characterization of rbcS Genes of Cotton (Gossypium hirsutum)
Kumar Paritosh, Deepak Pental, Pradeep Kumar Burma
1. Centre for Genetic Manipulation of Crop Plants, University of Delhi South Campus, Benito Juarez Road, New Delhi, 110021, India
2. Department of Genetics, University of Delhi South Campus, Benito Juarez Road, New Delhi, 110021, India
... Higo et al. 1999), PlantCARE (Lescot et al. 2002), and Softberry (www.softberry.com.)
databases. A number of putative regulatory motifs corresponding to the known
cis-elements of rbcS genes were found. The relative positions ...
Journal of Industrial Microbiology & Biotechnology
Volume 40, Issue 7 , pp 749-758 DOI:10.1007/s10295-013-1279-1
Gene replacement and elimination using ?Red- and FLP-based tool to re-direct carbon flux in acetogen biocatalyst during continuous CO2/H2 blend fermentation
Michael Tyurin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
... Promoter and terminator sequences. Promoter and terminator sequences used in both vectors
were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool
(http://linux1.softberry.com/). Primers for the synthetic genes used in this project are listed in Table ...
World Journal of Microbiology and Biotechnology
Volume 29, Issue 9 , pp 1611-1623 DOI:10.1007/s11274-013-1324-2
Selective methanol or formate production during continuous CO2 fermentation by the acetogen biocatalysts engineered via integration of synthetic pathways using Tn7-tool
Michael Tyurin, Michael Kiriukhin
1. Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA
2. Ajinomoto-Genetika Research Institute, 1st Dorozhny Pr. 1-1, 117545, Moscow, Russia
... early sporulation gene. Promoter and terminator sequences for the components of
all vectors used were identified using SoftBerry Bacterial Promoter, Operon and Gene
Finding tool (http://linux1.softberry.com/). The confirmation ...
Bioprocess Biosyst Eng.
2013 Jun 18. DOI:
Mevalonate production by engineered acetogen biocatalyst during continuous fermentation of syngas or CO2/H 2 blend.
Kiriukhin M, Tyurin M.
Syngas Biofuels Energy, Inc., P.O. Box 300819, Houston, TX, 77230, USA.
... Promoter and terminator sequences for the components of all vectors. Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR. ...
Journal of Applied Microbiology
Volume 114, Issue 4, pages 1033–1045, April 2013 DOI:10.1111/jam.12123
Expression of amplified synthetic ethanol pathway integrated using Tn7-tool and powered at the expense of eliminated pta, ack, spo0A and spo0J during continuous syngas or CO2/H2 blend fermentation
M. Kiriukhin 1, M. Tyurin 2,
1Ajinomoto-Genetika Research Institute, Moscow, Russia
2Syngas Biofuels Energy, Inc, Houston, TX, USA
... Promoter and terminator sequences for the components of all vectors. Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). rtPCR. ...
Applied Biochemistry and Biotechnology
Volume 170, Issue 6 , pp 1503-1524 DOI:10.1007/s12010-013-0285-0
Synthetic 2,3-Butanediol Pathway Integrated Using Tn7-tool and Powered Via Elimination of Sporulation and Acetate Production in Acetogen Biocatalyst
Michael Tyurin, Michael Kiriukhin
State
... Promoter and Terminator Sequences for the Components of All Vectors Promoter and terminator
sequences for the components of all vectors were identified using SoftBerry Bacterial Promoter,
Operon and Gene Finding tool (http://linux1.softberry.com/). RT-PCR ...
Theoretical and Applied Genetics
Volume 126, Issue 5 , pp 1273-1283 DOI:10.1007/s00122-013-2052-6
Structure, transcription and post-transcriptional regulation of the bread wheat orthologs of the barley cleistogamy gene Cly1
Ning et al.,
1. Plant Genome Research Unit, National Institute of Agrobiological Sciences (NIAS), 2-1-2 Kannondai, Tsukuba, Ibaraki, 305-8602, Japan
2. Graduate school of Horticulture, Chiba University, 648 Matsudo, Matsudo, Chiba, 271-8510, Japan
... cgi). Softberry Bacterial Genome Explorer (http://www.linux1.softberry.com/berry.
phtml) software was then used to allow the simultaneous comparison of distinct
annotated genomes. Phylogenetic analysis. Protein sequence ...
Antimicrob. Agents Chemother.
April 2013 vol. 57 no. 4 1603-1609 DOI:10.1128/AAC.01998-12
Elucidating the Regulon of Multidrug Resistance Regulator RarA in Klebsiella pneumoniae
Shyamasree De Majumdar a, Mark Veleba a, Sarah Finn b, Seamus Fanning b and Thamarai Schneiders a
aCentre for Infection and Immunity, Queen's University Belfast, Belfast, United Kingdom
bUCD Centre for Molecular Innovation and Drug Design, School of Public Health, Physiotherapy & Population Science, University College Dublin, Dublin, Ireland
... labeled “TSS” and shaded. The Shine-Dalgarno sequence is shown underlined, and
putative ?10, ?35 promoter regions determined through Softberry software analysis
are shown boxed and labeled accordingly. Our initial work ...
Genetic Testing and Molecular Biomarkers.
July 2013, 17(7): 553-561. doi:10.1089/gtmb.2012.0118.
Results of Genetic Testing in 855 Consecutive Unrelated Patients Referred for Long QT Syndrome in a Clinical Laboratory
Lieve et al.,
1Department of Pediatrics, Columbia University, New York, New York.
2Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands.
3GeneDx, Gaithersburg, Maryland.
... Browser. Variants were analyzed for predicted functional effect using PolyPhen2,
SIFT, Mutation Taster, Softberry Grantham score, cross species alignment, and location
compared with published functional domains of the protein. ...
Microbial Biotechnology,
6: 551–563. (2013) doi: 10.1111/1751-7915.12040
Tight coupling of polymerization and depolymerization of polyhydroxyalkanoates ensures efficient management of carbon resources in Pseudomonas putida.
Arias, S., Bassas-Galia, M., Molinari, G. and Timmis, K. N.
1Environmental Microbiology Laboratory, Helmholtz Centre for Infection Research, Braunschweig, Germany
2Institute for Microbiology, Technical University Braunschweig, Braunschweig, Germany
... The analysis of possible transcription promoters using Softberry, PromScan and the PDBG online
informatics tools, revealed that all pha genes are preceded by potential promoters and more
specifically, that both ? 70 and ? 54 potential promoters were found upstream of the ...
J. Bacteriol.
December 2013 vol. 195 no. 23 5233-5241 DOI:10.1128/JB.00965-13
Expanding the Cyanuric Acid Hydrolase Protein Family to the Fungal Kingdom
Anthony G. Dodge a, Chelsea S. Preiner a and Lawrence P. Wacket a,b
BioTechnology Institutea
Department of Biochemistry, Molecular Biology, and Biophysics,b University of Minnesota, St. Paul, Minnesota, USA
... directions by DNA sequence walking with a GenomeWalker Universal kit (Clontech, Mountain
View, CA) and primers SaroGSP1-5?, SaroGSP1-3?, SaroGSP2-5?, and SaroGSP2-3? (Table
1). Potential genes were predicted in the resulting sequence on the Softberry Inc. ...
ReseJ. Antimicrob. Chemother.
(2013) 68 (7): 1543-1550.
doi: 10.1093/jac/dkt078arch
Association of the novel aminoglycoside resistance determinant RmtF with NDM carbapenemase in Enterobacteriaceae isolated in India and the UK
Hidalgo et al.,
1Department of Animal Health and VISAVET, Universidad Complutense de Madrid, Madrid, Spain
2Antimicrobial Resistance and Healthcare Associated Infections (AMRHAI) Reference Unit, Health Protection Agency Microbiology Services – Colindale, London, UK
... into DH5? cells, which were then plated on agar containing ampicillin (50 mg/L) and gentamicin
(10 mg/L). A CloneJET PCR cloning kit (Fermentas International Inc.) was used to clone rmtF
along with its promoter region, previously determined with the Softberry online tool. ...
Plant Physiology and Biochemistry
Volume 69, August 2013, Pages 1–8 DOI:10.1016/j.plaphy.2013.04.007
Fad7 gene identification and fatty acids phenotypic variation in an olive collection by EcoTILLING and sequencing approaches
Sabetta et al.,
a Department of Soil, Plant and Food Sciences, Section of Genetics and Breeding, University of Bari «Aldo Moro», via Amendola 165/A, 70126 Bari, Italy
b CRA-OLI The Olive Growing and Olive Product Industry Research Centre, Contrada LiRocchi, 87036 Rende, Cosenza, Italy
c Department of Crop Systems, Forestry and Environmental Sciences, University of Basilicata, via N. Sauro 85, 85100 Potenza, Italy
... 4.3. EcoTILLING and PCR sequencing. The full-length genomic sequence was analysed
by CODDLE (http://www.proweb.org/input/) and SoftBerry (http://linux1.softberry.com/
berry.phtml) software and the gene structure was predicted. ...
J. Integr. Plant Biol.
Volume 55, Issue 5, pages 462–472, May 2013 doi: 10.1111/jipb.12027
Fine mapping of RppP25, a southern rust resistance gene in maize.
Zhao et al.,
1National Maize Improvement Center of China, Key Laboratory of Biology and Genetic Improvement of Maize (Ministry of Agriculture), China Agricultural University, Beijing 100193, China
2National Key Facility for Crop Gene Resources and Genetic Improvement (NFCRI), Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 10081, China
... Prediction of candidate gene The gene structure prediction program SoftBerry (http://linux1.softberry.
com/berry.phtml) and the GENSCAN Web Server at MIT (http://genes.mit.edu/GENSCAN.html)
were used to predict candidate gene in the resistance gene region. ...
J Bone Miner Res,
28: 1041–1049. doi: 10.1002/jbmr.1849
SNX10 mutations define a subgroup of human autosomal recessive osteopetrosis with variable clinical severity
Pangrazio et al.,
1Unita Organizzativa di Supporto/Istituto di Ricerca Genetica e Biomedica, Milan Unit, CNR, Milano, Italy
2Humanitas Clinical and Research Center, Rozzano, Italy
3Division of Immunology, Department of Pediatrics, University of Gothenburg, Gothenburg, Sweden
... the UCSF Chimera package. PovRay was used to generate high-quality images.
The effect of the mutation c.111 + 5G > C was tested using the software
www.fruitfly.org, www.cbs.dtu.dk, and www.linux1.softberry.com. Results. ...
Antibiotics
2013, 2(1), 11-27; doi:10.3390/antibiotics2010011
The Staphylococcus aureus Membrane Protein SA2056 Interacts with Peptidoglycan Synthesis Enzymes
Quiblier et al.,
1 Institute of Medical Microbiology, University of Zurich / Gloriastrasse 32, 8006 Zurich, Switzerland
2 Centre of Quality Control in Microbiology / ul. Chelmska 30/34, 00-725 Warsaw, Poland
... downstream of both femX and sa2056 [15]. Apart from the promoter upstream of femX,
the program softberry identified an additional putative promoter in the intergenic region
between femX and sa2056 [16]. Microarray analyses ...
Advance Journal of Food Science & Technology
2013, Vol. 5 Issue 4, p440-444. 5p.
Cloning of Formate dehydrogenase Gene and Effect on the Waterlogging Tolerance of Brassica napus L
Xu et al.,
... 442 expasy. org and http://www.softberry.com/ berry. phtml). Evaluation of waterlogging
tolerance of 12 materials: One-hundred seeds were submerged in 10 mL of deionized water
in tubes for 24 h in an incubator at 20°C (Ueno and Takahashi, 1997). ...
HAYATI Journal of Biosciences
Vol 20, No 3 (2013)
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
LUCIA KUSUMAWATI, KATHRYN KURAN, NIJAT IMIN, ULRIKE MATHESIUS, MICHAEL DJORDJEVIC
... The open reading frame from Softberry was blasted to the University of Oklahoma Medicago
truncatula genome blast server (http://www.genome.ou.edu/medicago_ blast.html) using blastn
to get the contig number (for example mtgsp_008f03.Contig1 for FAD). ...
Applied Microbiology and Biotechnology
Volume 97, Issue 5 , pp 1941-1952 DOI:10.1007/s00253-012-4044-x
Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen
Sun et al.,
1. State Key Laboratory of Microbial Technology, Shandong University, Jinan, 250100, People’s Republic of China
2. Scientific Research Center, Tsingtao Brewery Co.LTD, Qingdao, People’s Republic of China
... Predictions of the open-reading frames (ORF), prokaryotic promoters, and terminators were
performed at http://opal.biology.gatech.edu/ GeneMark/gmhmm2_prok.cgi and http://www.softberry.
com/ berry.phtml. Transcription analysis of the S-layer proteins by qRT-PCR ...
Biology of Reproduction
89(4):Article 98, 1-11. 2013 doi: http://dx.doi.org/10.1095/biolreprod.113.111849
Expression, Regulation, and Promoter Activation of Vanin-2 (VNN2) in Bovine Follicles Prior to Ovulation
Khampoun Sayasith 2, Jean Sirois , and Jacques G. Lussier
Centre de recherche en reproduction animale and the departement de biomedicine veterinaire, Faculte de medecine veterinaire, Universite de Montreal, Saint-Hyacinthe, Quebec, Canada
2Correspondence: Khampoun Sayasith, Centre de recherche en reproduction animale and the departement de biomedecine veterinaire, Faculte de medecine veterinaire, Universite de Montreal, Saint-Hyacinthe, Quebec, Canada
... The promoter sequence was analyzed to identify consensus cis-acting elements (TFSEARCH:
TRANS FAC databases [release date December 1999 and previously hosted at
http://motif.genome.jp/]; Transfac DB, Biobase GmbH [http://linux1.softberry.com/berry.phtml], ...
Fungal Genetics and Biology
Volume 61, December 2013, Pages 69–79 DOI:10.1016/j.fgb.2013.10.006
Disruption of the nitrogen regulatory gene AcareA in Acremonium chrysogenum leads to reduction of cephalosporin production and repression of nitrogen metabolism
Jinyang Li a, b, 1, Yuanyuan Pan a, 1, Gang Liu a
a State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China
b University of Chinese Academy of Sciences, Beijing 100049, China
... The insert in the resulting plasmid was verified by sequencing. To confirm AcareA, the
large fragment containing speculated AcareA was analyzed by software softberry. 2.4.
Disruption, complementation and overexpression of AcareA. ...
PloS one
November 13, 2013DOI: 10.1371/journal.pone.0079036
Identification and Molecular Characterization of FKF1 and GI Homologous Genes in Soybean
Li et al.,
MOA Key Lab of Soybean Biology (Beijing), National Key Facility of Crop Gene Resource and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Haidian District, Beijing, China
CAS Key Laboratory of Biofuels, Shandong Provincial Key Laboratory of Energy Genetics, Qingdao Institute of BioEnergy and BioProcess Technology, Chinese Academy of Sciences, Qingdao, Shandong, China
... three GI homologs were determined based on further analysis in Softberry database (http://www.softberry.com/berry.phtml). ...
Molecular Biology Reports
Volume 40, Issue 10 , pp 5907-5912 DOI:10.1007/s11033-013-2697-x
Construction and application of the vectors to identify genes encoding exported proteins of Escherichia coli
Niu et al.,
1. College of Animal Sciences, Zhejiang University, Hangzhou, 310058, China
2. Veterinary Bureau of Yuhang District, Hangzhou, 311100, China
... gorf/, http://bioinformatics.biol.rug.nl/websoftware/orf/orf_start.php), signal peptide prediction
(http://www.cbs.dtu.dk/services/SignalP/) and promoter analysis tools (http://www.fruitfly.org/
seq_tools/promoter.html, http://molbiol-tools.ca/promscan/, http://linux1.softberry.com/berry ...
Microbiological Research
Volume 168, Issue 8, 1 October 2013, Pages 477–484 DOI:10.1016/j.micres.2013.04.002
A serine hydroxymethyltransferase from marine bacterium Shewanella algae: Isolation, purification, characterization and l-serine production
Wei Jiang, Bingzhao Xia, Ziduo Liu
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
... A fragment sequence (722 bp) was obtained by PCR with degenerate primers, DP-F and
DP-R. Then through TAIL-PCR, sequences matching and executing the ORF-finding program
on DNA sequence (http://linux1.softberry.com/berry.phtml), the full-length sequence of the ...
Applied Microbiology and Biotechnology
Volume 97, Issue 11 , pp 4965-4976 DOI:10.1007/s00253-013-4851-8
ku70 and ku80 null mutants improve the gene targeting frequency in Monascus ruber M7
Yi He, Qingpei Liu, Yanchun Shao, Fusheng Chen
3. College of Food Science and Technology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China
1. National Key Laboratory of Agro-Microbiology, Huazhong Agricultural University, Wuhan, 430070, Hubei Province, People’s Republic of China
... Sequence prediction (http://linuxl.softberry.com/berry.phtml) of these two frag- ments revealed
that the putative M. ruber M7 ku70 gene consists of a 1,905-nt long open reading frame (ORF)
interrupted by five introns and the putative M. ruber M7 ku80 gene consists of a 1,998-nt ...
The Journal of Neuroscience
28 August 2013, 33(35): 14087-14097; doi: 10.1523/JNEUROSCI.2710-13.2013
Small-Fiber Neuropathy Nav1.8 Mutation Shifts Activation to Hyperpolarized Potentials and Increases Excitability of Dorsal Root Ganglion Neurons
Huang et al.,
1Department of Neurology and
2Center for Neuroscience and Regeneration Research, Yale University School of Medicine, New Haven, Connecticut 06510,
... Polyphen-2, and Sift characterize the substitution as “c25, likely to interfere with function,” “possibly
damaging,” and “nontolerated.” Splice prediction programs (SpliceSiteFinder, MaxEntScan,
NNSplice, GeneSplicer, Human Splicing Finder, Fruitfly, and Softberry) predict that ...
3 Biotech
September 2013, DOI:10.1007/s13205-013-0164-y
Siderophore biosynthesis genes of Rhizobium sp. isolated from Cicer arietinum L.
Bejoysekhar Datta, Pran K. Chakrabartty
1. Department of Botany, University of Kalyani, Nadia, Kalyani, West Bengal, 741 235, India
2. Acharya J.C. Bose Biotechnology Innovation Centre, Madhyamgram Experimental Farm, Madhyamgram, Kolkata, West Bengal, 700 129, India
... an operon. In the sequence of 4,921 bp, a probable ribosome-binding site (AGGAGG)
was identified six bp upstream of the ATG start codon of sidC of BICC 651 using Promoter
prediction search tool (www.softberry.com). A presumable ...
BMC Genetics
2013, 14:51 doi:10.1186/1471-2156-14-51
Linking the potato genome to the conserved ortholog set (COS) markers
Lindqvist-Kreuze et al.,
1 International Potato Center, Lima, Peru
2 USDA-Agricultural Research Service, Vegetable Crops Research Unit, University of Wisconsin, Madison, WI, USA
... genome sequence, but no gene hit. We ran those genome regions through Softberry
gene prediction and were able to identify genes matching the COS marker hit region
(results not shown). Further work focusing on the genome ...
Molecular Plant-Microbe Interactions
(2013). 26(6), 676-685. DOI:
A Rhamnose-Rich O-Antigen Mediates Adhesion, Virulence, and Host Colonization for the Xylem-Limited Phytopathogen Xylella fastidiosa
Clifford, J. C., Rapicavoli, J. N., & Roper, M. C.
Department of Plant Pathology and Microbiology, University of California, Riverside 92512, U.S.A.
... Online tools used for DNA manipulation and DNA and protein analysis were Integrated Microbial
Genomes, the National Center for Biotechnology Information, San Diego Supercomputer Center
Biology Workbench, Netprimer, and SoftBerry. Mutagenesis and complementation. ...
Journal of bacteriology
(2013). 195(4), 896-907. DOI:10.1128/JB.01973-12
Identification of the Treponema pallidum subsp. pallidum TP0092 (RpoE) Regulon and Its Implications for Pathogen Persistence in the Host and Syphilis Pathogenesis
Giacani, L., Denisenko, O., Tompa, M., & Centurion-Lara, A.
aDepartments of Medicine
bComputer Science and Engineering, University of Washington, Seattle, Washington, USA
...Transcription unit prediction (using http://linux1.softberry.com), hydropathy plot analysis (using http://web.expasy.org/protscale/), and prediction of transmembrane regions (using http://www.ch.embnet.org/software/TMPRED_form.html) identified TP0093 as the best putative anti-? factor for TP0092....
Journal of Invertebrate Pathology
Volume 110, Issue 1, May 2012, Pages 24?32, DOI: 10.1016/j.jip.2012.01.008
The lipopolysaccharide biosynthesis core of the Mexican pathogenic strain Serratia entomophila is associated with toxicity to larvae of Phyllophagablanchardi
Zitlhally Rodriguez-Segura b, Jianwu Chen c, Francisco J. Villalobos d, Sarjeet Gill c, Maria Eugenia Nunez-Valdez a
a Facultad de Ciencias, Universidad Autonoma del Estado de Morelos, Av. Universidad 1001, Col. Chamilpa, CP 62209, Cuernavaca, Morelos, Mexico
b Centro de Investigacion en Biotecnologia, Universidad Autonoma del Estado de Morelos, Av. Universidad 1001, Col. Chamilpa, CP 62209, Cuernavaca, Morelos, Mexico
... Automated sequencing was performed at the University of California Riverside Core
Instrumentation Facility. DNA sequences were analyzed by the Softberry Inc. software. ...
According to the DNA sequence analysis done by using the Softberry, Inc. ...
Journal of Bone and Mineral Research
DOI: 10.1002/jbmr.1849
SNX10 mutations define a subgroup of human Autosomal Recessive Osteopetrosis with variable clinical severity
Pangrazio et al.,
1UOS/IRGB, Milan Unit, CNR, Milano, Italy
2Humanitas Clinical and Research Center, Rozzano, Italy
... Chimera package. PovRay was used to generate high quality images. The effect of
the mutation c.111+5G>C was tested using the software www.fruitfly.org,
www.cbs.dtu.dk and www.linux1.softberry.com. Results Genetic findings ...
Journal of Integrative Agriculture
Volume 11, Issue 10, October 2012, Pages 1592–1600 DOI: 10.1016/S2095-3119(12)60162-2
Isolating the Mutator Transposable Element Insertional Mutant Gene mio16 of Maize Using Double Selected Amplification of Insertion Flanking Fragments (DSAIFF)
ZHONG et al.,
a National Key Laboratory of Crop Genetic Improvement/Huazhong Agricultural University, Wuhan 430070, P.R. China
b Institute of Upland Food Crops, Guizhou Academy of Agricultural Sciences/Guizhou Center of Maize Engineering Techniques, Guizhou 550006, P.R. China
... The alignment between the genomic sequence and the cDNA showed that the Mio16
gene contained a 2 550-bp ORF encod- ing a putative 850 aa protein (http://www.
softberry. com), which was composed of 11 exons and 10 introns. ...
PLoS ONE
7(5): e37611. doi:10.1371/journal.pone.0037611
A Unique Regulator Contributes to Quorum Sensing and Virulence in Burkholderia cenocepacia
O'Grady EP, Viteri DF, Sokol PA
Department of Microbiology, Immunology and Infectious Diseases, University of Calgary, Calgary, Alberta, Canada
... 1). BCAM1871 expression appeared to be driven from the cepI promoter as no other
promoter was identified upstream of the BCAM1871 ORF using promoter prediction
software (www.softberry.com or http://www.fruitfly.org, data not shown). ...
Advanced Science Letters
(2012) Volume 10, Number 1, pp. 153-157(5) DOI: 10.1166/asl.2012.3745
Isolation and Characterization of An Aldo-Keto Reductase cDNA from Camellia Oleifera Seed
Shao, Gongfeng; Tan, Xiaofeng; Chen, Hongpeng,
Laboratory
...Second Structure Analysis and 3D Structure Prediction The Softberry Platform figured out that -helix and -sheet were the main components in the second structure of Co-AKR ..
Advanced Science Letters
(2012) Volume 10, Number 1, pp. 168-172(5) DOI: 10.1166/asl.2012.3722
A Novel Metallothionein Gene Putatively Related to Fatty Acid Biosynthesis in Camellia Oleifera Seeds Confronted to Heavy Metal Stress.
Zhu, Fengyun; Tan, Xiaofeng; Chen, Hongpeng
...The sub-cellular location result predicted by Softberry revealed Co-MT deposit in cytoplasmid and it was a secreted protein. ...
mBio
3(3):e00035-12. doi:10.1128/mBio.00035-12.
Nontypeable Pneumococci Can Be Divided into Multiple cps Types, Including One Type Expressing the Novel Gene pspK
In Ho Park et al.,
Department of Pathology, School of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, USAa;
Department of Pediatrics, School of Medicine, Ewha Womans University, Seoul, South Korea
...Insertional sequences and the open reading frames (ORFs) in the DNA sequences were identified using a BLAST search at the National Center for Biotechnology Information website (http://www.ncbi.nlm.nih.gov/BLAST), Softberry (http://www.softberry.com) free web-based software,...
J Mol Endocrinol
April 1, 2012 48 89-97 DOI: 10.1530/JME-11-0105
17b-Estradiol regulates cyclin A1 and cyclin B1 gene expression in adult rat seminiferous tubules
Camille Bois 1,2, Christelle Delalande 1,2, Helene Bouraima-Lelong 1,2, Philippe Durand 3 and Serge Carreau 1,2
1Universite de Caen Basse Normandie,
EA 2608, Laboratoire «Estrogenes et Reproduction», Esplanade de la Paix, F-14032 Caen Cedex, France
2INRA USC 2006,
F-14032 Caen, France
... al. 1990). Promoter regions of cyclin A1 and cyclin B1 gene were analyzed using
TF Search and Softberry online software. The threshold was fixed at 0.85. Terminal
dUDP transferase nick end labeling. Squash preparations ...
Applied Microbiology and Biotechnology
April 2012 DOI: 10.1007/s00253-012-4044-x
Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen
Zhilan Sun et al.,
1. State Key Laboratory of Microbial Technology, Shandong University, Jinan, 250100, People’s Republic of China
2. Scientific Research Center, Tsingtao Brewery Co.LTD, Qingdao, People’s Republic of China
... Predictions of the open-reading frames (ORF), prokaryotic promoters, and terminators were
performed at http://opal.biology.gatech.edu/ GeneMark/gmhmm2_prok.cgi and http://www.softberry.
com/ berry.phtml. Transcription analysis of the S-layer proteins by qRT-PCR ...
Journal of Integrative Agriculture
Volume 11, Issue 6, June 2012, Pages 898–909 DOI: 10.1016/S2095-3119(12)60080-X,
Cloning and Characterization of a Somatic Embryogenesis Receptor-Like Kinase Gene in Cotton (Gossypium hirsutum)
Ya-li SHI*,
Rui ZHANG*,
Xiao-ping WU,
Zhi-gang MENG,
San-dui GUO
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P.R. China
... The full- length cDNA sequence was obtained by primers GS1- 5PF and GS1-3PR (Table
2). Sequence analysis The full-length genomic sequence obtained was analyzed using
the Softberry program (http://linux1.softberry.com/ berry.phtml). ...
American Journal of Molecular Biology
2012 Volume 2, Issue 2 , pp 132-139
Molecular cloning and characterization of fruit specific promoter from Cucumis sativus L.
Sindhu Chandrika Unni ; Padmanabhan Jayanthikumari Vivek ; Thakidiyil Thankappan Maju ; Rintu Thundiyil Varghese ; Eppurathumana Vasudevan Soniya
... promoter for successful fruit specific expression and this region was amplified using PRF and
PRR primers (Figure 1(e)). The 1.5 kb promoter region along with the 5' region of expansin gene
was shown in Figure 2. Transcription start site was predicted using Softberry online tool ...
Genetica
Volume 140, Issue 7-9 , pp 337-347 DOI: 10.1007/s10709-012-9685-2
Characterization of an Ac transposon system based on apt1-m1 (Ac) on the long arm of maize chromosome 9
Fei Wang et al.,
1. School of Life Sciences, Shanghai Key Laboratory of Bio-energy Crop, Shanghai University, 333 Nanchen Road, Shanghai, 200444, People’s Republic of China
... analysis. If the tr-Ac/Ds inserted into a gene, the gene structure could be identified
based on annotations in maizesequence (www.maizesequence.org) and prediction
using gene-finding tools for Eukaryota (www.softberry.com). ...
AEM
Published ahead of print 24 August 2012, DOI: 10.1128/AEM.02065-12
Unveiling the expression characteristics of IspC, a cell wall-associated peptidoglycan hydrolase in Listeria monocytogenes during growth under stress conditions
Jennifer Ronholm 1,2, Xudong Cao 3 and Min Lin 1,2
1Canadian Food Inspection Agency, Ottawa Laboratory Fallowfield, Ottawa, Ontario K2H 8P9, Canada
2Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, Ontario K1H 8M5, Canada
... Corresponding to this experimentally determined TSS, there are 209 -10 (TGGTAAAAT) and
-35 (TTGTTA) elements spaced by 19bp, as predicted by a bacterial 210 promoter program
(http://linux1.softberry.com) (Fig. 1). Examination of the sequence in this 211 ...
Theoretical and Applied Genetics
Volume 125, Issue 8 , pp 1717-1726 DOI: 10.1007/s00122-012-1948-x
Mapping and characterization of the major quantitative trait locus qSS7 associated with increased length and decreased width of rice seeds
Xianjin Qiu, Rong Gong, Youbin Tan, Sibin Yu
1. National Key Laboratory of Crop Genetic Improvement, and College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, China
... The 23-kb target region contains two common predicted genes (LOC_Os07g41200,
LOC_Os07g41210) based on three genome annotation databases (http://rice.plantbiology.
msu.edu/; http://ricegaas.dna.affrc.go.jp/; http://linux1.softberry.com/) (Fig. ...
Viruses.
2012 April; 4(4): 581–612.
Published online 2012 April 16. doi: 10.3390/v4040581
RNA-Sequencing Analysis of 5' Capped RNAs Identifies Many New Differentially Expressed Genes in Acute Hepatitis C Virus Infection
Papic et al.,
1 Department of Medicine, University of Utah, 30 N 1900 E #3C310, Salt Lake City, UT 84132, USA
2 Huntsman Cancer Institute, University of Utah, 30 N 1900 E #3C310, Salt Lake City, UT 84132, USA
...Using the ORF Finder software (Softberry) we found a small peptide of 48 amino acids encoded in this unannotated transcript ...
Insect Molecular Biology
Volume 21, Issue 4, pages 395–404, August 2012 DOI: 10.1111/j.1365-2583.2012.01145.x
Physiological significance of alternatively spliced exon combinations of the single-copy gene class A chitin synthase in the insect Ostrinia furnacalis (Lepidoptera)
M. Qu, Q. Yang
School of Bioscience and Biotechnology, Dalian University of Technology, Dalian, China
... DNA and protein sequence analyses. DNA sequence data for OfCHSA (GenBank ID: EU376026)
were translated to amino acids by DNAMAN software (Lynnon, Quebec, Canada). The splicing
sites of OfCHSA were analysed with SoftBerry (http://www.softberry.com/all.htm). ...
Front Plant Sci.
2012; 3: 54. DOI: 10.3389/fpls.2012.00054
Turnover of Phosphatidic Acid through Distinct Signaling Pathways Affects Multiple Aspects of Pollen Tube Growth in Tobacco
Pleskot et al.,
1Institute of Experimental Botany, v. v. i., Academy of Sciences of the Czech Republic, Prague, Czech Republic
2Department of Experimental Plant Biology, Faculty of Science, Charles University in Prague, Prague, Czech Republic
... Since gene models based on computer annotations often contain errors, exon-intron structures were
manually curated using SoftBerry server4 with the aid of experimentally verified
sequences or sequences from closely related species. ...
Molecular Microbiology
Volume 86, Issue 2, pages 394–410, October 2012
DOI: 10.1111/j.1365-2958.2012.08203.x
sarA negatively regulates Staphylococcus epidermidis biofilm formation by modulating expression of 1 MDa extracellular matrix binding protein and autolysis-dependent release of eDNA
Christner et al.,
1Institute for Medical Microbiology, Virology and Hygiene, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany
2Institute for Clinical Chemistry, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany
... Bioinformatics analysis of 150 nucleotides up-stream of the embp start codon identified three
high affinity SarA binding sites as defined by Sterba and co-workers (Sterba et al., 2003), two
located near or within the anticipated ?10 region (http://linux1.softberry.com), suggesting ...
J. Virol.
November 2012 vol. 86 no. 21 11937-11938 doi: 10.1128/?JVI.02009-12
Complete Genome Sequence of a J Subgroup Avian Leukosis Virus Isolated from Local Commercial Broilers
Hongxin Li et al.,
a College of Animal Science, South China Agricultural University, Guangzhou, China
... Japan), sequenced three times, and assembled using DNAStar (version 7). Multiple-sequence
alignment was performed with Clustal X (BioEdit version 7). The transcriptional regulatory
elements in noncoding regions of the genome were analyzed with SoftBerry (Softberry, Inc ...
Journal of Biotech Research
[ISSN: 1944-3285] 2012; 4:54-64
Acetogen biocatalyst Clostridium sp. MTEtOH871 engineered with our proprietary electrotransformation technology and equipment: continuous synthesis gas fermentation for selective ethanol production
Vel Berzin and Michael Tyurin*
Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX 77019, USA.
... Promoter and terminator sequences were identified using Softberry Bacterial Promoter, Operon
and Gene finding tool (http://linux1.softberry.com/). We used the origin of replication of a
~35-copy number 1.8 kb cryptic plasmid pMT351 we have isolated previously from the ...
J. Virol.
doi: 10.1128/?JVI.01894-12 October 2012 vol. 86 no. 19 10907-10908
Complete Genome Sequence of an Avian Leukosis Virus Isolate Associated with Hemangioma and Myeloid Leukosis in Egg-Type and Meat-Type Chickens
Jun Ji et al.,
aCollege of Animal Science, South China Agricultural University, Guangzhou, China
bCollege of Veterinary Medicine, South China Agricultural University, Guangzhou, China
... Multiple-sequence alignment was performed with Clustal X (BioEdit version 7). The
transcriptional regulatory elements in noncoding regions of the genome were analyzed
with SoftBerry (Softberry, Inc., Mount Kisco, NY). Comparative ...
Molecular Biology Reports
July 2012, Volume 39, Issue 7, pp 7347-7353 DOI
10.1007/s11033-012-1566-3
Assay and characterization of an osmolarity inducible promoter newly isolated from Bacillus subtilis
Wei-Wei Zhang (1)
Qiu-Rong Gao (1)
Ming-Ming Yang (2)
Hui Liu (2)
Dun Wang (1)
1. College of Life Sciences, Northwest A&F University, Yangling, 712100, People’s Republic of China
2. College of Animal Sciences, Yangling, 712100, People’s Republic of China
... Analysis of DNA sequence of the pro- moter-active fragment was carried out online with NCBI
blast 2.0 (http: www.ncbi.nih.gov). The promoter was predicted by softberry (http:
www.softberry.com). Results and discussion Characterization of an osmolarity-inducible promoter ...
Journal of Plant Physiology
Volume 169, Issue 11, 15 July 2012, Pages 1112–1120
Molecular characterization of two ethylene response factor genes in sweetpotato that respond to stress and activate the expression of defense genes in tobacco leaves
Yun-Hee Kima, 1,
Jae Cheol Jeonga, 1,
Seyeon Parka, b,
Haeng-Soon Leea, b,
Sang-Soo Kwaka, b,
a Environmental Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Gwahak-ro 125, Yuseong-gu, Daejeon 305-806, Republic of Korea
b Green Chemistry and Environmental Biotechnology, University of Science and Technology (UST), 217 Gajungro, Yuseong-gu, Daejeon 305-350, Republic of Korea
... To predict the isoelectric point (pI), molecular weight and signal peptides of the deduced proteins,
the ExPasy (http://www.expasy.org/tools), PSORT (http://psort.ims.u-tokyo.ac.jp) and SoftBerry
(http://www.softberry.com) programs were used. Subcellular localization of ERFs. ...
African Journal of Biotechnology
Vol. 11 (29), pp. 7378-7387, 10 April, 2012
DOI: 10.5897/AJB11.2875
Isolating Barley (Hordeum vulgare L.) B1 Hordein Gene Promoter and Using Sequencing Analaysis For The Identification of Conserved Regulatory Elements By Bioinformatic Tools
Kobra Nalbandi1, Bahram Baghban Kohnehrouz2* , Khalil Alami Saeed1 and Ashraf Gholizadeh3
1Ramin Agricultural and Natural Resources University, Mollasani, Ahwaz, Iran.
2Department of Plant Breeding and Biotechnology, University of Tabriz, Tabriz, Iran.
3Research Institute for Fundamental Sciences (RIFS), University of Tabriz, Tabriz, Iran.
... Hor.W. To find regulatory elements in promoter sequences, the PLANTCARE
(http://bioinformatics.psb.ugent.be/ webtools/plantcare/html) and Softberry
(http://linux1.softberry.com/berry.phtml) software were applied. Analysis ...
Polar Biology
October 2012, Volume 35, Issue 10, pp 1515-1524 DOI
10.1007/s00300-012-1191-6
Characterization and expression analysis of three cold shock protein (CSP) genes under different stress conditions in the Antarctic bacterium Psychrobacter sp. G
Weizhi Song (1) (2)
Xuezheng Lin (1) (2)
Xiaohang Huang (1) (2)
1. First Institute of Oceanography, SOA, Qingdao, 266061, China
2. Key Lab of Marine Bioactive Substances, SOA, Qingdao, 266061, China
... The regulatory sequences (ie, -10 region, -35 region, ribosomal binding site (RBS), DB, and
ORF) were analyzed using the Softberry (http:// linux1.softberry.com/berry.phtml) (Panicker
et al. 2010) and Neural Network Promoter Prediction (http://www. ...
Advanced Science Letters
Volume 10, Number 1, May 2012 , pp. 146-152(7) DOI: http://dx.doi.org/10.1166/asl.2012.3743
Cloning and Bioinformatics Analysis of a Peroxidase Gene from Camellia Oleifera Seed
Chen, Hongpeng; Tan, Xiaofeng; Shao, Gongfeng
... and chemical property of predicted protein, genetic evo- lution, homology modeling, 3D structural
optimization and ren- dering were analyzed with Codon W, Antheprot 5.0, Clustral X,
SWISS-MODEL sever, VMD1.8.5 and POV-Ray respectively, NCBI center, Softberry platform ...
Gene.
2012 Oct 1;507(1):9-19. Epub 2012 Jul 24.
BnC15 and BnATA20, the different putative components, control anther development in Brassica napus L.
Wan L, Hu Q, Hong D, Yang G.
National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei, PR China.
... downstream of the coding sequence. Full cDNA sequence was analyzed using
Softberry (http://linuxl.softberry.com/berry.phtml) and GeneScan Web Server
(http://genes.mit.edu/- GENSCAN.html). The deduced protein was viewed ...
Molecular Breeding
Volume 29, Issue 4 , pp 939-949 DOI
10.1007/s11032-011-9644-0
Validation of DGAT1-2 polymorphisms associated with oil content and development of functional markers for molecular breeding of high-oil maize
Yuchao Chai et al.,
1. National Maize Improvement Center of China, Beijing Key Laboratory of Crop Genetic Improvement, China Agricultural University, Beijing, 100193, China
2. Pioneer Hi-Bred International Inc., Johnston, IA, 50131–1004, USA
... 2008) was used to BLAST against the maize high-throughput genomic sequences database
(www.ncbi.nlm.nih.gov) to obtain the B73 genomic sequence. The gene structure was predicted
using online tools from the Softberry web site (www.softberry.com). ...
Animal Biotechnology
Volume 23, Issue 3, 2012 pages 156-173 DOI:10.1080/10495398.2012.662925
Screening of a Xylanase Clone from a Fosmid Library of Rumen Microbiota in Hu Sheep
Dr. Jiakun Wang et al.,
a College of Animal Sciences, Zhejiang University, Hangzhou, China
b Center for Biomedicine and health, Hangzhou Normal University, Hangzhou, China
... The GC composition was studied using the DNAStar software. Open reading frames (ORFs) were
characterized using Softberry online program using the criteria of sequences encoding peptides
longer than 50 amino acids (http://linux1.softberry.com/berry.phtml). ...
Letters in Applied Microbiology
Volume 55, Issue 2, pages 149–154, August 2012 DOI: 10.1111/j.1472-765X.2012.03272.x
Selective production of acetone during continuous synthesis gas fermentation by engineered biocatalyst Clostridium sp. MAceT113
V. Berzin1, M. Kiriukhin2, M. Tyurin1
1 ?Syngas Biofuels Energy, Inc., Houston, TX, USA
2 Ajinomoto – Genetika Research Institute, Moscow, Russia
... ljungdahliiDSM13528 (NC_014328, region 1295679…1297232, nucleotides 1–564). Promoter
and terminator sequences used in both vectors were identified using Softberry Bacterial
Promoter, Operon and Gene Finding tool (http://linux1.softberry.com/). ...
International Journal of Medical Microbiology
Volume 302, Issue 3, July 2012, Pages 117–128 http://dx.doi.org/10.1016/j.ijmm.2012.03.003
Surface-associated motility, a common trait of clinical isolates of Acinetobacter baumannii, depends on 1,3-diaminopropane
Evelyn Skiebe et al.,
a Robert Koch-Institute, Wernigerode Branch, D-38855 Wernigerode, Germany
b CEA, DSV, IG, Genoscope, 2 rue Gaston Cremieux, 91057 Evry, France
... A 3815-bp fragment encompassing genes A1S-2453 (ddc) and A1S-2454 (dat) as well as the
putative promoter and terminator regions (analysed with the softberry package available online:
http://linux1.softberry.com/berry.phtml) was amplified by PCR (see Fig. ...
Applied Biochemistry and Biotechnology
Volume 167, Issue 2 , pp 338-347 DOI
10.1007/s12010-012-9697-5
Elimination of Acetate Production to Improve Ethanol Yield During Continuous Synthesis Gas Fermentation by Engineered Biocatalyst Clostridium sp. MTEtOH550
Vel Berzin (1)
Michael Kiriukhin (2)
Michael Tyurin (1)
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA
2. Ajinomoto-Genetika Research Institute, 1st Dorozhny pr. 1-1, Moscow, Russia, 117545
... 2627526) flanking cat gene (FM201786) CDS. Promoter and terminator sequen-
ces were identified using Softberry Bacterial Promoter, Operon and Gene finding
tool (http:// linux1.softberry.com/). Detection of synthetic cat was ...
Gene
Volume 498, Issue 2, 1 May 2012, Pages 280–287
DNA adenine methyltransferase (Dam) controls the expression of the cytotoxic enterotoxin (act) gene of Aeromonas hydrophila via tRNA modifying enzyme-glucose-inhibited division protein (GidA)
Tatiana E. Erova a,
Valeri G. Kosykh b,
Jian Sha a,
Ashok K. Chopra a
a Department of Microbiology & Immunology, University of Texas Medical Branch, Galveston, TX 77555-1070, USA
b Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-1070, USA
... vector (Invitrogen, Carlsbad, CA). Upstream sequences of the gidA and act genes
of A. hydrophila SSU contained promoter regions, which we identified by using the
SoftBerry program (www.softberry.com). To obtain PCR products ...
Mol. Plant
(2012) 5 (5): 1042-1057. doi: 10.1093/mp/sss003
The Arabidopsis AP2/ERF Transcription Factor RAP2.11 Modulates Plant Response to Low-Potassium Conditions
Min Jung Kima,
Daniel Ruzickaa,
Ryoung Shinb and
Daniel P. Schachtmana,c,1
aDonald Danforth Plant Science Center, St Louis, MO 63132, USA
bRIKEN Plant Science Center, Yokohama, Kanagawa 230-0045, Japan
... (A) AtHAK5 promoter contains ERE, CGTCA (MeJA responsiveness), ABRE (ABA
responsiveness), GCC-box, and CE3 (ABA responsiveness) elements. SoftBerry
(www.softberry.com/berry.phtml) was used as a promoter prediction tool. ...
Journal of Biotech Research
2012; 4:1-12
Electrofusion of cells of Acetogen Clostridium sp. MT 351 with erm(B) or cat in the chromosome
Michael Tyurin 1, *, Michael Kiriukhin 2, Vel Berzin 1
1Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX 77019, USA. 2Ajinomoto Company, 1st Dorozny pr. 1-1, Moscow, Russia 117545
... downstream of erm(B) (AY334073), respectively. Promoter and terminator sequences
were identified using Softberry Bacterial Promoter, Operon and Gene Finding tool
(http://linux1.softberry.com/). The resulted synthetic ermB operon ...
Theoretical and Applied Genetics
August 2012 DOI
10.1007/s00122-012-1954-z
QTL mapping of resistance to gray leaf spot in maize
Yan Zhang et al.,
1. National Maize Improvement Center of China, China Agricultural University, 2 West Yuanmingyuan Road, Haidian District, Beijing, 100193, People’s Republic of China
2. Institute of Food Crops, Yunnan Academy of Agricultural Sciences, Longtou Street, Kunming, 650205, People’s Republic of China
... In an attempt to find out more InDels, we predicted putative genes in the single-/low- copy
sequence using tools in software SoftBerry (http:// linux1.softberry.com/berry.phtml), and designed
primers in either 50- or 30- ends of the predicted genes as high-level polymorphism is ...
Applied Biochemistry and Biotechnology
September 2012 DOI
10.1007/s12010-012-9864-8
Cre-lox66/lox71-Based Elimination of Phosphotransacetylase or Acetaldehyde Dehydrogenase Shifted Carbon Flux in Acetogen Rendering Selective Overproduction of Ethanol or Acetate
Vel Berzin (1)
Michael Kiriukhin (2)
Michael Tyurin michael@syngasbiofuelsenergy.com (1)
1. Syngas Biofuels Energy, Inc., 2441 Del Monte, Houston, TX, 77019, USA
2. Ajinomoto—Genetika Research Institute, 1st Dorozhny pr. 1-1, Moscow, Russia, 117545
... Inactivation of pta was performed as described [13] using integration vector pMT674pta. Promoter
and terminator sequences used in all integration vectors were identified using Softberry Bacterial
Promoter, Operon, and Gene Finding tool (http://linux1.softberry.com/). PCR ...
The Journal of Immunology
July 15, 2012 vol. 189 no. 2 539-550 doi: 10.4049/jimmunol.1103204
Identification, Cloning, and Functional Characterization of the IL-1 Receptor Antagonist in the Chicken Reveal Important Differences between the Chicken and Mammals
Mark S. Gibson*,
Mark Fife*,
Steve Bird†,
Nigel Salmon* and
Pete Kaiser*,1
*Institute for Animal Health, Compton, Berkshire RG20 7NN, United Kingdom; and
†Department of Biological Sciences, School of Science and Engineering, University of Waikato, Hamilton 3240, New Zealand
... HE608245). Putative promoter regions were analyzed using Softberry (http://linux1.
softberry.com/berry.phtml). 5? RACE was carried out using the SMARTer RACE cDNA
amplification kit (Clontech) following the manufacturer's instructions. ...
Plant Molecular Biology Reporter
August 2012 DOI
10.1007/s11105-012-0499-2
Molecular characterization of a cellulose synthase gene (AaxmCesA1) isolated from an Acacia auriculiformis x Acacia mangium hybrid
Seok Yien Christina Yong (1)
Ratnam Wickneswari wicki@ukm.my (2)
1. Department of Biology, Faculty of Science, Universiti Putra Malaysia, 43400 UPM, Serdang, Selangor Darul Ehsan, Malaysia
2. School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor Darul Ehsan, Malaysia
... cgi /iprscan.cgi). Promoter sequence was analyzed using Prediction of Plant Promoter
(http:// www.softberry.com/berry.phtml) and Neural Network Pre- diction
(http://www.fruitly.org/seq_tools/promoter.html) software. The cDNA ...
Insect Biochemistry and Molecular Biology
Available online 25 September 2012 http://dx.doi.org/10.1016/j.ibmb.2012.09.006
In Press, Uncorrected Proof — Note to users
Expansion of the silkworm GMC oxidoreductase genes is associated with immunity
Wei Sun a et al.,
a The Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400715, China
b College of Life Sciences, Chongqing University, Chongqing 400044, China
... domains. It was hypothesized that either of these two genes could be two single genes.
Indeed, both of them could be divided into two genes when re-analyzed using
Softberry (http://linux1.softberry.com/berry.phtml). Therefore ...
Antimicrob. Agents Chemother.
August 2012 vol. 56 no. 8 4450-4458 doi: 10.1128/?AAC.00456-12
Characterization of RarA, a Novel AraC Family Multidrug Resistance Regulator in Klebsiella pneumoniae
Mark Veleba a
aCentre for Infection and Immunity, Queen's University Belfast, Medical Biology Centre, Belfast, United Kingdom
bInstitute for Medical Microbiology, Immunology and Hygiene, University of Cologne, Cologne, Germany
... The junction between the C tail and the start site of rarA open reading frame was taken
to be the transcriptional start site. Predictions of the putative ?10 and ?35 hexamers were
determined using SoftBerry analysis of the intergenic region. ...
Cellular Signalling
Volume 25, Issue 1, January 2013, Pages 168–177 http://dx.doi.org/10.1016/j.cellsig.2012.09.006,
Structural diversity of the cAMP-dependent protein kinase regulatory subunit in Caenorhabditis elegans
Martyna W. Pastok et al.,
Institute of Integrative Biology, University of Liverpool, Biosciences Building, Crown St., Liverpool, L69 7ZB, United Kingdom
... http://opal.biology.gatech.edu/GeneMark/eukhmm.cgi), Grail (http://compbio.ornl.gov/Grail-1.3/),
GeneScan (http://genes.mit.edu/GENSCAN.html) and GeneFinder (http://www.bioscience.org/
urllists/genefind.htm) together with various tools available from Softberry (http://linux1 ...
MPMI
November 2012, Volume 25, Number 11
Pages 1419-1429
http://dx.doi.org/10.1094/MPMI-06-12-0155-R
A Polyketide Synthase Gene, ACRTS2, Is Responsible for Biosynthesis of Host-Selective ACR-Toxin in the Rough Lemon Pathotype of Alternaria alternata
Y. Izumi et al.,
1Faculty of Agriculture, Kagawa University, Miki, Kagawa 761-0795 Japan; 2Department of Plant Pathology, Washington State University, Pullman 99164-6430 U.S.A.
... with the largest contig at approximately 41 kb. One 17 kb contig (C14014) contained 12 three
open reading frames (ORFs) that encoded two unknown proteins and a putative 13 PKS,
identified via SoftBerry and BLAST/FASTA searches. The putative 14 ...
Human Mutation
Volume 33, Issue 11, pages 1576–1588, November 2012 DOI: 10.1002/humu.22142
Comprehensive functional assessment of MLH1 variants of unknown significance
Ester Borras et al.,
1
Hereditary Cancer Program, Catalan Institute of Oncology, ICO-IDIBELL, Hospitalet de Llobregat, Spain
2
Medical Clinic 1, Johann Wolfgang Goethe-University Clinic, Frankfurt, Germany
... To identify potential splicing mutations, disruption or creation of SS were evaluated
using NNSplice [Reese et al., 1997], Splicerport [Dogan et al., 2007], NetGene2 Server
[Hebsgaard et al., 1996], and SoftBerry [Burset et al., 2001]. ...
Microbial Pathogenesis
Volume 52, Issue 4, April 2012, Pages 227–238 http://dx.doi.org/10.1016/j.micpath.2012.01.004,
The Mycobacterium avium ESX-5 PPE protein, PPE25-MAV, interacts with an ESAT-6 family Protein, MAV_2921, and localizes to the bacterial surface
Michael McNamara a, b,
Lia Danelishvili a,
Luiz E. Bermudez a, b, c
a Department of Biomedical Sciences, College of Veterinary Medicine, Oregon State University, Corvallis, OR, USA
b Molecular and Cellular Biology Program, College of Science, Oregon State University, Corvallis, OR, USA
... PCR analysis (Suppl. Table 4). Bioinformatics analysis of potential operons and
terminator sites was performed using Softberry software (Softberry, Mount Kisko,
NY). 2.13. Statistical analysis. Each experiment was repeated ...
Extremophiles
Volume 16, Issue 1 , pp 35-43
DOI: 10.1007/s00792-011-0403-2
Effects of salts on activity of halophilic cellulase with glucomannanase activity isolated from alkaliphilic and halophilic Bacillus sp. BG-CS10
Guimin Zhang (1) (2)
Shunyi Li (2)
Yanfen Xue (1)
Liangwei Mao (2)
Yanhe Ma (1)
1. State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101, China
2. College of Life Sciences, Hubei University, Wuhan, 430062, China
... The signal peptide was identified using the SignalP 3.0 server (http:// www.cbs.dtu.dk/
services/SignalP), and the promoter sequence was predicted online (http://linux1.
softberry. com/berry.phtml). Construction of the expression plasmid ...
Appl. Environ. Microbiol.
January 2012 vol. 78 no. 2 581-585 DOI 10.1128/?AEM.06611-11
Controlled Gene Expression in Bifidobacteria by Use of a Bile-Responsive Element
Lorena Ruiz et al.,
Department of Microbiology and Biochemistry of Dairy Products, Instituto de Productos Lacteos de Asturias (IPLA), Consejo Superior de Investigaciones Cientificas (CSIC), Villaviciosa, Asturias, Spain
... Schematic representation of the constructs used in this work. (A) Main features of the betA
upstream region (unpublished data) deduced after the analysis with Softberry and Neural Network
Promoter Prediction. Pin-like symbols represent potential inverted repeats. ...
Scientific Reports
2, Article number: 228 doi:10.1038/srep00228 2012
Recruitment in the sea: bacterial genes required for inducing larval settlement in a polychaete worm
Ying Huang, Sean Callahan & Michael G. Hadfield
... Promoter prediction was performed using the BPROM program, which predicts bacterial promoters and is available through the Softberry website (http://linux1.softberry.com/berry.phtml?topic=index&group=program&subgroup=promoter) ...
Breast Cancer Research and Treatment
Volume 121, Number 1, 177-184, DOI: 10.1007/s10549-009-0532-9
Potentially functional polymorphisms in ESR1 and breast cancer risk: a meta-analysis
Ni Li, Jing Dong, Zhibin Hu, Hongbing Shen and Min Dai
(1) National Office of Cancer Prevention and Control, Cancer Hospital/Institute, Chinese Academy of Medical Sciences, 17 Panjiayuannanli, Chaoyang District, 100021 Beijing, China
(2) Department of Epidemiology and Biostatistics, Cancer Center, Nanjing Medical University, 210029 Nanjing, China
... For SNPs in the promoter region and 50UTR, we use software in the web site of Softberry
(http://www. softberry.com/berry.phtml) and use TF search (http://www. cbrc.jp/research/db/
TFSEARCH.html) to see the change of transcription factor binding. ...
Plant Molecular Biology
DOI: 10.1007/s11103-009-9557-z
OsPRP3, a flower specific proline-rich protein of rice, determines extracellular matrix structure of floral organs and its overexpression confers cold-tolerance
Kodiveri Muthukalianan Gothandam 1 , Easwaran Nalini 1, Sivashanmugam Karthikeyan 1 and Jeong Sheop Shin 2
(1) School of Bio Sciences & Technology, VIT University, Vellore, 632 014, Tamil Nadu, India
(2) School of Life Sciences & Biotechnology, Korea University, Seoul, 136-701, Korea
... 2000). Nucleotide and deduced amino acid sequence were analyzed with the Basic Local Align-
ment Search Tool (BLAST) at the National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov) and the Soft berry programme (http://www.softberry.com). ...
Biology of Reproduction
Published online before print March 3, 2010, doi: 10.1095/?biolreprod.109.082644
Kit System in the Zebrafish Ovary--Evidence for Functional Divergence of Two Isoforms of Kit (Kita and Kitb) and Kit Ligands (Kitlga and Kitlgb) During Folliculogenesis
Kai Yao and
Wei Ge
... For kitb, a partial genomic sequence was available in the Ensembl Databank (
ENSDARG00000056133; http://www.ensembl.org/Danio_rerio/) and the exons of kitb were
predicted by CBS PREDICTION SERVERS (http://www.cbs.dtu.dk/services/) and SOFTBERRY ( ...
Molecular Biotechnology
Volume 46, Number 2, 127-133, DOI: 10.1007/s12033-010-9277-2
Novel Expression System for Combined Vaccine Production in Edwardsiella tarda Ghost and Cadaver Cells Novel Expression System for Combined Vaccine Production in Edwardsiella tarda Ghost and Cadaver Cells
Seung Hyuk Choi 1, Yoon Kwon Nam 2 and Ki Hong Kim 1
(1) Department of Aquatic Life Medicine, Pukyong National University, Busan, 608-737, Korea
(2) Department of Aquaculture, Pukyong National University, Busan, 608-737, Korea
... of the trapped fragment. Based on the bioinformatic prediction of putative promoter
region (SOFTBERRY; http://linux1.softberry.com/berry. phtml), a clone (C#28) was
chosen for the trimming of the promoter region. From the C ...
Genetics
Vol. 184, 975-983, April 2010 doi:10.1534/genetics.109.112557
An Interspecific Plant Hybrid Shows Novel Changes in Parental Splice Forms of Genes for Splicing Factors
Moira Scascitelli, Marie Cognet 1 and Keith L. Adams 2
University of British Columbia Botanical Garden and Centre for Plant Research, and Department of Botany, University of British Columbia, Vancouver, British Columbia V6T 1Z4, Canada
... When gene models were not available, we analyzed putative gene exon/intron structures and
protein sequence predictions with gene finding programs from Softberry (http://linux1.softberry.
com/berry.phtml). View this table: In this window In a new window, TABLE 1. ...
Appl. Environ. Microbiol.
doi:10.1128/AEM.01742-10
Ralstonia solanacearum Dps contributes to oxidative stress tolerance, colonization, and virulence on tomato plants
Jennifer M. Colburn-Clifford, Jacob M. Scherf, and Caitilyn Allen
University of Wisconsin-Madison Department of Plant Pathology, 1630 Linden Dr., Madison WI 53706 USA
... Page 6. AEM01742-10 Version 2 -6- as previously described (1). DNA and protein
sequences were analyzed using Softberry 118 (http://linux1.softberry.com/berry.
phtml), Biology Workbench (http://workbench.sdsc.edu/), 119 ...
New Biotechnology
Volume 27, Issue 4, 30 September 2010, Pages 289-299 doi:10.1016/j.nbt.2010.01.337
Isolation and characterization of oil palm constitutive promoter derived from ubiquitin extension protein (uep1) gene
Subhi Siti Masura 1, Ghulam Kadir Ahmad Parveez 1, and Ismanizan Ismail 2
1 Advanced Biotechnology and Breeding Centre (ABBC), Biological Research Division, Malaysian Palm Oil Board (MPOB), P.O. Box 10620, 50720 Kuala Lumpur, Malaysia
2 School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor, Malaysia
... assembly. DNA and protein homology searches against GenBank databases were
performed using BLAST 2.0 [23]. Prediction of putative location of transcription start
sites was carried out using the Softberry database. Identification ...
Extremophiles
2010 Mar;14(2):171-83. Epub 2009 Dec 20.
Occurrence and distribution of capB in Antarctic microorganisms and study of its structure and regulation in the Antarctic biodegradative Pseudomonas sp. 30/3
Panicker G, Mojib N, Nakatsuji T, Aislabie J, Bej AK.
Department of Biology, University of Alabama at Birmingham, 1300 University Boulevard, CH103, Birmingham, AL, 34294-1170, USA.
... ncbi.nlm.nih.gov) using the Basic Local Alignment Search Tool (BLAST). The promoter,
RBS and ORF sequences were analyzed using Softberry (http://softberry.com/berry.
phtml) and Geneious (http://www.geneious.com) software. ...
Plant Physiology and Biochemistry
Volume 48, Issues 2-3, February-March 2010, Pages 153-159 doi:10.1016/j.plaphy.2009.12.008
Identification of iron-deficiency responsive microRNA genes and cis-elements in Arabidopsis
Wei Wei Kong a and Zhi Min Yang
a Department of Biochemistry and Molecular Biology, College of Life Sciences, Nanjing Agricultural University, Nanjing 210095, China
... Using transcription start site (TSS) predicted software (SoftBerry, http://www.softberry.com), we
were able to obtain 139 (74.3%) 2 kb proximal promoter sequences upstream of pre-miRNAs.
These sequences contain at least one transcription start site or promoter. ...
Microbial Pathogenesis
Volume 48, Issue 5, May 2010, Pages 168-177 doi:10.1016/j.micpath.2010.02.006
The Burkholderia cenocepacia K56-2 pleiotropic regulator Pbr, is required for stress resistance and virulence
Ramos et al.,
a IBB – Institute for Biotechnology and Bioengineering, Centre for Biological and Chemical Engineering, Instituto Superior Tecnico, Torre Sul, Piso 6. Av. Rovisco Pais, 1049-001 Lisboa, Portugal
b Department of Microbiology, Institute of Plant Biology, University of Zurich, Zurich, Switzerland
... pbr and phzD–phzF (Fig. 1C). These results demonstrate that phzD and phzF are
forming an operon, which was predicted using the Softberry software suite
(http://linux1.softberry.com/berry.phtml). The two fragments could not ...
Planta
DOI: 10.1007/s00425-010-1326-3
Sweetpotato late embryogenesis abundant 14 (IbLEA14) gene influences lignification and increases osmotic- and salt stress-tolerance of transgenic calli
Park et al.,
... http://www.expasy.org/tools), PSORT (http://psort.ims. u-tokyo.ac.jp), and SoftBerry
(http://www.softberry.com) programs. Planta 123 Page 4. Gene expression analysis
Total RNA was isolated from sweetpotato using TRIzol reagent ..
International Journal of Medical Microbiology
Volume 300, Issue 5, June 2010, Pages 279-288
Characterisation of multidrug-resistant Salmonella Typhimurium 4,[5],12:i:- DT193 strains carrying a novel genomic island adjacent to the thrW tRNA locus
Sandra Trupschuch a, 1, Jenny A. Laverde Gomez a, 1, Ia Ediberidze b, Antje Flieger a and Wolfgang Rabsch a
a Division of Bacterial Infections and National Reference Centre for Salmonella and other Bacterial Enteric Pathogens, Robert Koch-Institute, Wernigerode Branch, Germany
b Eliava Institute of Bacteriophage, Microbiology and Virology, Tbilisi, Georgia
.. For bioinformatical analyses, we used the following online available software tools:
www.ncbi.nlm.nih.gov/ for NCBI's BLASTn and BLASTx analyses; linux1.softberry.com
/berry.phtml for promotor search; www.effectors.org for the prediction of potential T3SS-secreted ...
European journal of plant pathology
2010, vol. 127, no3, pp. 351-363
Alternative splicing and genetic diversity of the white collar-1 (wc-1) gene in cereal Phaeosphaeria pathogens
Ericka et al.,
(1) Seed Improvement and Propagation Station, Taichung 426, TAIWAN, PROVINCE DE CHINE
(2) Department of Plant Pathology, National Chung Hsing University, Taichung City 402, TAIWAN, PROVINCE DE CHINE
... When the wc-1 genomic sequence was analyzed by Softberry (http://linux1.softberry. ...
Therefore, the deduced WC-1 polypep- tide (1,076 aa) analyzed by Softberry was three
amino acids fewer as compared to the analysis from the Broad Institute. ...
PLoS ONE
2010, 5(5): e10803. doi:10.1371/journal.pone.0010803
The Monofunctional Catalase KatE of Xanthomonas axonopodis pv. citri Is Required for Full Virulence in Citrus Plants
Tondo ML, Petrocelli S, Ottado J, Orellano EG
Molecular Biology Division, Facultad de Ciencias Bioquimicas y Farmaceuticas, Instituto de Biologia Molecular y Celular de Rosario, Consejo Nacional de Investigaciones Cientificas y Tecnicas, Universidad Nacional de Rosario, Rosario, Argentina
... bp upstream of the 5? end to 14 bp downstream of the 3? end of the ORF was amplified using
the primer pair ckatE-F and ckatE-R (Table 1). The amplified sequence included the putative
promoter sequence of the katE gene, previously predicted with SoftBerry (www.softberry ...
The Journal of Agricultural Science
2010, 148: 579-591, DOI: 10.1017/S0021859610000420
Gene expression and nitrogen loss in senescing root systems of red clover (Trifolium pratense)
WEBB et al.,
a1 Institute of Biological, Environmental and Rural Sciences, Gogerddan, Aberystwyth, Ceredigion SY23 3EB, UK
a2 Department of Environmental and Geographical Sciences, Manchester Metropolitan University, Manchester M1 5GD, UK
... DNA sequences were aligned using ClustalW. Gene structure was analysed using multiple
alignment construction and analysis workbench (MACAW) and Softberry (Mount KIsco, New York,
USA; http://linux1.softberry.com/berry.phtml). ... Analysis by Softberry shows two exons. ...
Acta Derm Venereol.
2010;90(1):95-6
A new SPINK5 donor splice site mutation in siblings with Netherton syndrome
Tuysuz et al.,
... Page 2. 96 Letters to the Editor using two different software programs available at http://www.
fruitfly.org/ and http://linux1.softberry.com). Both predictors showed that the splice site score of
the mutant sequence was much lower (0.59) than the wild-type counterpart (0.96). ...
African Journal of Biotechnology
Vol. 9(41), pp. 6826-6834, 11 October, 2010
Cloning and functional analysis in transgenic tobacco of a tapetum-specific promoter from Arabidopsis
Xuan-Li Nie, Jian-Wei Zhu, An-Qi Geng and Xing-Guo Xiao
State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing, 100193, China.
... In order to identify this kind of cis-elements, we analyzed in detail the DNA sequence of the -155
region (Figure 5) with Plant CARE (http://bioinformatics.psb,ugent.be/webtools/plantcare/ht ml)
and SOFTBERRY (http://linuxl.softberry.com/berry. phtml), in addition to PLACE. ...
International Journal of Hydrogen Energy
Volume 35, Issue 3, February 2010, Pages 1065-1073 doi:10.1016/j.ijhydene.2009.11.102
Molecular characterization and homologous overexpression of [FeFe]-hydrogenase in Clostridium tyrobutyricum JM1
Ji Hye Jo a, Che Ok Jeon b, Seung Yoon Lee c, Dae Sung Lee d, and Jong Moon Park e
a Biosciences Center, National Renewable Energy Laboratory, 1617 Cole Blvd, Golden, CO 80401-3393, USA
b Department of Life Science, Chung-Ang University, Seoul 156-756, South Korea
... nucleotide identity. Transcription promoters and termination sequences of the hydA
gene were analyzed using web-based programs (http://www.softberry.com/;
http://www.fruitfly.org/seq.tools/promoters. html). The theoretical ...
Journal of plant biology
2010, vol. 53, no2, pp. 134-141
Cloning and Characterization of Functional Trehalose-6-Phosphate Synthase Gene in Maize
Jiang Wei (1) ; Fu Feng-Ling (1) ; Zhang Su-Zhi (1) ; Wu Ling (1) ; Li Wan-Chen (1)
(1) Maize Research Institute, Sichuan Agricultural University, Sichuan, Ya’an, China
... The completely matched sequence together with its sequences within 5,000 bp upstream and
downstream, a total of 15,000 bp, was used to analyze the gene structure using GeneFinder
software (http://linux1.softberry.com). Open Reading Frame Cloning ...
Antimicrob. Agents Chemother.
doi:10.1128/AAC.01672-09
A novel insertion sequence, ISAba10, inserted into ISAba1 adjacent to the blaOXA-23 gene and disrupting the outer membrane protein carO gene in Acinetobacter baumannii
Lee et al.,
Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752, Korea; Korean Institute of Tuberculosis, 14 Woomyun-dong, Seocho-gu, Seoul 137-900, Korea
... higher level carbapenem resistance by conferring additional promoter sequences to the 85
blaOXA-23 gene. Analyses using an online tool (http://linux1.softberry.com) suggested the 86
presence of a putative promoter within the ISAba10 element (Fig. 1). 87 ...
Appl. Environ. Microbiol.
doi:10.1128/AEM.02417-09
Random mutagenesis of Clostridium cellulolyticum using a Tn1545 derivative
Jean-Charles Blouzard, Odile Valette, Chantal Tardif, and Pascale de Philip
Laboratoire de Chimie Bacterienne, IFR88-CNRS, Marseille, France; Universite d'Aix-Marseille, Marseille, France
...Promoter predictions (http://linux1.softberry.com/) at the 14 junctions of
pMIS1545 and the insertion sites revealed that putative -10/-35 promoters sites were 15 ...
Clinical Genetics
Volume 77, Issue 5, pages 453–463, May 2010 DOI: 10.1111/j.1399-0004.2009.01337.x
Novel exon nucleotide substitution at the splice junction causes a neonatal Marfan syndrome
Chao et al.,
1 Department of Obstetrics and Gynecology, National Cheng Kung University Hospital, Douliou Branch, Yunlin, Taiwan
2 Institute of Basic Medical Sciences, National Cheng Kung University Medical College, Tainan, Taiwan
... The tools included Splice Site Prediction by Neural Network (NNSplice; http://www.fruitfly.org/
seq tools/splice.html) (9), a weight matrix-based prediction tool (Splm; http://linux1.softberry.com/
berry.phtml), NetGene2 (http://www.cbs.dtu.dk/services/ NetGene2/) (10), and ...
Mol Biotechnol.
2010 May;45(1):24-33
Characterization of a cryptic plasmid pD403 from Lactobacillus plantarum and construction of shuttle vectors based on its replicon
Sun Z, Kong J, Kong W
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China.
... ncbi. nlm.nih.gov/Blast.cgi). Prediction of open reading frames, prokaryotic promoters,
and terminators was performed at http://opal.biology.gatech.edu/GeneMark/
gmhmm2_prok.cgi and http://www.softberry.com/berry.phtml. To ...
Electronic Journal of Biotechnology
DOI: 10.2225/vol13-issue5-fulltext-12
Isolation and characterization of the tissue and
development-specific potato snakin-1 promoter inducible
by temperature and wounding
Natalia I. Almasia 1 · Vanesa Narhirnak 1 · H. Esteban Hopp 1 · Cecilia Vazquez-Rovere 1
1 Instituto de Biotecnologia, Centro Nacional de Investigaciones Agropecuarias, Instituto Nacional de
Tecnologia Agropecuaria, Castelar, Los Reseros y Dr. N. Repetto, Hurlingham, Provincia de Buenos Aires, Argentina
... The amplified fragment was cloned in pCRII-TOPO® (TACloning®, Invitrogen (EUA),
sequenced and analyzed with the BioEdit Sequence Alignment Editor software,
Softberry, PlantCARE (Rombauts et al. 1999; Lescot et al. ...
The Plant Journal
61: 324–338. doi: 10.1111/j.1365-313X.2009.04057.x
Sucrose non-fermenting kinase 1 (SnRK1) coordinates metabolic and hormonal signals during pea cotyledon growth and differentiation
Radchuk et al.,
1 Institut fur Pflanzengenetik und Kulturpflanzenforschung (IPK), Corrensstrasse 3, D-06466 Gatersleben, Germany
2 Biology Department, Trent University, Peterborough, ON K9J 7B8, Canada
... Data bank searches (http://www.softberry.com) revealed a TTAGGGTTT motif described as an
inverted telo-box, associated with gene translation and the cell cycle (proliferating cell nuclear
antigen), a AATATTTTTATT motif found in pea ribulose-1,5-bisphosphate carboxylase ...
Plant Cell Rep.
2010 Mar;29(3):239-48
Isolation and functional characterization of two novel seed-specific promoters from sunflower (Helianthus annuus L.)
Zavallo D, Lopez Bilbao M, Hopp HE, Heinz R
Instituto de Biotecnologia, CNIA, Instituto Nacional de Tecnologia Agropecuaria-Castelar, Los Reseros y Nicolas Repeto, 1686 Hurlingham, Buenos Aires Province, Argentina
... Amplified fragments were cloned into pCR8/GW/TOPO (Invitrogen, USA), sequenced and analyzed
in silico with Vector NTI Advance 9 software (Invitrogen, USA). Pro- moter motif search was
conducted using Softberry server, PlantCARE database (Lescot et al. ...
PLoS
2010
Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri
Yinping Guo, Uma Shankar Sagaram, Jeong-soon Kim, and Nian Wang
Citrus Research and Education Center, Department of Microbiology and Cell Science, University of Florida, IFAS, 700 Experiment Station Road, Lake Alfred, Florida 33850
... The intergenic distance between the galU gene and the downstream gene kefB is 174 bp.
The galU gene and the downstream kefB gene were predicted to belong to different operons
based on operon prediction using SOFTBERRY (Softberry, Inc.). ...
PLoS Biol
2010 8(8): e1000467. doi:10.1371/journal.pbio.1000467
Distinct Olfactory Signaling Mechanisms in the Malaria Vector Mosquito Anopheles
gambiae
Liu et al.,
1 Departments of Biological Sciences and Pharmacology, Center for Molecular Neuroscience, Institutes of Chemical Biology and Global Health and Program in
Developmental Biology, Vanderbilt University, Nashville, Tennessee, United States of America, 2 USDA, Agricultural Research Service, Henry A. Wallace Beltsville
Agricultural Research Center, Plant Sciences Institute, Invasive Insect Biocontrol and Behavior Laboratory, Beltsville, Maryland, United States of America
...Potential exon-intron gene
models were predicted based on homology to DmIRs or AgIRs, as
well as with the aid of a Hidden Markov Model-based gene structure predictor (www.Softberry.com)...
Journal of Bacteriology
October 2010, p. 5081-5092, Vol. 192, No. 19 doi:10.1128/JB.00653-10
The Delta Subunit of RNA Polymerase, RpoE, Is a Global Modulator of Streptococcus mutans Environmental Adaptation
Xiaoli Xue, Jurgen Tomasch, Helena Sztajer, and Irene Wagner-Dobler
esearch Group Microbial Communication, Division of Cell Biology, Helmholtz Centre for Infection Research, Inhoffenstr. 7, D-38124 Braunschweig, Germany
... S6 and S7 in the supplemental material) predicted by the SoftBerry web service (SoftBerry Inc.,
Mount Kisco, NY), while the third one had too short a sequence length (114 bp in total, but with
only 45 bp before the putative terminator) to find a putative promoter. ...
Journal of Bacteriology
May 2010, p. 2535-2545, Vol. 192, No. 10 doi:10.1128/JB.01689-09
A Genetic Determinant in Streptococcus gordonii Challis Encodes a Peptide with Activity Similar to That of Enterococcal Sex Pheromone cAM373, Which Facilitates Intergeneric DNA Transfer
Vickerman et al.,
Department of Periodontics and Endodontics and Department of Oral Biology, School of Dental Medicine, University at Buffalo, 223 Foster Hall, Buffalo, New York 14214,1 Cariology, Restorative Sciences and Endodontics, School of Dentistry,2
... oxidase signature (PS00079). The lspA gene is located between two overlapping
open reading frames with a single upstream promoter identified by both MacVector
and Softberry promoter prediction software. In silico analysis ...
Journal of Bacteriology
March 2010, p. 1184-1192, Vol. 192, No. 5 doi:10.1128/JB.01372-09
In Helicobacter pylori, LuxS Is a Key Enzyme in Cysteine Provision through a Reverse Transsulfuration Pathway
Doherty et al.,
Centre for Biomolecular Science, University of Nottingham, University Park, Nottingham NG7 2RD,1 Nottingham Digestive Diseases Centre NIHR Biomedical Research Unit, School of Clinical Sciences, University of Nottingham and Nottingham University Hospitals NHS Trust, Queen's Medical Centre, Nottingham NG7 2UH,2
... A putative 70 promoter lying upstream of cysK Hp was identified using promoter
prediction algorithms found at http://www.softberry.ru/berry.phtml and
http://www.fruitfly.org/seq_tools/promoter.html and is shown as an arrow. ...
Fungal Genetics and Biology
Volume 47, Issue 10, October 2010, Pages 818-827 doi:10.1016/j.fgb.2010.06.009
Specialized and shared functions of the histidine kinase- and HOG1 MAP kinase-mediated signaling pathways in Alternaria alternata, a filamentous fungal pathogen of citrus
Ching-Hsuan Lin a, b and Kuang-Ren Chung a, b
a Citrus Research and Education Center, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
b Department of Plant Pathology, IFAS, University of Florida, Gainesville, FL 32611, USA
... nlm.nih.gov/). Open 9 reading frame (ORF) and exon/intron positions were deduced
from comparisons of 10 genomic and cDNA sequences or predicted using the
gene-finding software at 11 http://www.softberry.com. A search ...
Research in Microbiology
Volume 161, Issue 2, March 2010, Pages 144-152 doi:10.1016/j.resmic.2009.12.002
The 285 kDa Bap/RTX hybrid cell surface protein (SO4317) of Shewanella oneidensis MR-1 is a key mediator of biofilm formation
Bjorn Vergauwen
a Laboratory for Protein Biochemistry and Biomolecular Engineering (L-ProBE), Ghent University, 9000 Ghent, Belgium
b Laboratory of Pharmaceutical Microbiology, Ghent University, 9000 Ghent, Belgium
.. A predicted promoter region (http://www.softberry.com) precedes the start site of ORF SO4317,
ORFs SO4318–SO4323 are separated from each other by no more than 27 base pairs, and an
intergenic region of 818 base pairs, containing a predicted transcription termination site ...
PLoS ONE
5(6): e11067. doi:10.1371/journal.pone.0011067
Genomic Features of the Human Dopamine Transporter Gene and Its Potential Epigenetic States: Implications for Phenotypic Diversity
Shumay E, Fowler JS, Volkow ND
1 Brookhaven National Laboratory, Medical Department, Upton, New York, United States of America, 2 National Institute on Drug Abuse, National Institutes of Health, Bethesda, Maryland, United States of America
... the typical sequence characteristics of a strong promoter. Here, de novo predicted
TSSs are only marginal (Promoter 2.0 Prediction server) or off-target (Softberry).
The software Eponine (Sanger) predicts multiple low-score ...
Chinese Science Bulletin
Volume 54, Number 18 / September, 2009 pp. 3249-3257
Characterization of a PDR type ABC transporter gene from wheat (Triticum aestivum L.)
Yi Shang et al.,
(1) State Key Laboratory of Crop Genetics and Germplasm Enhancement, Cytogenetics Institute, Nanjing Agricultural University, Nanjing, 210095, China
(2) Institute of Crop Research and Nuclear Technique Utilization, Zhejiang Academy of Agricultural Science, Hangzhou, 310021, China
... A positive TAC clone was identified using the primer pair SH49S and SH49A. The TAC
clone was sequenced us- ing a chromosome walking method and the gene was
predicted using Softberry software (http://www. soft- berry.com). ...
Mem. Inst. Oswaldo Cruz
vol.104 no.3 Rio de Janeiro May 2009 doi: 10.1590/S0074-02762009000300018
Phylogeny and evolution of the aspartyl protease family from clinically relevant Candida species
B Parra-Ortega; H Cruz-Torres; L Villa-Tanaca; C Herna'ndez-Rodri'guez
Departamento de Microbiologi'a, Escuela Nacional de Ciencias Biolo'gicas, Instituto Polite'cnico Nacional, Plan de Ayala y Prol. Carpio, Colonia Casco de Santo Toma's, CP 11340 Agencia de Correos 220, Me'xico, DF, Me'xico
... Prediction of motif sequences was performed with PROSITE (http://www.expasy.org) (Falquet
et al. 2002). PSORTII (http://www.psort.org/) and Softberry (http://www.softberry.com) were used
to predict subcellular localization; Softberry was also used to find exons. ...
Insect Biochemistry and Molecular Biology
Volume 39, Issue 8, August 2009, Pages 547-567
Comparative and functional genomics of lipases in holometabolous insects
Irene Horne, Victoria S. Haritos, John G. Oakeshott
CSIRO Entomology, GPO Box 1700, Canberra, ACT 2601, Australia
encoded by href="genbank:XM_312606">XM_312606) to identify acid lipases; gene structures
were then predicted using Genscan (Burge and Karlin, 1997) or Softberry (http://www ...
Journal of Biomedicine and Biotechnology
Volume 2009 (2009), Article ID 398434, 10 pages
doi:10.1155/2009/398434
Adding to Yersinia enterocolitica Gene Pool Diversity: Two Cryptic Plasmids from a Biotype 1A Isolate
Lepka et al.,
Robert Koch Institute, Wernigerode Branch, Burgstrasse 37, 38855 Wernigerode, Germany
... resp.). 2.5. Sequence Analyses. Potential coding regions were determined by softberry
(http://www.softberry.com/) tools and confirmed applying Glimmer (http://www.ncbi.nlm.
nih.gov/genomes/MICROBES/glimmer_3.cgi). Comparison ...
Peptides
Volume 30, Issue 7, July 2009, Pages 1241-1248
FGLamide Allatostatin genes in Arthropoda: Introns early or late?
Francisco Marti'nez-Pe'rez a, b, William G. Benden ac, Belind a S.W. Chang a and Stephen S. Tobe a
aDepartment of Cell and Systems Biology, University of Toronto, Toronto, ON, Canada
bDepartment of Genetics and Molecular Biology, CINVESTAV, Mexico, D.F., Mexico
... from D. punctata and D. melanogaster. With the sequences obtained, the exon-intron
organization was established with Softberry programs (http://linux1.softberry.com/
berry.phtml). The conceptual translation and the sequence ...
Plant Molecular Biology
Volume 71, Numbers 1-2 / September, 2009, pp. 193-205
Cloning and characterization of two novel chloroplastic glycerol-3-phosphate dehydrogenases from Dunaliella viridis
Yunxia He et al.,
(1) Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, 99 Shangda Road, 200444 Shanghai, People’s Republic of China
(2) Institute of Plant Physiology & Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 200032 Shanghai, People’s Republic of China
... al. 1997). Gene and protein predictions were carried out with the SoftBerry service
(http://www.softberry.com/berry.phtml). Possible chloroplast transit peptides were
predicted using ChloroP (http://www.cbs.dtu.dk/services/). Subcellular ...
Biochem. J.
(2009) 418, 443–451 (Printed in Great Britain) doi:10.1042/BJ20081478
Intracellular catalase/peroxidase from the phytopathogenic rice blast
fungus Magnaporthe grisea: expression analysis and biochemical
characterization of the recombinant protein
ZAMOCKY et al.,
*Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry, University of Natural Resources and Applied Life Sciences, Muthgasse 18 A-1190 Vienna, Austria,
†Department of Chemistry, University of Modena and Reggio Emilia, Modena, Italy
... Promoter and subcellular targeting prediction Prediction of intron and native promoter location
within the geno- mic DNA of M. grisea strain 70-15 was performed in the SoftBerry suite
(http://www.softberry.com) using the ascomycete- specific parameters. ...
Applied and Environmental Microbiology
May 2009, p. 2869-2878, Vol. 75, No. 9 doi:10.1128/AEM.02326-08
Biosynthesis of Sibiromycin, a Potent Antitumor Antibiotic
Wei Li, Ankush Khullar, ShenChieh Chou, Ashley Sacramo, and Barbara Gerratana
Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 20742
... ORF and sequence homology analyses were performed by using SoftBerry (Softberry, Inc.) and
GeneMark (exon.gatech.edu/GeneMark/) and by using BLAST programs (blast.ncbi.nlm.nih.gov/
blast.cgi), respectively. Production, isolation, and analysis of sibiromycin. ...
Molecular Genetics and Genomics
Volume 281, Number 1 / January, 2009 pp. 109-123
TRANSPARENTTESTA12 genes from Brassica napus and parental species: cloning, evolution, and differential involvement in yellow seed trait
You-Rong Chai et al.,
(1) Chongqing Rapeseed Engineering Research Center, Southwest University, Tiansheng Road 216#, Beibei, 400716 Chongqing, People’s Republic of China
(2) Chongqing Key Laboratory of Crop Quality Improvement, Southwest University, Tiansheng Road 216#, Beibei, 400716 Chongqing, People’s Republic of China
... Page 4. 112 Mol Genet Genomics (2009) 281:109-123 123 and websites such as NCBI
(http://www.ncbi.nlm.nih.gov), Expasy (http://www.expasy.org), and SoftBerry (http://www.
softberry.com). Southern hybridization for TT12 genes in B. napus and its two parental species ...
Plant Physiology Preview
Published on September 18, 2009; 10.1104/pp.109.145177
Metabolite sorting of a germplasm collection reveals the Hydroxylase3 locus as a new target for maize provitamin A biofortification
Ratnakar Vallabhaneni et al.,
Department of Biological Sciences, Lehman College, The City University of New York, 250 Bedford Park Blvd. West, Bronx, NY 10468; The Graduate School and University Center-CUNY, 365 Fifth Ave., New York, NY 10016-4309
... Gene models were drawn using Genscan (www.genscan.com), Softberry (www.softberry.
com) and Vector NTI Suite9.0 (Invitrogen, Carlsbad, CA). Transcription start sites were
estimated by EST and promoter analysis (www.softberry.com). ...
BMC Genomics
2009, 10:224doi:10.1186/1471-2164-10-224
Complete sequence determination of a novel reptile iridovirus isolated fromsoft-shelled turtle and evolutionary analysis of Iridoviridae
Youhua Huang et al.,
aState Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, 135 West Xingang Road, Guangzhou 510275, PR China
... programs at the NCBI website (http://www.ncbi.nlm.nih.gov). The whole genome sequence was
also submitted to http://www.softberry.com (Softberry Inc., Mount Kisco, NY, USA) for identification
of all putative ORFs. For more refined analyses, conserved motifs and domains and ...
Euphytica
Volume 167, Number 3 / June 2009, pp. 281-291
Promoter anchored amplified polymorphism based on random amplified polymorphic DNA (PAAP-RAPD) in cotton
Mingxiong Pang 1, R. G. Percy 2, Ed. Hughs 3 and Jinfa Zhang 1
(1) Department of Plant and Environmental Sciences, New Mexico State University, Las Cruces, NM 88003, USA
... information about the cloned PAAP-RAPD fragments, 220 plant promoter sequences were
downloaded from http://www.soft- berry.com and ... the cloned potential promoters we downloaded
the characterized dicot plant promoters from database at http://www.softberry.com/with a ...
Veterinary Immunology and Immunopathology
Volume 128, Issue 4, 15 April 2009, Pages 437-440
Complete sequencing of full-length canine ataxia telangiectasia mutated mRNA and characterization of its putative promoter
Fabio Gentilini, Maria Elena Turba, Monica Forni and Stefano Cinotti
aVeterinary Clinical Department, Alma Mater Studiorum-University of Bologna, Via Tolara di Sopra 50, 40064 - Ozzano Emilia, Bologna, Italy
... proscan/) (Prestridge, 1995) and "MOTIF" software (http://motif.genome.jp). The
putative PolyA signal sites were predicted using PolyA (http://www.softberry.com/).
Finally, the predictors PhD-SNP (http://gpcr.biocomp.unibo.it ...
International Journal of Hydrogen Energy
Volume 35, Issue 3, February 2010, Pages 1065-1073
Molecular characterization and homologous overexpression of [FeFe]-hydrogenase in Clostridium tyrobutyricum JM1
Ji Hye Jo, Che Ok Jeon, Seung Yoon Lee, Dae Sung Lee and Jong Moon Park
a Biosciences Center, National Renewable Energy Laboratory, 1617 Cole Blvd, Golden, CO 80401-3393, USA
... nucleotide identity. Transcription promoters and termination sequences of the hydA
gene were analyzed using web-based programs (http://www.softberry.com/;
http://www.fruitfly.org/seq.tools/promoters. html). The theoretical ...
Glycoconjugate Journal
Volume 26, Number 3 / April, 2009, pp. 313-324
Sialylation in protostomes: a perspective from Drosophila genetics and biochemistry
Kate Koles1, Elena Repnikova1, Galina Pavlova2, Leonid I. Korochkin2 and Vladislav M. Panin1
1) Department of Biochemistry and Biophysics, Texas A&M University, College Station, TX 77843-2128, USA
... insect species: African malaria mosquito (Anopheles gambiae, XP_308850), yellow fever mosquito
(Aedes aegypti, XM_001649540), red flour beetle (Tribolium castaneum, XP_968750), and pea
aphid (Acyrthosiphon pisum, reconstructed using SoftBerry prediction (www.softberry.com) ...
Applied and Environmental Microbiology
November 2009, p. 6712-6720, Vol. 75, No. 21
Edwardsiella ictaluri Encodes an Acid-Activated Urease That Is Required for Intracellular Replication in Channel Catfish (Ictalurus punctatus) Macrophages
Natha J. Booth,1, Judith B. Beekman,1,2 and Ronald L. Thune 1,2*
Department of Veterinary Science, Louisiana State University Agricultural Center, Louisiana State University, Baton Rouge, Louisiana 70803,1 Department of Pathobiological Sciences, School of Veterinary Medicine, Skip Bertman Drive and River Road, Louisiana State University, Baton Rouge, Louisiana 708032
... The genetic structure of the urease operon was examined using the stem-loop and terminator
programs of the Wisconsin package (Genetics Computer Group, Madison, WI) and the bacterial
operon and gene-finding software program from SoftBerry, Inc. ...
Microb Cell Fact.
2009; 8: 48.
Surface display of heterologous proteins in Bacillus thuringiensis using a peptidoglycan hydrolase anchor
Xiaohu Shao,1 Mengtian Jiang,1 Ziniu Yu,1 Hao Cai,2 and Lin Li
1State Key Laboratory of Agricultural Microbiology, Huazhong Agricultural University, Wuhan 430070, China
2College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
... kurstaki wild-type strain YBT-1520 comprises over 5600 ORFs (data not published). A
whole-genome analysis of the corresponding proteins in this strain was performed with the
online tool "softberry" [21], using the genome data of B. thuringiensis subsp. ...
The Plant Cell
21:131-145 (2009)
A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-Domain Protein JAZ10 in Arabidopsis
Hoo Sun Chung a,b and Gregg A. Howe a,b
a Department of Energy–Plant Research Laboratory, Michigan State University, East Lansing, Michigan 48824
b Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824
... Gene prediction programs (www.softberry.com) suggest that JAZ10 orthologs in rice (Oryza sativa)
(gi:115458122) and poplar (Populus trichocarpa) (Joint Genome Institute gene model 548076)
are subject to alternative splicing events that alter the Jas domain. ...
MPMI
August 2009, Volume 22, Number 8
Pages 942-952
DOI: 10.1094/MPMI-22-8-0942
The YAP1 Homolog–Mediated Oxidative Stress Tolerance Is Crucial for Pathogenicity of the Necrotrophic Fungus Alternaria alternata in Citrus
Ching-Hsuan Lin, Siwy Ling Yang, and Kuang-Ren Chung
Citrus Research and Education Center, and Department of Plant Pathology, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Rd., Lake Alfred 33850, U.S.A.
... The pro- moter region was analyzed using regulatory sequence analysis tools. ORF
and exon or intron positions were predicted using Softberry gene-finding software
and verified by comparisons of genomic and cDNA sequences. ...
Journal of Plant Interactions
Volume 3, Issue 2 June 2008 , pages 75 - 93
Endophytes: exploiting biodiversity for the improvement of natural product-based drug discovery
Agata Staniek; Herman J. Woerdenbag; Oliver Kayser
Pharmaceutical Biology Department, University of Groningen, The Netherlands
... gramme (available from: http://www.softberry.com/ berry.phtml) aided by RACE (rapid
amplification of cDNA ends) and confirmed by reverse transcription- PCR ...
PLoS Genet
(2008) 4(1): e3. doi:10.1371/journal.pgen.0040003
Repetitive Element-Mediated Recombination as a Mechanism for New Gene Origination in Drosophila
Yang et al.,
Chinese Academy of Sciences (CAS)—Max Planck Junior Research Group, Key Laboratory of Cellular and Molecular Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan, China
... copy-specific primers, and for those that resulted in no RACE product (possibly
due to low expression levels or long ends), we used the Softberry software [65 ...
Genetics.
2008 August; 179(4): 2239–2252. doi: 10.1534/genetics.108.089862
Quantitative Trait Loci (QTL) Analysis For Rice Grain Width and Fine Mapping of an Identified QTL Allele gw-5 in a Recombination Hotspot Region on Chromosome 5
Wan et al.,
National Key Laboratory for Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, China and †Institute of Crop Science and the National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China
... candidate genes in the 49.7-kb region (http://www.ncbi.nlm.nih.gov/BLAST;
http://www.softberry.com). Of these genes, one had unknown ...
Nucleic Acids Research
Volume 36(7)April 2008pp 2196-2207
Epigenetics of a tandem DNA repeat: chromatin DNaseI sensitivity and opposite methylation changes in cancers
Koji et al.,
Human Genetics Program and Department of Biochemistry and Tulane Cancer Center, Tulane Medical School, Tulane University, New Orleans, LA 70112, USA
... that p13E-11, which is only 0.1 kb from D4Z4 (Figure 1) and has no features of a
gene (http://exon.gatech.edu/GeneMark/ , http://www.softberry.com/berry.phtml ...
Cell Research
18, 1199 - 1209 (01 Dec 2008), doi: 10.1038/cr.2008.307
Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight
Weng et al.,
... (D) Compared with IR24, 1.2-kb genomic DNA is deleted in Asominori. (E) Three ORFs
are predicted in the candidate region harboring GW5 (http://softberry.com). ...
PROTEOMICS
2008, Volume 8 Issue 20, Pages 4273 - 4286
Physiology of Streptococcus thermophilus during the late stage of milk fermentation with special regard to sulfur amino-acid metabolism
Herve-Jimenez et al.,
INRA,UR477 Biochimie Bacterienne, Jouy-en-Josas, France
... a) L/E ratio: ratio between the relative mRNA levels at 5h30 and 2h30. b) Determined
with ProFinder software (http://www.softberry.com/all.htm). ...
BMC Microbiology
2008, 8:227 doi:10.1186/1471-2180-8-227
Genomic analysis of bacteriophage epsilon34 of Salmonella enterica serovar
Anatum (15+)
Robert Villafane, Milka Zayas, Eddie B. Gilcrease, Andrew M. Kropinski, and Sherwood R. Casjens
Ponce School of Medicine,
Departments of Biochemistry and Microbiology,
Ponce, Puerto Rico 00732
The Betawrap [57],
Softberry , tRNAscan-SE
[79],
[44] web sites
were used for beta-helix structure, phage promoter, tRNA gene and
transmembrane helix identification, respectively.
Published in Crop Sci
48:2314-2320 (2008)
Cloning and Characterization of a CAP Gene Expressed in Gossypium arboreum Fuzzless Mutant
Sheng Wang, Guo-Hong Zhao, Yin-Hua Jia and Xiong-Ming Du
Cotton Germplasm Division, Cotton Research Institute, Chinese Academy of Agricultural Sciences, Huanghe Dadao, Kaifaqu, Anyang, Henan 455000, China
... Blast.cgi). Softberry server was used to determine the exon/intron boundaries
(http://www.softberry.com/berry.phtml). The conceptual ...
J Microbiol Methods.
2008 May;73(2):133-41. Epub 2008 Feb 11
An integrative expression vector for strain improvement and environmental applications of the nitrogen fixing cyanobacterium, Anabaena sp. strain PCC7120
Chaurasia AK, Parasnis A, Apte SK
Molecular Biology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India.
... 164 base pair region upstream of psbA1) showed 50% homology with the ? 10 and ?
35 consensus sequences of E. coli promoters (www.softberry.com/promoscan). ...
The Journal of Immunology
2008, 181: 7106-7114.
Histoplasma capsulatum Cyclophilin A Mediates Attachment to Dendritic Cell VLA-5
Francisco J. Gomez, Robyn Pilcher-Roberts, Arash Alborzi and Simon L. Newman
Department of Internal Medicine, Division of Infectious Diseases, University of Cincinnati College of Medicine, and {dagger} Veterans Administration Medical Center, Cincinnati, OH 45267
... The sequence was analyzed with the SoftBerry GeneFinder on-line server
(http://www.softberry.com/berry.phtml) that correctly identified the Hc CypA coding ...
Biochemical Journal Immediate Publication.
Published on 10 Nov 2008 as manuscript BJ20081478
Intracellular catalase-peroxidase
from the phytopathogenic fungus Magnaporthe grisea:
expression analysis and biochemical characterisation
of the recombinant protein
Zamocky et al.,
Metalloprotein Research Group, Division of Biochemistry, Department of Chemistry,
University of Natural Resources and Applied Life Sciences, Muthgasse 18 A-1190 Vienna,
Austria
... Prediction of intron and native promoter location within the genomic DNA of Magnaporthe
grisea strain 70-15 was performed in SoftBerry suite (http://www ...
Bioscience, Biotechnology, and Biochemistry
Vol. 72 (2008) , No. 6 pp.1571-1579
Molecular Cloning, Characterization, and Differential Expression of a Farnesyl-Diphosphate Synthase Gene from the Basidiomycetous Fungus Ganoderma lucidum
Yi-Xin DING et al.,
College of Life Sciences, Nanjing Agricultural University, Key Laboratory of Microbiological Engineering of Agricultural Environment, Ministry of Agriculture
... The phylogenetic tree was gener- ated by MEGA. 18) The promoter sequences were analyzed
online at the http://www.softberry.com/ berry.phtml website. Results ...
Applied and Environmental Microbiology
July 2008, p. 4359-4365, Vol. 74, No. 14 doi:10.1128/AEM.02499-07
Novel Bacterial Surface Display Systems Based on Outer Membrane Anchoring Elements from the Marine Bacterium Vibrio anguillarum
Zhao Yang, Qin Liu,* Qiyao Wang, and Yuanxing Zhang*
State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai 200237, China
... of the above membrane-related proteins were analyzed with ExPASy Proteomics tools
(TMHMM Server v.2.0 [http://kr.expasy.org/tools/]) and SoftBerry (data not ...
MPMI
April 2008, Volume 21, Number 4, Pages 469-479 DOI: 10.1094/MPMI-21-4-0469
Genetic Dissection Defines the Roles of Elsinochrome Phytotoxin for Fungal Pathogenesis and Conidiation of the Citrus Pathogen Elsinoe fawcettii
Hui-Ling Liao and Kuang-Ren Chung
Citrus Research and Education Center, and Department of Plant Pathology, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Rd., Lake Alfred 33850, U.S.A.
... ORF and exon/intron positions were predicted using the Softberry gene-finding software
and confirmed by comparisons of genomic and cDNA sequences. ...
Microbiology
154 (2008), 3556-3566; DOI 10.1099/mic.0.2008/019414-0
Determination of a transcriptional regulator-like gene involved in biosynthesis of elsinochrome phytotoxin by the citrus scab fungus, Elsinoe fawcettii
Kuang-Ren Chung and Hui-Ling Liao
Citrus Research and Education Center, and Department of Plant Pathology, Institute of Food and Agricultural Sciences (IFAS), University of Florida, 700 Experiment Station Road, Lake Alfred, FL 33850, USA
... Prediction of ORFs and exon/intron junctions was first performed using the
gene-finding software at http://www.softberry.com and further confirmed by comparing ...
BMC Genomics
2008; 9: 149. Published online 2008 March 31. doi: 10.1186/1471-2164-9-149.
Losing helena: The extinction of a drosophila line-like element
Rita Rebollo, Emmanuelle Lerat, Liliana Lopez Kleine, Christian Biemont, and Cristina Vieira
1Universite de Lyon; Universite Lyon 1; CNRS; UMR 5558, Laboratoire de Biometrie et Biologie Evolutive, Villeurbanne F-69622, France
2UR477 de Biochimie Bacterienne, UR341 de Mathematiques et informatiques Applique'es, INRA. 78352 Jouy en Josas, France
... Splice sites and transcription binding sites were predicted by the Softberry tools
[40] and Genomatix [41]; PEPcoil ([42] allowed us to find the coiled coil ...
Blood Coagulation & Fibrinolysis.
19(3):240-242, April 2008
Four novel FXI gene mutations in three factor XI- deficient patients
de Raucourt, Emmanuelle a; de Mazancourt, Philippe b,c; Quelin, Florence b,c
... to the acceptor site for exon 7, but an exon prediction software did not show an
effect on the probability of splicing (website: http://www.softberry.com/cgi ...
Food and Chemical Toxicology
Volume 46, Issue 4, April 2008, Pages 1249-1256
SULT1C3, an orphan sequence of the human genome, encodes an enzyme activating various promutagens
Walter Meinl, Claudia Donath, Heiko Schneider, Yasmin Sommer and Hansruedi Glat
German Institute of Human Nutrition (DIfE) Potsdam-Rehbrucke, Department of Nutritional Toxicology, Arthur-Scheunert-Allee 114-116, 14558 Nuthetal, Germany
... then used the Baylor College of Medicine (BCM) Search Launcher http://searchlauncher.
bcm.tmc.edu/ (many modules are now hosted by http://www.softberry.com) to ...
Infection and Immunity
June 2008, p. 2411-2419, Vol. 76, No. 6
Identification of a Novel Prophage-Like Gene Cluster Actively Expressed in Both Virulent and Avirulent Strains of Leptospira interrogans Serovar Lai
Jin-Hong Qin et al.,
Department of Microbiology and Parasitology, Institutes of Medical Sciences, Shanghai Jiao Tong University, School of Medicine, Shanghai 200025, China,1 Laboratory of Molecular Microbiology, Institute of Plant Physiology and Ecology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China
... uk/). Transcription operons and the corresponding promoters were predicted
using Softberry software (Softberry, Mount Kisco, NY). ...
...The putative
promoter or regulatory regions of transcripts I, II, and
III, all proximal to gene LA0195 but with different transcription
directions, were identified by using the Softberry prokaryotic
promoter prediction tools....
Molecular Immunology
Volume 45, Issue 12, July 2008, Pages 3470-3476
IgD in the reptile leopard gecko
Francisco Gambon-Deza and Christian Sanchez Espinel
Unidad de Inmunologia, Hospital do Meixoeiro, Carretera de Madrid s/n, Vigo 36210, Pontevedra, Spain
... Sequence characteristics were analysed in the Softberry Web to deduce the exons
and introns, and to verify the presence of other interesting characteristics ...
Endocrinology
2008 Vol. 149, No. 9 4256-4266
Seladin-1 Is a Fundamental Mediator of the Neuroprotective Effects of Estrogen in Human Neuroblast Long-Term Cell Cultures
Paola Luciani et al.,
Endocrine Unit, Department of Clinical Physiopathology, Center for Research, Transfer and High Education on Chronic, Inflammatory, Degenerative and Neoplastic Disorders for the Development of Novel Therapies (P.L., C.D., F.R., S.B., I.C., F.D., M.M., G.D., M.S., A.P.), Department of Anatomy, Histology, and Forensic Medicine (G.B.V.), University of Florence, 50139 Florence, Italy
... A 6-kb region upstream seladin-1 open reading frame was analyzed using eukaryotic
promoter identification programs (http://www.softberry.com/berry.phtml? ...
Biochimie
Volume 90, Issue 6, June 2008, Pages 878-887
Fish specific duplication of Dmrt2: Characterization of zebrafish Dmrt2b
Xiang Zhou et al.,
Department of Genetics and Center for Developmental Biology, College of Life Sciences, Wuhan University, Wuhan 430072, P.R. China
... www.ensembl.org/Danio_rerio/), and the exons of Dmrt2b were predicted by CBS PREDICTION
SERVERS (http://www.cbs.dtu.dk/services/) and SOFTBERRY (http://www ...
PNAS
February 27, 2007 | vol. 104 | no. 9 | 3336-3341
A common variant in combination with a nonsense mutation in a member of the thioredoxin family causes primary ciliary dyskinesia
Benedicte Duriez et al.,
Institut National de la Sante et de la Recherche Medicale,
Unite 654, F-94000 Creteil, France; Faculte de Me'decine,
Universite Paris 12, IFR10, F-94000 Creteil, France
... in Man, www.ncbi.nlm.nih.gov/Omim (for PCD and Kartagener syndrome); Ensembl,
www.ensembl.org; NCBI, www.ncbi.nlm.nih.gov; and Softberry, www.softberry.com. ...
Journal of Bacteriology,
October 2007, p. 6928-6935, Vol. 189, No. 19
Negative Regulation of the EcoRI Restriction Enzyme Gene Is Associated with Intragenic Reverse Promoters
Yaoping Liu, and Ichizo Kobayashi
Department of Medical Genome Sciences, Graduate School of Frontier Science, University of Tokyo, Tokyo, Japan,1 Institute of Medical Science, University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108-8639, Japan
... rebase.html). In silico promoter prediction was carried out with the tools
available at http://www.softberry.com/all.htm. The RNA ...
Applied and Environmental Microbiology,
November 2007, p. 7367-7372, Vol. 73, No. 22
Regulation of a Novel Acidithiobacillus caldus Gene Cluster Involved in Metabolism of Reduced Inorganic Sulfur Compounds
Olena I. Rzhepishevska et al.,
Molecular Biology, Umea* University, SE-901 87 Umea*, Sweden,
... Promoter prediction was performed using programs available at www.fruitfly.org/
seq_tools/promoter.html and www.softberry.com and a combined Hidden Markov Model ...
Journal of Plant Physiology
Volume 164, Issue 3, 7 March 2007, Pages 350-363
Cloning and molecular characterization of a functional flavonoid 3'-hydroxylase gene from Brassica napus
Ben-Bo Xu et al.,
Chongqing Rapeseed Technology Research Center, Chongqing Key Laboratory of Crop Quality Improvement, Beibei, Chongqing 400716, People's Republic of China
... gov/). Protein structure predictions were carried out on websites
(http://www.expasy.org and http://www.softberry.com/berry.phtml). ...
Biochemical and Biophysical Research Communications
Volume 358, Issue 2, 29 June 2007, Pages 590-595
Activation-induced changes in alternate splice acceptor site usage
T. Prescott Atkinson and Yuling Dai
Department of Pediatrics, University of Alabama at Birmingham, Birmingham, AL, USA
... A list of over 12,000 publicly available EST-verified human splice acceptor sites
(www.softberry.com) was examined for the occurrence of the AGCAG motif, and ...
Journal of Bacteriology,
March 2007, p. 1774-1782, Vol. 189, No. 5
The fox Operon from Rhodobacter Strain SW2 Promotes Phototrophic Fe(II) Oxidation in Rhodobacter capsulatus SB1003
Laura R. Croal, Yongqin Jiao, and Dianne K. Newman
Division of Biology, Division of Geological and Planetary Sciences, Howard Hughes Medical Institute, California Institute of Technology, Pasadena, California 91125
... Predicted operons, promoters, and terminators were identified with the
tools at Softberry (http://www.softberry.com/berry.phtml). ...
Crop Sci
47:2437-2444 (2007)
Identification, Characterization and Expression of Drought Related alpha-Crystalline Heat Shock Protein Gene (GHSP26) from Desi Cotton
Asma Maqbool et al.,
Center of Excellence in Molecular Biology, University of the Punjab, 87-Canal Bank Road, Thokar Niaz Baig Lahore (53700) Pakistan
... 2007). To find out the exon/intron boundaries, untranslated regions (UTRs), and
poly-A tail, softberry server was used (http://www.softberry.com/berry.phtml). ...
Plant Molecular Biology
Volume 65, Number 4 / November 2007 p. 453-466
T-DNA tagged knockout mutation of rice OsGSK1 , an orthologue of Arabidopsis BIN2 ,
with enhanced tolerance to various abiotic stresses
Serry Koh et al.,
Department of Life Science, Sogang University, Seoul, 121-742, Korea
... 2002), and were annotated with the Softberry program (http://www. softberry.com/
berry.phtml), and BLASTP (http://www. ncbi.nlm.nih.gov/BLAST). ...
Molecular Immunology
doi:10.1016/j.molimm.2007.09.015
Global identification and comparative analysis of SOCS genes in fish: Insights into the molecular evolution of SOCS family
Hong-Jian Jin, Jian-Zhong Shao, Li-Xin Xiang, Hao Wanga and Li-Li Sun
College of Life Sciences, Zhejiang University, Hangzhou 310058, China
... search coding exons or open reading frames (ORF) by the GENSCAN program
(http://genes.mit.edu/GENSCAN.html) or GENE FINDING programs at the Softberry web ...
Archives of Virology
Volume 152, Number 8 / August 2007 p. 1457-1465
Characterization of complete genome sequence of the spring viremia of carp
virus isolated from common carp (Cyprinus carpio) in China
Y. Teng et al.,
State Key Laboratory of Biocontrol, College of Life Sciences, Sun Yat-sen University, Guangzhou, P.R. China
... the genomic map. Putative ORFs were predicted by submitting to http:==
www.softberry.com (Softberry Inc., Mount Kisco, NY). In all ...
Molecular and Biochemical Parasitology
Volume 154, Issue 1, July 2007, Pages 52-61
Are Caenorhabditis elegans receptors useful targets for drug discovery:
Pharmacological comparison of tyramine receptors with high identity
from C. elegans (TYRA-2) and Brugia malayi (Bm4)
Katherine A. Smith, Elizabeth B. Rex and Richard W. Komunieck
Department of Biological Sciences, University of Toledo, 2801 West Bancroft Street, Toledo, OH 43606-3390, USA
... were performed with TYRA-2. Contigs with high matches to C. elegans proteins
were run through a modified gene prediction program, Softberry (http://sun1 ...
Biochemical and Biophysical Research Communications
Volume 358, Issue 4, 13 July 2007, Pages 1148-1153
Characterization of two temperature-inducible promoters newly isolated from B. subtilis
Wang Li et al.,
College of Animal Sciences, Northwest A&F University, Yangling 712100,
People’s Republic of China
... The sequence analysis was performed online with NCBI blast 2.0 (www.ebi.ac.uk);
promoter region was predicted by softberry software (www.softberry.com). ...
Biochemical and Biophysical Research Communications
Volume 354, Issue 1, 2 March 2007, Pages 90-95
Assay and characterization of a strong promoter element from B. subtilis
Ai-Ling Zhang et al.,
College of Animal Sciences, Northwest A&F University, Yangling 712100,
People’s Republic of China
... The sequence analysis was performed online with NCBI blast (http://www.ncbi.nih.
gov), and promoters were predicted online by using of softberry (http://www ...
Crop Sci
47:14-26 (2007)
The FAD2 Gene Family of Soybean:
Insights into the Structural and Functional Divergence of a Paleopolyploid Genome
Jessica A. Schlueter et al.,
USDA-ARS-CICGR, Ames, IA 50011
... based parameters (www.softberry.com; verified 13 Dec. 2006), and GeneMark.hmm with
A. thaliana based parameters (Lukashin and Borodovsky, 1998) were run. ...
J Gen Virol
88 (2007), 450-457; DOI 10.1099/vir.0.82396-0
Genome organization of the Chelonus inanitus
polydnavirus: excision sites, spacers and abundance of proviral and excised segments
Marc Annaheim and Beatrice Lanzrein
Institute of Cell Biology, Baltzerstrasse 4, CH-3012 Bern, Switzerland
... Gene prediction with Softberry software suggested the presence of a gene with
a deduced product of 57 amino acids and two exons on the spacer. ...
Molecular Biology and Evolution
2007 24(2):539-550; doi:10.1093/molbev/msl183
Mechanisms and Rates of Birth and Death of Dispersed Duplicated Genes during the Evolution of a Multigene Family in Diploid and Tetraploid Wheats
Eduard D. Akhunov, Alina R. Akhunova and Jan Dvorak
Department of Plant Sciences, University of California, Davis
... No known promoter or enhancer elements were found with the promoter
prediction software
(www.softberry.com/berry.phtml) within a 1,297-bp sequenced region ...
Journal of Bacteriology
March 2007, p. 1774-1782, Vol. 189, No. 5
The fox Operon from Rhodobacter Strain SW2 Promotes
Phototrophic Fe(II) Oxidation in Rhodobacter capsulatus SB1003
Laura R. Croal, Yongqin Jiao, and Dianne K. Newman
Division of Biology, Division of Geological and Planetary Sciences, Howard Hughes Medical Institute,
California Institute of Technology, Pasadena, California 91125
... Predicted operons, promoters, and terminators were identified with the
tools at Softberry (http://www.softberry.com/berry.phtml). ...
PLoS Comput Biol
2006 2(3): e18 doi:10.1371/journal.pcbi.0020018
A Third Approach to Gene Prediction Suggests Thousands of Additional Human Transcribed Regions
Glusman G, Qin S, El-Gewely MR, Siegel AF, Roach JC, et al.
1 Institute for Systems Biology, Seattle, Washington, United States of America, 2 Institute of Medical Biology, University of Tromso, Tromso, Norway, 3 Departments of Management Science, Finance and Statistics, University of Washington, Seattle, Washington, United States of America
...We include here the genomewide annotation of known genes (KG), Ensembl genes (ENS), Twinscan (TW),
GenScan (GS), Softberry genes (SB)..
Infection and Immunity,
January 2006, p. 410-424, Vol. 74, No. 1
DNA Adenine Methyltransferase Influences the Virulence of
Aeromonas hydrophila
Tatiana E. Erova et al.,
Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, Texas 77555-1070
... Putative -10 (GGGTAGAAT) and -35 (TAGCCA) elements of the promoter were also identified
in this region using a software program found at www.softberry.com. ...
Molecular Microbiology
Volume 59 Issue 2 Page 707-721, January 2006
Evidence for siderophore-dependent iron acquisition in group B streptococcus
Anne Clancy et al.,
1Division of Infectious Diseases, Immunology, and Rheumatology, Department of Pediatrics, Children's Hospital and Regional Medical Center/University of Washington, 307 Westlake Avenue N, Seattle WA 98109, USA.
2 Department of Microbiology and Immunology, University of Western Ontario, London, ON, Canada N6A 5C1.
... The promoter prediction programs utilized were http:/ / www.fruitfly.org/ seq_tools/
promoter.html and http:/ / www.softberry.com/ berry.phtml?topic=promoter . ...
Infection and Immunity,
October 2006, p. 5763-5772, Vol. 74, No. 10
Mutations within the Catalytic Motif of DNA Adenine
Methyltransferase (Dam) of Aeromonas hydrophila Cause the
Virulence of the Dam-Overproducing Strain To Revert to
That of the Wild-Type Phenotype
Tatiana E. Erova et al.,
Department of Microbiology and Immunology, The University of Texas Medical Branch, Galveston, Texas 77555-1070
... be methylated by Dam, resulting in increased Act production, were detected within
the putative promoter region by using a software program from Softberry, Inc. ...
JBC Papers in Press.
Published on May 15, 2006 as Manuscript M601307200
Importance of CREB in Regulation of Expression of the Murine Cyclic Nucleotide
Phosphodiesterase 3B (PDE3B) Gene in Differentiating 3T3-L1 Preadipocytes
Hanguan Liu et al.,
Pulmonary/Critical Care Medicine Branch, National Heart, Lung, and Blood Institute, National
Institutes of Health, Bethesda, MD 20892 and +Section for Molecular Signaling, Department of Cell
and Molecular Biology, University of Lund, S-22100, Lund, Sweden
Consistent with our experimental results, two promoter regions
(beginning at position -4061 and another, at-364)
were predicted when 5105 bp of the 5’-flanking sequence of the murine
PDE3B gene was queried at http://www.softberry.com/all.htm.
Molecular Biology and Evolution
2006 23(7):1386-1396; doi:10.1093/molbev/msl004
Molecular Characterization of a Diagnostic DNA Marker for Domesticated Tetraploid Wheat Provides Evidence for Gene Flow from Wild Tetraploid Wheat to Hexaploid Wheat
Jan Dvorak, Eduard D. Akhunov, Alina R. Akhunov, Karin R. Deal and Ming-Cheng Luo
Department of Plant Sciences, University of California, Davis
A putative transcription start was identified 166 bp upstream of the translation start by
searching promoter a database at http://www.softberry.com/berry.phtml.
Genetics,
Vol. 172, 1251-1261, February 2006
The Maize aberrant pollen transmission 1 Gene Is a SABRE/KIP Homolog
Required for Pollen Tube Growth
Zhennan Xu*, and Hugo K. Dooner*
* Waksman Institute, Rutgers University, Piscataway, New Jersey 08855 and
Department of Plant Biology, Rutgers University, New Brunswick, New Jersey 08901
...The exon–intron
junctions of the rice SAK genes were determined
with the Softberry sequence analysis program (http://
www.softberry.com/berry.phtml), aided by the maize
apt1 full-length cDNA sequence....
Science
28 April 2006:
Vol. 312. no. 5773, pp. 583 - 588
Global Control of Dimorphism and Virulence in Fungi
Julie C. Nemecek,1 Marcel Wuthrich,2 Bruce S. Klein
Department of Medical Microbiology and Immunology, University of Wisconsin Medical School, University of Wisconsin Hospital and Clinics, Madison, WI 53792, USA.
... ORFA encodes a protein of 1274 residues (on the basis of transcript size) and
predicted by gene-finding software (Softberry, Mount Kisco, NY). ...
Applied and Environmental Microbiology
February 2006, p. 1086-1095, Vol. 72, No. 2
The Naphthalene Catabolic (nag) Genes of Polaromonas naphthalenivorans CJ2:
Evolutionary Implications for Two Gene Clusters and Novel Regulatory Control
Che Ok Jeon,1,2 Minjeong Park,2 Hyun-Su Ro,2,3 Woojun Park,4 and Eugene L. Madsen1
Department of Microbiology, Cornell University, Ithaca, New York 14853-8101,
1 Division of Environmental Biotechnology, EBNCRC & PMBBRC, Gyeongsang National University, 900 Gazwa-dong, JinJu, GyeongNam 660-701, Korea,
... 1). Transcription promoters and termination sequences of the nag gene clusters were
analyzed by using web-based programs (http://www.softberry.com/; http://www ...
Blood Coagulation & Fibrinolysis.
17(1):69-73, January 2006.
Identification of five novel mutations in the factor XI gene (F11) of patients with factor XI deficiency
Quelin, Florence et al.,
... NetGene2/ ; http://www.fruitfly.org/cgi-bin/seq_tools/splice.pl ; http://125.itba.
mi.cnr.it/?webgene/wwwspliceview.html ; http://www.softberry.com/cgi-bin ...
Acta Biochimica et Biophysica Sinica,
Volume 38, Number 7, July 2006 , pp. 492-499(8)
OsFY, a Homolog of AtFY, Encodes a Protein that
Can Interact with OsFCA-g in Rice (Oryza sativa L.)
LU, Qi; XU, Zheng-Kai; SONG, Ren-Tao
Shanghai Key Laboratory of Bio-energy Crop, School of Life Sciences, Shanghai University, Shanghai 200444, China
... AP003735). We predicted OsFY mRNA using HMM-based gene structure prediction with
the monocot setting at http:/ /www.softberry.com/berry.phtml. ...
Archives of Microbiology
Volume 186, Number 6 / December, 2006 513-517
The ntp operon encoding the Na+ V-ATPase of
the thermophile Caloramator fervidus
Trees Ubbink-Kok1, Jeroen Nijland1, Dirk-Jan Slotboom2 and Juke S. Lolkema1
(1) Molecular Microbiology, Biomolecular Sciences and Biotechnology Institute, University of Groningen, Kerklaan 30, 9751 NN, Haren, Groningen, The Netherlands
(2) Membrane Enzymology, Biomolecular Sciences and Biotechnology Institute, University of Groningen, Nijenborgh 4, 9747 AG Groningen, The Netherlands
... related organ- isms. Putative promoters and terminators were identi- Wed
at http://www.softberry.com/berry.phtml. The sequence was ...
Molecular Biology and Evolution
2006 23(3):550-558
Molecular Evolution of the Ankyrin Gene Family
Xinjiang Cai, and Yanhong Zhang
Howard Hughes Medical Institute and Departments of Cell Biology, Biochemistry, and Neuroscience, Duke University Medical Center and Department of Medicine, Duke University Medical Center
... open reading frames using the GENSCAN program (Burge and Karlin 1997 Go)
(http://genes.mit.edu/GENSCAN.html) or GENE FINDING programs at the Softberry Web ...
DNA Sequence
Volume 17, Issue 1 February 2006 , pages 31 - 40
Alternative splicing and expression analysis of
OsFCA (FCA in Oryza sativa L.), a gene homologous to FCA in Arabidopsis
Xiling Du; Xiaoyin Qian; Dong Wang; Jinshui Yang
Institute of Genetics, School of Life Sciences, Fudan University. Shanghai. China
... The obtained genomic sequence was sent to Softberry (www.softberry.com) to predict
the sequence of full length cDNA of OsFCA. ... Softberry (www.softberry.com). ...
Applied and Environmental Microbiology
February 2006, p. 1496-1506, Vol. 72, No. 2
Paenibacillus sp. Strain JDR-2 and XynA1: a Novel System for Methylglucuronoxylan Utilization
Franz J. StJohn, John D. Rice, and James F. Preston*
Department of Microbiology and Cell Science, University of Florida, Gainesville, Florida 32611
... Analysis of sequences for regulatory elements was conducted using the online tools
available through Softberry (http://www.softberry.com/berry.phtml). ...
Microbiology
151 (2005), 1671-1682; DOI 10.1099/mic.0.27848-0
mrpA, a gene with roles in resistance to Na+ and adaptation to alkaline pH in the cyanobacterium Anabaena sp. PCC7120
A. Blanco-Rivero1,, F. Leganes1, E. Fernandez-Valiente1, P. Calle2 and F. Fernandez-Pinas1
1 Departamento de Biologia, Facultad de Ciencias, Universidad Autonoma de Madrid, Madrid 28049, Spain
2 Departamento de Quimica Fisica Aplicada, Universidad Autonoma de Madrid, Madrid 28049, Spain
... A promoter-like sequence (-35 region and -10 region; http://www.softberry.com/
berry.phtml) was found in the upstream region (data not shown). ...
Journal of Bacteriology
December 2005, p. 8247-8255, Vol. 187, No. 24 doi:10.1128/JB.187.24.8247-8255.2005
Distribution and Expression of the ZmpA Metalloprotease in the Burkholderia cepacia Complex
S. Gingues, C. Kooi, M. B. Visser, B. Subsin, and P. A. Sokol
Department of Microbiology & Infectious Diseases, University of Calgary, Calgary, Alberta T2N 4N1, Canada
... promoter sequences of J2315 and Pc715j zmpA were compared and found to be identical
in both the -35 (TTGTAA) and -10 (TTCTAGCAT) regions (www.softberry.com ...
Current Microbiology
Volume 50, Number 3 / March, 2005 pp. 129-132
Characterization of a 4 kb Variant of the nifD Element in Anabaena sp. Strain ATCC 33047
Brian J. Henson1, Linda E. Watson1 and Susan R. Barnum1
(1) Department of Botany, Miami University, Oxford, OH 45056, USA
... ORF searches were performed with the NCBI ORF finder (www.ncbi.nlm.nih.gov), Gene
Finder (www.softberry.com), and Gene Mark (http://opa1.biology.gatech.edu ...
Microbiology
151 (2005), 1381-1393; DOI 10.1099/mic.0.27718-0
Enterococcus faecalis divIVA: an essential gene involved in cell division, cell growth and chromosome segregation
Sandra Ramirez-Arcos1,2,, Mingmin Liao1, Susan Marthaler1, Marc Rigden1 and Jo-Anne R. Dillon1,2,
1 Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, ON, Canada K1H 8M5
2 Centre for Research in Biopharmaceuticals and Biotechnology, University of Ottawa, Ottawa, ON, Canada K1H 8M5
... and the presence of putative promoters and transcriptional terminators in the E.
faecalis dcw gene cluster was completed using http://sun1.softberry.com/berry ...
Journal of Experimental Botany
2005 56(414):1177-1188; doi:10.1093/jxb/eri110
Molecular characterization of DNA sequences from the Primula vulgaris S-locus
Manfield et al.,
Centre for Plant Sciences, Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, UK
... Prediction of putative genes structures was undertaken using gene prediction software
using the default parameters (www.softberry.com/berry.phtml). Results. ...
Antimicrobial Agents and Chemotherapy
April 2005, p. 1432-1440, Vol. 49, No. 4 doi:10.1128/AAC.49.4.1432-1440.20
Acquisition of Resistance to Carbapenems in Multidrug-Resistant Clinical Strains of Acinetobacter baumannii: Natural Insertional Inactivation of a Gene Encoding a Member of a Novel Family of ?-Barrel Outer Membrane Proteins
Maria A. Mussi, Adriana S. Limansky, and Alejandro M. Viale
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, Rosario, Argentina
... Predictions of consensus bacterial promoter sequences were conducted at
http://www.softberry.com. Nucleotide sequence accession numbers. ...
Nucleic Acids Research
2005 33(5):1739; doi:10.1093/nar/gki320
Human pol II promoter prediction: time series descriptors and machine learning
Rajeev Gangal and Pankaj Sharma
SciNova Technologies Pvt. Ltd 528/43 Vishwashobha, Adjacent to Modi Ganpati, Narayan Peth, Pune 411030, Maharashtra, India
... for promoter prediction, eg Neural Network Promoter Prediction (http://www.fruitfly.
org/seq_tools/promoter.html), SoftBerry (http://www.softberry.com/berry ...
Plant Molecular Biology
Volume 58, Number 3 / June, 2005 pp.421-433
OsPPR1, a pentatricopeptide repeat protein of rice is essential for the chloroplast biogenesis
Kodiveri M. Gothandam1, Eun-Sook Kim1, Hongjoo Cho1 and Yong-Yoon Chung1
(1) School of Life Sciences and Biotechnology, Korea University, Sungbuk-ku, 136-701, Seoul, Anam-Dong, Korea
... nucleotide and amino acid sequences were analyzed by the Basic Local Alignment Search
Tool (BLAST) and the Softberry prog- rame (http://www.softberry.com/). ...
Mol Cells.
2005 Apr 30;19(2):212-8.
Characterization of an abiotic stress-inducible dehydrin gene, OsDhn1, in rice (Oryza sativa L.)
Lee SC et al.,
Department of Life Science, Sogang University, Seoul 121-742, Korea
... genomic sequences were retrieved (with E-values < 3.8) all of which contained putative
dehydrin genes as predicted by the annotation tool, Softberry (http://www ...
Microbiol Res.
2005;160(3):233-42.
Salt stress induction of glutamyl endopeptidase biosynthesis in Bacillus intermedius
Gabdrakhmanova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia
... was inspected for the occurrence of the characteristic -35 and -10 boxes of
SigA-type promoters (Helmann, 1995) by using the Softberry Prediction of ...
Biochim Biophys Acta.
2005 Jan 3;1739(2-3):140-9
Potential structure/function relationships of predicted secondary structural elements of tau
Gamblin TC.
Department of Molecular Biosciences, University of Kansas, 1200 Sunnyside Ave. Lawrence, KS 66045, USA
... sequence [17]. This analysis was originally performed on-line, and is now
available at http://www.softberry.com/berry.phtml. The ...
Microbiology 150 (2004), 518-520; DOI 10.1099/mic.0.26871-0
IVET experiments in Pseudomonas fluorescens reveal cryptic promoters at loci associated with recognizable overlapping genes
Mark W. Silby1, Paul B. Rainey2,3 and Stuart B. Levy1,4
1 Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, USA
...Using SoftBerry software (http://www.softberry.com/berry.phtml), -35 and -10 boxes and a transcriptional start site were predicted 84, 60 and 44 bp upstream of the iiv5 ORF, respectively...
alzheimer’s disease brain
Journal Journal of Molecular Neuroscience
Volume 24, Number 2 / June, 2004 pp.269-275
The splicing regulatory protein p18SRP is down-regulated in alzheimer’s disease brain
Heese et al.,
(1) BF Research Institute, c/o National Cardiovascular Center, 565-0873 Suita, Osaka, Japan
(2) Choju Medical Institute, Fukushimura Hospital, Noyori, 441-8124 Toyohashi, Aichi, Japan
... Protein sequence analysis was per- formed with Prosite, Profile, Blocks, ProDom,
Prints, Pfam, PsortII, Softberry, AACompIdent, Inter- ProScan, SMART,and ELM ...
Plant Science
Volume 166, Issue 1, January 2004, Pages 69-79
Trapping and characterization of cold-responsive genes from T-DNA tagging lines in rice
Lee et al.,
a Department of Life Science, Sogang University, Seoul 121-742, South Korea
b Department of Life Science, Pohang University of Science and Technology, Pohang 790-784, South Korea
... database, and were annotated using the Rice Genome Automated Annotation System
(RiceGAAS; http://www.ricegaas.dna.affrc.go.jp), the Softberry program (http ...
Plant Molecular Biology
Volume 54, Number 4 / March, 2004 pp. 489-502
Generation of T-DNA Tagging Lines with a Bidirectional Gene Trap Vector and the Establishment of an Insertion-Site Database
Ryu et al.,
(1) National Research Laboratory of Plant Functional Genomics, Department of Life Science, Pohang University of Science and Technology (POSTECH), Pohang, 790-784, Republic of Korea
(2) Department of Molecular Biology, Pusan National University, Busan, 609-735, Republic of Korea
... been annotated in the public databases, we undertook annotation with the
Softberry program (http:// www.softberry.com/berry.phtml). ...
J Cell Biochem.
2004 Apr 1;91(5):1030-42
Characterizing the new transcription regulator protein p60T
Heese et al.,
BF Research Institute, c/o National Cardiovascular Center, 5-7-1 Fujishirodai, Suita, Osaka 565-0873, Japan
... expasy.ch): softberry: http://www.softberry. com/index.html; and Amino Acid Composition
Search (AACompIdent): http://kr.expasy.org/ tools/aacomp/. ...
Journal of Photoscience
2004, Vol. 11(3), pp. 115-120
Construction of Gene-Specific Primers for Various AntioxidantIsoenzyme Genes and Their Expressions in Rice (Oryza sativa L.)Seedlings Obtained from Gamma-irradiated Seed
Kim et al.,
1 Division of Radiation Application Research, Korea Atomic Energy Research Institute, Daejeon 305-353, Korea
... in the database (Table 1). In the case of CATa, its cDNA sequence was predicted
from the genomic DNA at a gene prediction site (http:// www.softberry.com/). ...
Genome Biol.
2003;5(1):R3. Epub 2003 Dec 22
An integrated gene annotation and transcriptional profiling approach towards the full gene content of the Drosophila genome.
Hild et al.,
Zentrum fur Molekulare Biologie Heidelberg, University of Heidelberg, Im Neuenheimer Feld 282, 69120 Heidelberg, Germany.
... Max Planck Institute for Molecular Genetics, Ihnestra?e 73, 14195 Berlin,
Germany. § Softberry, Inc., 116 Radio Circle, Suite ...
Invest Ophthalmol Vis Sci
2003;44: E-Abstract 418. 418—B393
Identification of Promoter and Other Regulatory Regions of Pitx3 Gene
E.V. Semina1, K. Frees2, S. Tomarev3, A. Cvekl4 and J.C. Murray4
1 Pediatrics, Medical College of Wisconsin, Milwaukee, WI, United States
2 Pediatrics, University of Iowa, Iowa City, IA, United States
... MatInspector and Softberry software have been utilized to perform promoter searches
and to identify binding sites for transcription factors/potential ...
Physiological and Molecular Plant Pathology
Vol. 62, no. 5, pp. 305-313. May 2003
Characterisation of neutral trehalase and UDP-glucose:sterol glucosyltransferase genes from the plant pathogenic fungus Leptosphaeria maculans
Idnurm, A., Warnecke, DC., Heinz, E., Howlett, BJ.*
... The larger transcript, detected by amplification of cDNA using primers designed
within an exon predicted by DNA analysis software (www.softberry.com), encodes ...
Plant Physiology
133:2040-2047 (2003)
Generation and Analysis of End Sequence Database for T-DNA Tagging Lines in Rice
Suyoung An et al.,
National Research Laboratory of Plant Functional Genomics, Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang 790-784, Korea (S.A., S.P., D.-H.J., D.-Y.L., H.-G.K., J.-H.Y., J.H., S.-R.K., Y.-H.K., M.L., G.A.
... sequence had not yet been annotated in the public database, the sequence surrounding
the insertion site was annotated using the Softberry program (http://www ...
Plant Molecular Biology
Volume 52, Number 5 / July, 2003, pp. 923-934
Abundance of plastid DNA insertions in nuclear genomes of rice and Arabidopsis
Ilham A. Shahmuradov 1 , Yagut Yu. Akbarova 2, Victor V. Solovyev 3 and Jalal A. Aliyev 2
(1) Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK
(2) Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
(3) Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA
Nucleic Acids Research,
2003, Vol. 31, No. 4 1148-1155
Characterization of Arabidopsis thaliana ortholog of the human breast cancer susceptibility gene 1: AtBRCA1, strongly induced by gamma rays
S. Lafarge and M.-H. Montane*
CEA Cadarache, DSV-DEVM, Laboratoire de Radiobiologie Vegetale, Bat 185, F-13108 St Paul Lez Durance Cedex, France
...Gene structure prediction was done on software implemented on the Softberry web page (http://www.softberry.com/), analysis of protein domains using the SMART...
...The gene structure of At4g21070 was determined with three gene structure prediction software packages (Softberry, GenScan, Grail). .... To resolve this ambiguity in intron-exon prediction, we postulated the presence of two genes given by Softberry prediction software and performed northern blotting and 5' RACE to characterize the structural organization of the At4g21070 locus...
The Plant Cell
Vol. 14, 2107-2119, September 2002
Two Novel Fungal Virulence Genes Specifically Expressed in Appressoria of the Rice Blast Fungus
Chaoyang Xue a et al.,
a Department of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 47907
... were sequenced and analyzed with several programs, including TRES (www.bioportal.
bic.nus.edu.sg/tres), Expasy (www.expasy.org), and SoftBerry (www.softberry.com ...
Biological Psychiatry
Volume 51, Issue 11, Pages 896-901
Association study of novel human serotonin 5-HT1B polymorphisms with alcohol dependence in taiwanese han
H.Sun et al.,
... be identified within the 5? regulatory region; however, sequence annotation using
the Nucleotide Sequence Analysis program (http://softberry.com/) predicts a ...
Journal of Bacteriology
January 2002, p. 183-190, Vol. 184, No. 1
Regulation of the acuF Gene, Encoding Phosphoenolpyruvate Carboxykinase in the Filamentous Fungus Aspergillus nidulans
Michael J. Hynes,* Oliver W. Draht,, and Meryl A. Davis
Department of Genetics, University of Melbourne, Parkville, Victoria 3010, Australia
... The Protein Sequence Analysis program (http://www.softberry.com/protein.html) predicted
a PEPCK (ATP) signature sequence between amino acids 275 and 290. ...
Eur J Neurosci.
2002 Jan;15(1):79-86.
Characterizing CGI-94 (comparative gene identification-94) which is down-regulated in the hippocampus of early stage Alzheimer's disease brain
Heese et al.,
BF Research Institute, c/o National Cardiovascular Center, 5-7-1 Fujishiro-dai, Suita, Osaka, 565-0873 Japan
... Additionally, protein sequence analysis was performed using the following programs
at ExPASy, http://www.expasy.ch; softberry, http://www/softberry.com/index ...
Plant Cell
2002 September; 14(9): 2107–2119.
doi: 10.1105/tpc.003426
Two Novel Fungal Virulence Genes Specifically Expressed in Appressoria of the Rice Blast Fungus
Chaoyang Xue et al.,
aDepartment of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 47907
... were sequenced and analyzed with several programs, including TRES (www.bioportal.
bic.nus.edu.sg/tres), Expasy (www.expasy.org), and SoftBerry (www.softberry.com ...
Plant Physiol.
February 2002, Vol. 128, pp. 336-340
Cellulose Synthase-Like Genes of Rice
Samuel P. Hazen, John S. Scott-Craig, and Jonathan D. Walton
Department of Energy-Plant Research Laboratory, Michigan State University, East Lansing, Michigan 48824
... the corresponding proteins were deduced using gene prediction software from GeneMark
(Atlanta; http://opal.biology.gatech.edu/GeneMark) and Softberry, Inc. ...
|