Test on-line:

The programs usage in Scientific publications BPROM
FPROM
CpGFinder
NSITE
NSITE-PL
NSITEM
PATTERN
POLYAH
PROMH
PlantProm
RegSite
ScanWM-P
TSSP
TSSG
TSSW



BPROM

Infection and Immunity
2016, 84(9), 2566-2574. doi: 10.1128/IAI.00297-16

Evidence that BosR (BB0647) is a positive autoregulator in Borrelia burgdorferi

Ouyang, Z., Zhou, J., Norgard, M. V.
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas, USA

... To investigate further the regulation of bosR expression in B. burgdorferi, we analyzed the 5? putative regulatory region upstream of bb0648 using BPROM (SoftBerry), a bacterial promoter prediction program. A typical bacterial ? 70 promoter (P1) (Fig. ...


Research in microbiology
2016, 167(2), 90-102. http://dx.doi.org/10.1016/j.resmic.2015.10.004

Insights into aureocin A70 regulation: participation of regulator AurR, alternative transcription factor sB and phage f11 regulator cI

Coelho, M. L. V., Fleming, L. R., & de Freire Bastos, M. D. C.
a Departamento de Microbiologia Geral, Instituto de Microbiologia Paulo de Goes, UFRJ, Rio de Janeiro, Brazil b Instituto Nacional da Propriedade Industrial, INPI, Brazil

... operon, a region of 240 nucleotides immediately upstream of this operon was analyzed using programs PPP (http://bioinformatics. biol.rug.nl/websoftware/ppp/ppp_start.php) and BPROM (http://linux1.softberry.com). ...


Applied and environmental microbiology
2016, 82(12), 3503-3514. doi: 10.1128/AEM.00299-16

Agrobacterium tumefaciens Zur Regulates the High-Affinity Zinc Uptake System TroCBA and the Putative Metal Chaperone YciC, along with ZinT and ZnuABC, for Survival under Zinc-Limiting Conditions

Chaoprasid, P. et al.,
aLaboratory of Biotechnology, Chulabhorn Research Institute, Lak Si, Bangkok, Thailand bEnvironmental Toxicology, Chulabhorn Graduate Institute, Lak Si, Bangkok, Thailand

... 300 bp (Fig. 1B). The transcriptional start sites of troC (at the A residue) and of yciC (at the A residue) were determined by 5? RACE, and the ?10 and ?35 sequences were predicted using BPROM (Softberry) (Fig. 1B). A Zur ...


BMC Genomics
2016, 17:326 DOI: 10.1186/s12864-016-2680-8

Xylan degradation by the human gut Bacteroides xylanisolvens XB1A T involves two distinct gene clusters that are linked at the transcriptional level

Despres, J. et al.,
Institut National de la recherche Agronomique (INRA), UR454 Microbiologie; INRA, Plate-forme d’Exploration du Metabolisme

... Putative promoters and terminators were searched within intergenic sequences (>100 bp) using different tools (BPROM, PPP, Arnold) available at http://molbiol-tools.ca/Promoters.htm. Operon prediction was carried out using FGENESB, which is based on distances between ORFs and frequencies of different genes neighboring each other in known bacterial genomes, as well as on promoter and terminator predictions (http://www.softberry.com/berry.phtml?topic=fgenesb&group=programs&subgroup=gfindb). ...


Applied and environmental microbiology
2016, 82(4), 1274-1285. doi: 10.1128/AEM.03111-15

A new N-Acyl homoserine lactone synthase in an uncultured symbiont of the Red Sea sponge Theonella swinhoei

Britstein, M. et al.,
aDepartment of Marine Biology, Leon H. Charney School of Marine Sciences, University of Haifa, Haifa, Israel bBacteriology Group, International Centre for Genetic Engineering & Biotechnology, Padriciano, Trieste, Italy cArgonne National Laboratory, Institute for Genomic and Systems Biology, Argonne, Illinois, USA

... The intergenic region between TswR and TswI, predicted to contain the promoter region of the TswI AHL synthase (based on Predictions of Bacterial Promoters [BPROM]; Softberry), and the intergenic region between TswR-t and TswR, predicted to contain the promoter region ...


SpringerPlus
2016 65:1060 DOI: 10.1186/s40064-016-2693-4

Characterization of antimicrobial substance from Lactobacillus salivarius KL-D4 and its application as biopreservative for creamy filling

Therdtatha, P. et al.,
Specialized Research Unit, Probiotics and Prebiotics for Health, Department of Biotechnology, Faculty of Agro-Industry, Kasetsart University Center for Advanced Studies for Agriculture and Food (CASAF), Kasetsart University Institute for Advanced Studies (NRU-KU), Kasetsart University

... Bacterial promoter prediction was performed using BROM on the Softberry (online program) on August 4th, 2015 ...


Molecular microbiology
2016, 99(3), 453-469. DOI: 10.1111/mmi.13128

Vibrio cholerae phosphatases required for the utilization of nucleotides and extracellular DNA as phosphate sources

McDonough, E., Kamp, H., Camilli, A.
Howard Hughes Medical Institute and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA, USA

... Using the online promoter prediction tool, Softberry BRPOM (Solovyev and Salamov, 2011), we identified two putative CRP binding sites in the V.?cholerae cpdB promoter. ...


PloS one
2016, 11(7), e0158895. http://dx.doi.org/10.1371/journal.pone.0158895

Identification, Functional Characterization and Regulon Prediction of a Novel Two Component System Comprising BAS0540-BAS0541 of Bacillus anthracis

Gopalani, M., Dhiman, A., Rahi, A., Kandari, D., & Bhatnagar, R.
Laboratory of Molecular Biology and Genetic Engineering, School of Biotechnology, Jawaharlal Nehru University, New Delhi-110067, India

... search. Promoter predictions were done using PromBase [27] and Bprom program (Softberry) wherever needed. ...


Environmental Microbiology
2016 DOI: 10.1111/1462-2920.13419

The guanidinobutyrase GbuA is essential for the alkylquinolone-regulated pyocyanin production during parasitic growth of Pseudomonas aeruginosa in co-culture with Aeromonas hydrophila

Jagmann, N., Bleicher, V., Busche, T., Kalinowski, J., & Philipp, B.
Institut fur Molekulare Mikrobiologie und Biotechnologie, Westfalische Wilhelms-Universitat (WWU) Munster, Munster, Germany Center for Biotechnology (CeBiTec), Universitat Bielefeld, Bielefeld, Germany

... With the bacterial promoter prediction program BProm (www.softberry.com), however, another putative promoter could be identified within the gene ...


Frontiers in Microbiology
26 May 2016, 7, 782 http://dx.doi.org/10.3389/fmicb.2016.00782

When Genome-Based Approach Meets the "Old but Good": Revealing Genes Involved in the Antibacterial Activity of Pseudomonas sp. P482 against Soft Rot Pathogens

Krzyzanowska, D. M. et al.,
1Laboratory of Biological Plant Protection, Department of Biotechnology, Intercollegiate Faculty of Biotechnology of University of Gdansk and Medical University of Gdansk, Gdansk, Poland 2Laboratory of Molecular Bacteriology, Department of Medical Biotechnology, Intercollegiate Faculty of Biotechnology University of Gdansk and Medical University of Gdansk, Medical University of Gdansk, Gdansk, Poland 3School of Life Sciences, Faculty of Medicine and Health Sciences, University of Nottingham, Nottingham, UK

... The sequence of interest (contig JHTS01000055.1, range 27,755–36,623) was analyzed for the presence of sigma housekeeping promoter sequence by three different programs: PromoterHunter9 (Klucar et al., 2010), Promoter prediction10 (Reese, 2001) and BPROM 11 (Solovyev and Salamov, 2011). ...


RNA
2016, 22(9), 1373-1385. doi: 10.1261/rna.055129.115

A computational strategy for the search of regulatory small RNAs in Actinobacillus pleuropneumoniae

Rossi, C. C. et al.,
1Laboratorio de Genetica Molecular de Micro-organismos, Departamento de Microbiologia, Instituto de Biotecnologia Aplicada a Agropecuaria–BIOAGRO, Universidade Federal de Vicosa, Vicosa, 36570-900, Brazil 2Section of Paediatrics, Imperial College London, St. Mary's Campus, London W2 1PG, United Kingdom

... All the candidates had putative Rho-independent terminator regions and promoter elements in the close upstream region of each designated gene, as predicted by BPROM (software Softberry, available at www.softberry.com, Supplemental Fig. S2). ...


Biochemistry (Moscow)
2016, 81(8), 884-891. doi:10.1134/S0006297916080095

Features of gene expression of Bacillus pumilus metalloendopeptidase

Rudakova, N. L. et al.,
Kazan (Volga Region) Federal University

... trpC2; ?glnK – strain deficient in the glnK gene, CmR Page 3. 886 RUDAKOVA et al. BIOCHEMISTRY (Moscow) Vol. 81 No. 8 2016 metalloendopeptidase gene using the Softberry BPROM network [10]. The results were statistically processed in Microsoft Excel. ...


Microbial Drug Resistance
2016 doi:10.1089/mdr.2016.0047.

Biochemical Characterization of ?-Lactamases from Mycobacterium abscessus Complex and Genetic Environment of the ?-Lactamase-Encoding Gene

Ramirez, A. et al.,
1Universidad de Los Andes, Facultad de Farmacia y Bioanalisis, Laboratorio de Microbiologia Molecular, Merida, Venezuela. 2Universidad de Buenos Aires, Facultad de Farmacia y Bioquimica, Laboratorio de Resistencia Bacteriana, Buenos Aires, Argentina.

... 60 sec. Putative gene promoter sequences (?35) were recognized using the BPROM program (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb). DNA sequencing and analysis PCR products ...


Int J Nano Stud Technol
2016, S3:001, 1-8.

Removal of Heavy Metals by Indigenous Microorganisms and Identification of Gene Responsible for Remediation

M.H. Fulekar
1 School of Environment and Sustainable Development, Central University of Gujarat, Gandhinagar, India. 2 Environmental Biotechnology Laboratory,Department of Life Sciences, University of Mumbai, Vidyanagari, Santacruz (E) Mumbai, India.

... biology tools, ExPASy. The restriction endonuclease sites of the gene was determined with the help of online analysis tools. The promoter region was determined by Softberry-BRPROM program. Result and Discussion The ...


Frontiers in Microbiology
2016, 7: 1115. doi: 10.3389/fmicb.2016.01115

Thusin, a novel two-component lantibiotic with potent antimicrobial activity against several Gram-positive pathogens

Xin, B. et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China

.. The putative promoter and terminator in the thusin gene cluster were detected using the Softberry BPROM and Find Term software programs ...


Viruses
2016, 8(8), 213; doi:10.3390/v8080213

Binding Specificities of the Telomere Phage ?KO2 Prophage Repressor CB and Lytic Repressor Cro

Hammerl, J. A., Jackel, C., Lanka, E., Roschanski, N., Hertwig, S.
1 Bundesinstitut fur Risikobewertung (Federal Institute for Risk Assessment), Department of Biological Safety, Diedersdorfer Weg 1, D-12277 Berlin, Germany 2 Max-Planck-Institut fur Molekulare Genetik, Ihnestra?e 63-73, D-14195 Berlin, Germany

... In silico promoter identification was performed by using BPROM (Softberry, Mount Kisco, NY, USA ...


Frontiers in microbiology
2016, 7: 687. doi: 10.3389/fmicb.2016.00687

The rnc Gene Promotes Exopolysaccharide Synthesis and Represses the vicRKX Gene Expressions via MicroRNA-Size Small RNAs in Streptococcus mutans

Mao, M. Y. et al.,
1State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, China 2Department of Dentistry, Yan'an Hospital Affiliated to Kunming Medical University, Kunming, China

... We first analyzed these intergenic noncoding sequences by FGENESB and BPROM programs for operon and promoter prediction, respectively (http://linux1.softberry.com/berry.phtml) (Solovyev and ...


Plasmid
2016, Volumes 84–85, March–May 2016, Pages 36–43. doi:10.1016/j.plasmid.2016.02.005

The ancient small mobilizable plasmid pALWED1. 8 harboring a new variant of the non-cassette streptomycin/spectinomycin resistance gene aadA27

Kurakov, A. et al.,
a Institute of Molecular Genetics, Russian Academy of Sciences, Kurchatov sq. 2, 123182 Moscow, Russia b Institute of Bioengineering, Research Center of Biotechnology of the Russian Academy of Sciences, Leninsky Ave. 33, bld. 2, 119071 Moscow, Russia

.. Putative ORFs and promoters were detected using BPROM, FGENESB (http://www.softberry.com/berry.html), and GeneMark.hmm for ...


PloS one
2016, 11(7), e0158793. doi: 10.1371/journal.pone.0158793

In Vitro Analysis of Predicted DNA-Binding Sites for the Stl Repressor of the Staphylococcus aureus SaPIBov1 Pathogenicity Island

Papp-Kadar, V., Szabo, J. E., Nyiri, K., Vertessy, B. G.
Department of Applied Biotechnology and Food Science, Budapest University of Technology and Economics, Budapest, 1111, Hungary, Laboratory of Genome Metabolism and Repair, Institute of Enzymology, Research Centre for Natural Sciences, Hungarian Academy of Sciences, Budapest, 1117, Hungary

... For promoter prediction the BRPOM software was used (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) [29]. ...


Molecular Microbiology
2016, doi: 10.1111/mmi.13403

A novel flagellar sheath protein, FcpA, determines filament coiling, translational motility and virulence for the Leptospira spirochete

Author et al.,
1Department of Epidemiology of Microbial Disease, Yale School of Public Health, New Haven, CT 06520, USA. 2Gonc?alo Moniz Research Center, Oswaldo Cruz Foundation, Brazilian Ministry of Health, Salvador, Bahia 40296-710, Brazil

... For complementation, the fcpA gene with its native promoter region (a 400bp-region upstream the start codon as identified by the Softberry software; http://linux1.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb)


Applied and environmental microbiology
2016, 82(6), 1789-1798. doi: 10.1128/AEM.03526-15

A 1, 3-1, 4-b-Glucan Utilization Regulon in Paenibacillus sp. Strain JDR-2

Chow, V. et al.,
aDepartment of Microbiology and Cell Science, University of Florida, Gainesville, Florida, USA bInstitute for Microbial and Biochemical Technology, Forest Products Laboratory, USDA Forest Service, Madison, Wisconsin, USA

... Bioinformatic analyses by BPROM software (SoftBerry) and ARNold software (http://rna.igmors. u-psud.fr/toolbox/arnold/index.php) identified putative promoters and terminators within the genome sequence that includes the bgl16A 1 and bg16lA 2 genes and adjacent genes ...


Applied microbiology and biotechnology
June 2016, Volume 100, Issue 12, pp 5467–5477 DOI: 10.1007/s00253-016-7354-6

New tools for chloroplast genetic engineering allow the synthesis of human growth hormone in the green alga Chlamydomonas reinhardtii

Wannathong, T., Waterhouse, J. C., Young, R. E., Economou, C. K., Purton, S.
Department of Biology, Faculty of ScienceSilpakorn University Algal Research Group, Institute of Structural and Molecular BiologyUniversity College London

... Promoter prediction software, softberry BPROM, indicates a possible –35 element (TTGTAA) upstream of the –10 element. ...


Journal of biosciences
2016, 41(2), 193-203. DOI: 10.1007/s12038-016-9608-y

In situ real-time evaluation of radiation-responsive promoters in the extremely radioresistant microbe Deinococcus radiodurans

Anaganti, N., Basu, B., Apte, S. K.
1. Molecular Biology Division, Bhabha Atomic Research Centre, Mumbai, 400 085, India

.. start site in D. radiodurans in 500bp upstream DNA sequence of selected ORFs was carried out by using software ( http://www.fruitfly.org/seq_tools/ promoter.html ) (Reese 2001) or BPROM software ( http://linux1.softberry.com/berry ...


Journal of molecular biology
2016, 428(2), 477-491. doi:10.1016/j.jmb.2015.12.010

The gene transfer agent RcGTA contains head spikes needed for binding to the Rhodobacter capsulatus polysaccharide cell capsule

Westbye, A. B., Kuchinski, K., Yip, C. K., Beatty, J. T.
1 Department of Microbiology and Immunology, The University of British Columbia, Vancouver, BC, Canada V6T 1Z3 2 Department of Biochemistry and Molecular Biology, The University of British Columbia, Vancouver, BC, Canada V6T 1Z3

... 1) was predicted using Softberry ¶ BPROM [28], and a segment of DNA containing 355 bp 5? of the annotated start codon, including this putative promoter, was found to initiate transcription after fusion to lacZ ...


PloS one
2016, 11(7), e0158447 doi: 10.1371/journal.pone.0158447

Promoter Screening from Bacillus subtilis in Various Conditions Hunting for Synthetic Biology and Industrial Applications

Song, Y. et al.,
Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China, Key Laboratory of Systems Microbial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, P. R. China

... We selected seven strongest promoter candidates and predicted the -35, -10 elements and the lengths of the spacers (Fig 3A) using Softberry Inc., (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Journal of applied microbiology
2016, 120(1), 126-137.

Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001

Zhang, C., Guo, T., Xin, Y., Gao, X., Kong, J.
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China

... Promter prediction was performed by the online available program neural network promoter prediction (http://www.fruitfly. org/seq_tools/promoter.html) and softberry bprom (http://linux1.softberry.com/berry ...


PloS one
2016, 11(7), e0159408. doi: 10.1371/journal.pone.0159408

Identification of Preferred DNA-Binding Sites for the Thermus thermophilus Transcriptional Regulator SbtR by the Combinatorial Approach REPSA

Van Dyke, M. W. et al.,
Department of Chemistry and Biochemistry, Kennesaw State University, Kennesaw, Georgia, United States of America Department of Molecular and Cellular Biology, Kennesaw State University, Kennesaw, Georgia, United States of America

...Sequences ±200 bp of the genomic SbtR site was analyzed using both Softberry BPROM and University of Groningen PePPER to identify potential promoters [49,50]. ...


Journal of Biotechnology
2016, 233, 17-25. doi:10.1016/j.jbiotec.2016.06.024

Rex in Clostridium kluyveri is a global redox-sensing transcriptional regulator

Hu, L. et al.,
a State Key Laboratory of Microbial Technology, School of life science, Shandong University, Jinan, People’s Republic of China b Institute of Basic Medicine, Shandong Academy of Medical Science, Jinan, People’s Republic of China

... To predict promoter, we used the software as follows: BPROM (Softberry, Inc, NY, USA ...


Applied microbiology and biotechnology
2016, 100(3), 1501-1510. DOI: 10.1007/s00253-015-7124-x

Metabolic potential of Bacillus subtilis 168 for the direct conversion of xylans to fermentation products

Rhee, M. S. et al.,
Xycrobe Therapeutics, Inc, College of ForestryNorthwest A&F University, Department of Microbiology and Cell Science, IFASUniversity of Florida

... Using BPROM (Softberry) to identify sequences qualifying as potential promoters, a single promoter with ?35 and ?10 elements was identified upstream from a transcriptional start site 301 bp upstream of the sequence for a ribosomal binding site and 331 bp upstream of an ATG ...


Toxins
2016, 8(4), 113. doi:10.3390/toxins8040113

Identification and Characterization of the HicAB Toxin-Antitoxin System in the Opportunistic Pathogen Pseudomonas aeruginosa

Li, G. et al.,
Department of Microbiology, Third Military Medical University, Chongqing 400038, China

... The putative promoter and terminator were predicted by BPROM (http://linux1.softberry.com/berry. phtml) and FindTerm (http://www.softberry.com/berry.phtml?topic=findterm&group= programs&subgroup=gfindb), respectively. 4.3. DNA Extraction, RNA Purification and RT-PCR. ...


Microbiology
2016, 162(5), 777-788. doi: 10.1099/mic.0.000270

Regulation and production of Tcf, a cable-like fimbriae from Salmonella enterica serovar Typhi

Leclerc, J. M. et al.,
1? Department of Microbiology, Infectiology and Immunology, Universite de Montreal,CP 6128 Succursale Centre-Ville, Montreal, Quebec H3C 3J7,Canada 2? INRS-Institut Armand-Frappier,531 boulevard des Prairies, Laval, Quebec H7V 1B7,Canada

... tcfA promoter region was performed. Putative binding sites for H-NS, RcsB, Fur and ArgR were identified using the bacterial promoter analysis software Softberry Bprom (www.softberry.com) (Fig. 4a). Putative regulation by the ...


Microorganisms
2016, 4(1), 3. doi:10.3390/microorganisms4010003

In Silico Analysis of a Novel Plasmid from the Coral Pathogen Vibrio coralliilyticus Reveals Two Potential "Ecological Islands"

Wachter, J., Hill, S. A.
Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA

... Enzyme restriction sites were identified with the NEBcutter V2.0 tool made available through New England Biolabs [21]. Putative promoters for each orf were identified using BPROM available on Softberry [22]. tRNAs were identified using the tRNAscan-SE program [23]. ...


Biotechnology and Bioprocess Engineering
2016, 21(1), 68-78. DOI: 10.1007/s12257-015-0618-7

Explored a cryptic plasmid pSXM33 from Shewanella xiamenensis BC01 and construction as the shuttle vector

Zhou, Y., Ng, I. S.
1. Department of Chemical and Biochemical Engineering, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen, 361-005, China 2. Department of Chemical Engineering, National Cheng Kung University, Tainan, 70101, Taiwan 3. Research Center for Energy Technology and Strategy, National Cheng Kung University, Tainan, 70101, Taiwan

... edu.cn/ Ori-Finder/. Prediction of transcriptional promoters was carried out with a Web-based BPROM program in http:// www.softberry.com/. The tandem repeats were searched in http://www.loria.fr/mreps. Circular plasmid map ...


In Vitro Cellular & Developmental Biology-Animal
2016, 52(1), 77-88.DOI: 10.1007/s11626-015-9949-0

he Wolbachia WO bacteriophage proteome in the Aedes albopictus C/wStr1 cell line: evidence for lytic activity?

Baldridge, G. D. et al.,
Department of Entomology University of Minnesota Department of Biochemistry, Molecular Biology and BiophysicsUniversity of Minnesota

... Sequences of the non-coding 125-bp region upstream of WD0612 (A) and the 95-bp region downstream of WD0618 (B) were annotated using Softberry BPROM prediction (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb; Solovyev and Salamov 2011). ...


Journal of Molecular Catalysis B: Enzymatic
2016, 130, 1-8. doi:10.1016/j.molcatb.2016.04.002

Gene cloning, expression and characterization of a novel cold-adapted protease from Planococcus sp

Zhang, H. et al.,
Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, College of Bioengineering, Tianjin University of Science & Technology, Tianjin 300457, PR China

... The sequence assembly was performed using the Vector NTI software (Invitrogen). The promoter and RBS sites were predicted using the online software of BPROM (http://linux1.softberry.com/ berry.phtml). Alignments of multiple sequences were performed using ClustalX. ...


Microbial cell factories
2016, 15(1), 1. DOI: 10.1186/s12934-016-0448-0

Evaluation of novel inducible promoter/repressor systems for recombinant protein expression in Lactobacillus plantarum

Heiss, S. et al.,
Christian Doppler Laboratory for Genetically Engineered Lactic Acid Bacteria, Department of Biotechnology, University of Natural Resources and Life Sciences

... codon. The ?35 and ?10 promoter region were identified (SoftBerry, BPROM) and are underlined. Primer binding sites for negative controls (for construction of negative controls without promoter) are underlined in dashed line. ...


PloS one
2016, 11(2), e0148221. http://dx.doi.org/10.1371/journal.pone.0148221

The Symbiotic Performance of Chickpea Rhizobia Can Be Improved by Additional Copies of the clpB Chaperone Gene

Paco, A., Brigido, C., Alexandre, A., Mateos, P. F., Oliveira, S.
ICAAM–Instituto de Ciencias Agrarias e Ambientais Mediterranicas (Laboratorio de Microbiologia do Solo), Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002–554, Evora, Portugal Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002–554, Evora, Portugal, IIFA–Instituto de Investigacao e Formacao Avancada, Universidade de Evora, Ap. 94, 7002–554, Evora, Portugal

... The identification of the putative promoter and terminator regions was previously performed using BPROM-Prediction of bacterial promoters software (http://www.softberry.com) and ARNold Finding Terminators at IGM—Web Server (http://rna.igmors.u-psud.fr/toolbox/arnold ...


PloS one
2016, 11(3), e0150234. http://dx.doi.org/10.1371/journal.pone.0150234

Characterization of salA, syrF, and syrG Genes and Attendant Regulatory Networks Involved in Plant Pathogenesis by Pseudomonas syringae pv. syringae B728a

Vaughn, V. L., Gross, D. C.
Department of Plant Pathology and Microbiology, Texas A&M University, College Station, Texas, United States of America

... Computer analysis. Nucleotide sequences that were 100-bp upstream of identified transcriptional start sites were analyzed using the Softberry Bprom algorithm (http://linux1.softberry.com/berry.phtml) to identify putative ? 70 -dependent promoters. ...


Frontiers in microbiology
2016, 7: 146. doi: 10.3389/fmicb.2016.00146

Characterization of Vibrio fluvialis qnrVC5 gene in native and heterologous hosts: Synergy of qnrVC5 with other determinants in conferring quinolone resistance

Vinothkumar, K., Kumar, G. N., Bhardwaj, A. K.
1Molecular Biology of Diseases, Department of Human Health and Diseases, School of Biological Sciences and Biotechnology, Indian Institute of Advanced Research, Gandhinagar, India 2Department of Bio-Chemistry, Faculty of Science, The Maharaja Sayajirao University of Baroda, Vadodara, India

... Softberry-BPROM, a promoter prediction tool was used to find the promoters and other regulatory elements in qnrVC5 gene cassette 3 . The structure of QnrVC5 was predicted by I-TASSER server using automated mode, as it employs hierarchical method for protein structure ...


PloS one
2016, 11(5), e0155397. http://dx.doi.org/10.1371/journal.pone.0155397

Regulation of Motility and Phenazine Pigment Production by FliA Is Cyclic-di-GMP Dependent in Pseudomonas aeruginosa PAO1

Lo, Y. L. et al.,
Institute of Molecular Medicine, National Tsing Hua University, Hsin Chu, Taiwan Molecular Infectious Disease Research Center, Division of Pediatric Infectious Diseases, Department of Pediatrics, Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Taoyuan, Taiwan

... Restriction sites and oligonucleotide primer sequences were identified using Vector NTI Advance ® software (Invitrogen). Promoter regions were predicted using BPROM software (Softberry, Inc). Flagellar observation through transmission electron microscopy. ...


BMC genomics
2016, 17:47. DOI: 10.1186/s12864-016-2376-0

Discovery and profiling of small RNAs responsive to stress conditions in the plant pathogen Pectobacterium atrosepticum

Kwenda, S. et al.,
Department of Microbiology and Plant Pathology, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria Kazan Institute of Biochemistry and Biophysics, Kazan Scientific Center, Russian Academy of Sciences Division of Plant Sciences, College of Life Sciences, University of Dundee (at The James Hutton Institute)

... and fundamental types of the detected 3? UTR sRNAs based on their biogenesis, we extracted each sRNA sequence plus 200 nt upstream of the start position of each sRNA and performed promoter predictions using BPROM program (http://?www.?softberry.?com/?berry ...


Journal of applied microbiology
2016, 120(1), 126-137. DOI: 10.1111/jam.12990

Catabolite responsive element deficiency of xyl operon resulting in carbon catabolite derepression in Lactobacillus fermentum 1001

Zhang, C., Guo, T., Xin, Y., Gao, X., Kong, J.
State Key Laboratory of Microbial Technology, Shandong University, Jinan, China

... Promter prediction was performed by the online available program neural network promoter prediction (http://www.fruitfly.org/seq_tools/promoter.html) and softberry bprom (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Biochemistry and Biophysics Reports
2016, 6, 124-134. doi:10.1016/j.bbrep.2016.03.012

Conformational features of the Staphylococcus aureus AgrA-promoter interactions rationalize quorum-sensing triggered gene expression

Rajasree, K., Fasim, A., Gopal, B.
Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560012, India

... the identification of the P1 promoter between the PvuII and RsaI restriction sites in the agr operon [3]. The region between these two restriction sites was used as an input sequence for the BPROM server, a web-based bacterial promoter prediction server, (Softberry, Inc., Mount ...


Frontiers in microbiology
2016, 7: 545. doi: 10.3389/fmicb.2016.00545

Genomics of three new bacteriophages useful in the biocontrol of Salmonella

Bardina, C. et al.,
Departament de Genetica i de Microbiologia, Molecular Microbiology, Universitat Autonoma de Barcelona, Barcelona, Spain

... Potential promoter regions and transcription terminators were predicted using the Softberry programs BProm (http://linux1.softberry.com/berry.phtml), FindTerm (Solovyev and Salamov, 2011), and TransTerm (Ermolaeva et al., 2000). ...


FEBS open bio
2015, 5, 813-823. doi:10.1016/j.fob.2015.09.004

House dust mites possess a polymorphic, single domain putative peptidoglycan d, l endopeptidase belonging to the NlpC/P60 Superfamily

Tang, V. H., Stewart, G. A., Chang, B. J.
Microbiology & Immunology, School of Pathology and Laboratory Medicine, The University of Western Australia, Crawley, WA, Australia

... sequences were analysed for the presence of prokaryotic promoters using the Neural Network Promoter Prediction (NNPP) program at the Berkeley Drosophila Genome Project (BDGP) (www.fruitfly.org/seq_tools/promoter.html) and the program Softberry BPROM (Softberry, Inc ...


Genetics and molecular research: GMR
2015, 14(1), 190. DOI http://dx.doi.org/10.4238/2015.January.16.2

Bioinformatic analysis of phage AB3, a phiKMV-like virus infecting Acinetobacter baumannii

Zhang, J., Liu, X., Li, X. J.
1Department of Geriatrics Medicine, The Third People’s Hospital of Chongqing, Chongqing, China 2Department of General Internal Medicine, The First Brand, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China

... Transcription terminators in the phage AB3 genome were predicted using the FindTerm program available from Softberry and promoters in the phage AB3 genome were predicted using the BPROM program on the Softberry website (linux1. softberry.com/berry.phtml). ...


Journal of bacteriology
2015, 197(2), 354-361. 4doi: 10.1128/JB.01948-14

The Putative Eukaryote-Like O-GlcNAc Transferase of the Cyanobacterium Synechococcus elongatus PCC 7942 Hydrolyzes UDP-GlcNAc and Is Involved in Multiple Cellular Processes

Sokol, K. A., Olszewski, N. E.
aDepartment of Genetics, Cell Biology, and Development, University of Minnesota, Saint Paul, Minnesota, USA bDepartment of Plant Biology, University of Minnesota, Saint Paul, Minnesota, USA

... two (NSII) of the ?ogt strain. The Softberry bacterial promoter prediction software BPROM (Softberry, Inc., Mount Kisco, NY) predicts that the SeOGT promoter is 293 bp upstream of the start codon. Wild-type SeOGT with 697 ...


PloS one
2015, 10(7), e0131676. DOI: 10.1371/journal.pone.0131676

Structure and Assembly of TP901-1 Virion Unveiled by Mutagenesis

Stockdale et al.,
School of Microbiology, University College Cork, Western Road, Cork, Ireland Department of Food Biosciences, Teagasc Food Research Centre, Moorepark, Fermoy, Co. Cork, Ireland

... BLAST, Pfam and HHpred analyses were used for functional annotations of proteins [61–64]. Putative promoter sequences of NZ9000 prophage t712 were identified using SoftBerry BPROM (http://www.softberry.com). Significant ...


PloS one
2015, 10(1). DOI: 10.1371/journal.pone.0116611

Genetic Acquisition of NDM Gene Offers Sustainability among Clinical Isolates of Pseudomonas aeruginosa in Clinical Settings

Mishra et al.,
Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, 221005, India Department of Biotechnology and Bioinformatics, North Eastern Hill University, Shillong, Meghalaya, India

... (http://www.ncbi.nlm.nih.gov/BLAST/). Further, promoter sites were also determined by using SoftBerry BPROM software (http://linux1.softberry.com/berry.phtml??topic=bprom&group= programs&subgroup=gfin?db). Results. Genetic context of bla NDM. ...


Journal of Applied Microbiology
2015 DOI: 10.1111/jam.13036

Occidiofungin is an Important Component Responsible for the Antifungal Activity of Burkholderia pyrrocinia Strain Lyc2

Wang, X. Q. et al.,
Department of Plant Pathology, College of Plant Protection, Shandong Agricultural University, Tai'an, Shandong, China Collaborative Innovation Centre for Annually High Yield and High Efficiency Production of Wheat and Corn, Shandong Agricultural University, Tai'an, Shandong, China

... Biosciences, Carlsbad, CA) and Geneious R8 (Biomatters Ltd.). Open reading frames (ORFs) and genes were predicted by the Softberry FGENESH program (Salamov and Solovyev ... prediction was accomplished using the web-based software BRROM in the Softberry Page 9. ...


International journal of bioinformatics research and applications
2015, 11(4), 347-365. DOI: http://dx.doi.org/10.1504/IJBRA.2015.070140

Opposite nucleotide usage biases in different parts of the Corynebacterium diphtheriae spaC gene

Khrustalev, V. V., Barkovsky, E. V., Kolodkina, V. L., & Khrustaleva, T. A.

... We used three methods for promoter prediction: the 'BPROM' available via the SoftBerry server (http://linux1.softberry.com); the 'NNPP' program (http://fruitfly.org/ seq_tools/promoter. html) (Reese, 2001); the 'PromPredict' (http://nucleix.mbu.iisc. ...


Infection and immunity
2015, 83(9), 3497-3505. doi: 10.1128/IAI.00597-15

Expression of the oligopeptide permease operon of Moraxella catarrhalis is regulated by temperature and nutrient availability

Jones, M. M., Murphy, T. F.
aDepartment of Microbiology and Immunology, University at Buffalo, The State University of New York, Buffalo, New York, USA bClinical and Translational Research Center, University at Buffalo, The State University of New York, Buffalo, New York, USA

... We identified a putative promoter region, using SoftBerry BPROM bacterial promoter prediction software (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup= gfindb), in the 204-bp intergenic region between oppF and oppA. ...


Gene
2015, 564(1), 81-86. doi:10.1016/j.gene.2015.03.044

Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC

Cerveau, N. et al.,
a Universite de Poitiers, UMR CNRS 7267 Ecologie et Biologie des Interactions, Equipe Ecologie Evolution Symbiose, 5 Rue Albert Turpin, 86073 Poitiers Cedex 9, France b Department of Biology, University of Copenhagen, 2200N Copenhagen, Denmark

... 2.2. Bioinformatics analyses. To identify ? 35/? 10 box promoters, the nucleotide sequence of each IS copy was analyzed using the BPROM software from the SoftBerry suite (http://linux1.softberry.com/berry.phtml?topic=bprom&gro.


PloS one
2015, 10(7), e0131695. DOI: 10.1371/journal.pone.0131695

Bioinformatic Analysis of Chlamydia trachomatis Polymorphic Membrane Proteins PmpE, PmpF, PmpG and PmpH as Potential Vaccine Antigens

Nunes, A., Gomes, J. P., Karunakaran, K. P., Brunham, R. C.
Bioinformatics Unit, Department of Infectious Diseases, National Institute of Health, Lisbon, Portugal Vaccine Research Laboratory, University of British Columbia Centre for Disease Control, Vancouver, Canada

... For each operon, in silico promoter predictions were made by using both the Neural Network Promoter Prediction (NNPP, http://www.fruitfly.org/seq_tools/promoter.html) and the BPROM software (Softberry, http://linux1.softberry.com/berry.phtml?topic=bprom&group ...


Journal of microbiological methods, 118, 75-77.
2015, 118, 75-77. doi:10.1016/j.mimet.2015.08.016

An improved Tn7-lux reporter for broad host range, chromosomally-integrated promoter fusions in Gram-negative bacteria

Glassing, A., Lewis, T. A.
Department of Biological and Physical Sciences, Montana State University Billings, Billings, MT 59101, United States

... A scan of that sequence using a bacterial promoter-finding software (BPROM, Softberry, Inc.) found a potential promoter within that region (nt 2338 of GenBank accession #AY962893.1). We attempted cloning of bacterial promoters into pUC18-mini-Tn7T-Gm-lux using an XcmI ...


Bone & Joint Journal Orthopaedic Proceedings Supplement
2015, 97(SUPP 15), 38-38

THE STRUCTURE AND THE ROLE OF SDR REGION OF STAPHYLOCOCCUS AUREUS GENE IN BONE INFECTIONS

Sitkiewicz, I., Babiak, I.
1Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Warsaw, Poland 2Department of Orthopedics and Traumatology, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcriptional organization of the sdr region was detected using BPROM and FGENESB algorithms (www.softberry.com) based on region 611262bp- 623152bp (GeneBank number CP000730.1) of the Staphylococcus aureus subsp. ...


Food Science and Biotechnology
2015, 24(5), 1749-1753. DOI: 10.1007/s10068-015-0227-4

Prediction and identification of an acid-inducible promoter from Lactococcus lactis ssp. cremoris MG1363

Yu, H. et al.,
1. Laboratory of Food Safety and Molecular Biology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing, 100083, China 2. The Supervision, Inspection & Testing Center of Genetically Modified Organisms, Ministry of Agriculture, Beijing, 100083, China

... cremoris MG1363 (16). In addition, the online promoter prediction tools: Neural Network Promoter Prediction (http:// www.fruitfly.org/seq tools/promoter.html) and SofeBerry (http:// linux1.softberry. com/berry.phtml?topic=bprom&group=programs& subgroup=gfindb) were used. ...


FEMS microbiology letters
2014, 353(2), 98-105. DOI:10.1111/1574-6968.12411

The pqqC gene is essential for antifungal activity of Pseudomonas kilonensis JX22 against Fusarium oxysporum f. sp. lycopersici

Xu, J. et al.,
1 Key Laboratory of Control Technology and Standard for Agro-product Safety and Quality, Ministry of Agriculture/Jiangsu Academy of Agricultural Sciences, Nanjing, China 2 Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Mississippi State, MS, USA

... Promoter prediction was conducted using the web-based software bprom in the Softberry package (Solovyev & Salamov, 2011). Illumina sequencing was used to determine the pqq gene cluster of P. kilonensis JX22, as described previously (Jalan et al., 2011). ...


Microbiology
2014, 160(Pt 1), 102-112. DOI:10.1099/mic.0.070664-0

OxyR-dependent expression of a novel glutathione S-transferase (Abgst01) gene in Acinetobacter baumannii DS002 and its role in biotransformation of organophosphate insecticides

Longkumer, T., Parthasarathy, S., Vemuri, S. G., Siddavattam, D.
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad 500 046, India

... ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) was used to predict ORFs and bprom software (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb) was used for promoter predictions. ...


ACS synthetic biology
April 4, 2014 DOI:10.1021/sb4001189

A synthetic anhydrotetracycline-controllable gene expression system in Ralstonia eutropha H16

Li H., Liao J. C.
†Department of Chemical and Biomolecular Engineering, ‡The Molecular Biology Institute, §Department of Chemistry & Biochemistry, Institute of Genomics and Proteomics, University of California, Los Angeles, California 90095, United States

... Using the bioinformatic tool (BPROM, Softberry), we identified the putative ?10 and ?35 elements of the P rrsC and the transcriptional start site (Figure 1A). There are two different tetO operators (tetO1 and tetO2) that can both be recognized by the tetR repressor.(13) We took a ...


Annals of Microbiology
2014, 64(2), 809-814. DOI: 10.1007/s13213-013-0717-7

Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage

Fu, Y., Zhai, Z., An, H., Hao, Y.
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China

... DNASTAR software package was employed to detect direct and inverted repeats. Putative promoter and terminator predictions were analyzed with BPROM and FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...


International journal of food microbiology
2014, 177, 89-97. DOI: 10.1016/j.ijfoodmicro.2014.02.011

Response of S. thermophilus LMD-9 to bacitracin: Involvement of a BceRS/AB-like module and of the rhamnose–glucose polysaccharide synthesis pathway

Thevenard B. et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France

... The presence of putative promoters, terminators, and operons was evaluated using BPROM (http://linux1.softberry.com/berry.phtml), BDGP (http://www.fruitfly.org/seq_tools/promoter.html), FINDTERM (http://linux1.softberry.com/berry.phtml), TranstermHP (http://transterm.cbcb ...


Microbiology
2014, 160(Pt 2), 406-417. DOI: 10.1099/mic.0.074773-0

Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors, and its expression is controlled by NtrC and PhoB acting at two interspaced promoters

Gallarato L. A. et al.,
1Departamento de Biologia Molecular, FCEFQyN, Universidad Nacional de Rio Cuarto, Ruta 36-Km 601, (5800) Rio Cuarto, Cordoba, Argentina 2Departamento de Ingenieria Celular y Biocatalisis, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos 62210, Mexico

... 1999). prodoric was used to determine the integration host factor (IHF) consensus (Munch et al., 2003). The bprom tool from the SoftBerry server (http://linux1.softberry. com) was used to identify ? 70 -dependent promoters. NtrC ...


PloS one
2014, 9(2), e90087. DOI: 10.1371/journal.pone.0090087

New Hydrocarbon Degradation Pathways in the Microbial Metagenome from Brazilian Petroleum Reservoirs

Sierra-Garcia I. N. et al.,
Microbial Resources Division, Research Center for Chemistry, Biology and Agriculture (CPQBA), University of Campinas - UNICAMP, Campinas, Brazil Laboratory of Genomics and Expression, University of Campinas - UNICAMP, Campinas, Brazil

... several tools available for gene prediction in prokaryotes through heuristic approaches: Metagene [14] http://metagene.cb.ku-tokyo.ac.jp/) and MetaGeneMark [15] designed for metagenomic sequences, GLIMMER 3.02 [16], [17] and FGENESB (http://linux1.softberry.com/berry ... ...Putative ribosomal binding sites were identified using RBSFINDER [22], and the presence of bacterial promoters and transfer RNA genes was predicted using the programs BPROM (http://linux1.softberry.com/berry.phtml) and tRNAscan-SE [23], respectively. ...


Plasmid
Volume 74, July 2014, Pages 32–38 DOI: 10.1016/j.plasmid.2014.05.003

Construction of a Novel Inducible Expression Vector for Lactococcus lactis M4 and Lactobacillus plantarum Pa21.

Maidin M. S. T. et al.,
a Department of Cell and Molecular Biology, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia b Department of Microbiology, Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia

... The potential Pribnow box and -35 site of P hsp were predicted with BPROM (Softberry, USA), an online bacterial ? 70 promoter (major E. coli promoter class) recognition program with about 80% accuracy and specificity that can be accessed freely at (http://linux1.softberry.com ...


Journal of proteomics
2014, 108, 78-88. DOI: 10.1016/j.jprot.2014.05.005

Phosphate regulated proteins of Xanthomonas citri subsp. citri: A proteomic approach

Pegos, V. R., Nascimento, J. F., Sobreira, T. J. P., Pauletti, B. A., Paes-Leme, A., & Balan, A.
a Laboratorio Nacional de Biociencias — LNBio, Centro de Pesquisas em Energia e Materiais — CNPEM, Campinas, SP, Brazil b Universidade Estadual de Campinas — UNICAMP, Instituto de Biologia, Campinas, SP, Brazil

... the promoter regions of the X. citri Pho regulon genes, we submitted a sequence of 100 nucleotides upstream of the start codon of isolated genes or from the first gene belonging to an operon, to the bacterial promoter prediction programme BPROM from the SoftBerry server (http ...


PloS one
2014, 9(3), e90603. Volume DOI: 10.1371/journal.pone.0090603

Analysis of the Promoters Involved in Enterocin AS-48 Expression

Cebrian R et al.,
Departamento de Microbiologia, Facultad de Ciencias, Universidad de Granada, Granada, Spain

... as-48 or bac regions (GenBank KJ146793 and Y12234.1, and D85752.1, respectively [9], [6]) were analysed with the bioinformatic programs Promoter Prediction by Neural Network (NNPP) [31] (http://s.fruitfly.org/seq_tools/promoter?.html) and BPROM (Softberry Inc., Mount ...


Nature communications
2014 , 5. Article number: 4076 DOI: 10.1038/ncomms5076

Adaptive synonymous mutations in an experimentally evolved Pseudomonas fluorescens population

Bailey, S. F., Hinz, A., Kassen, R.
Department of Biology, University of Ottawa, Ottawa, Ontario, Canada K1N 6N5

... Bent arrows indicate promoters predicted by the Softberry BPROM program ( http://linux1.softberry.com/berry.phtml). ...


Microbiology
February 2013 vol. 159 no. Pt 2 230-242 DOI:10.1099/mic.0.061614-0

A CsrA/RsmA translational regulator gene encoded in the replication region of a Sinorhizobium meliloti cryptic plasmid complements Pseudomonas fluorescens rsmA/E mutants

Betina Agaras †, Patricio Sobrero † and Claudio Valverde
Laboratorio de Bioquimica, Microbiologia e Interacciones Biologicas en el Suelo, Departamento de Ciencia y Tecnologia, Universidad Nacional de Quilmes, Roque Saenz Pena 352 – Bernal B1876BXD – Buenos Aires, Argentina

... The rsmA Sm coding sequence is shaded in dark grey. The sequence of the divergently encoded ORF II gene is shaded in light grey. Putative ? 70 -dependent promoters (boxed) were identified via the Softberry Bprom algorithm (http://linux1.softberry.com/berry.phtml). ...


PLOS ONE
February 08, 2013DOI: 10.1371/journal.pone.0056321

Generation of an Artificial Double Promoter for Protein Expression in Bacillus subtilis through a Promoter Trap System

Yang et al.,
College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi Province, People's Republic of China Department of Animal Science, McGill University, Quebec, Canada

... The sequence analysis was performed online with NCBI blast 2.0 (www.ebi.ac.uk); promoter region was predicted by the BPROM program (Softberry Inc., Mount Kisco, NY, USA; http://linux1.softberry.com). Sub-cloning of promoter regions. ...


Microbiology
January 2013 vol. 159 no. Pt 1 96-106 DOI:10.1099/mic.0.062349-0

Transcriptional regulation of the Rhodobacter capsulatus response regulator CtrA

Molly M. Leung †, Cedric A. Brimacombe and J. Thomas Beatty
Department of Microbiology and Immunology, The University of British Columbia, 2350 Health Sciences Mall, Vancouver, BC V6T 1Z3, Canada

... Promoter sequence analysis, RNA 5?end-mapping and ?-galactosidase assays. Analysis of sequences for putative promoter –10 and –35 sites was done using the Softberry bacterial promoter prediction computer program BPROM (http://www.softberry.com/all.htm). ...


PloS one
February 13, 2013DOI: 10.1371/journal.pone.0056063

A Two-Component System (XydS/R) Controls the Expression of Genes Encoding CBM6-Containing Proteins in Response to Straw in Clostridium cellulolyticum

Celik et al.,
Aix-Marseille Universite, CNRS, UMR7283, Marseille, France Institut fur Mikrobiologie, Ernst-Moritz-Arndt Universitat, Greifswald, Germany

... D) Genetic organization of xydS/R and xyl-doc genes as in (A) with schematic localizations of promoters (thin arrow) and terminators (stem-loop) predicted by BPROM and FindTerm programs (http://linux1.softberry.com). doi:10.1371/journal.pone.0056063.g001. ...


F1000Research
2013, 2:99 (doi: 10.12688/f1000research.2-99.v1

Polycistronic transcription of fused cassettes and identification of translation initiation signals in an unusual gene cassette array from Pseudomonas aeruginosa [v1; ref status: approved with reservations 2, http://f1000r.es/p3]

Erica L Fonseca, Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, Rio de Janeiro, 4365, Brazil - See more at: http://f1000research.com/articles/2-99#sthash.epID3u3g.dpuf

... The 5'UTR from gcu14 were submitted to the promoter predictor programs Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/ index.html) and BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml). ...


PloS one
October 16, 2013 DOI: 10.1371/journal.pone.0076685

The Global Anaerobic Regulator Anr, Is Involved in Cell Attachment and Aggregation Influencing the First Stages of Biofilm Development in Pseudomonas extremaustralis

Paula M. Tribelli, Anthony G. Hay, Nancy I. Lopez
IQUIBICEN-CONICET and Dpto. de Quimica Biologica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina Department of Microbiology, Cornell University, Ithaca, New York, United States of America

... support [37], and in an intergenic genomic zone. Putative ? 70 dependent promoters were identified using the Softberry Bprom algorithm (http://linux1.softberry.com/berry. phtml). Sequence logos was performed using 5 Anr-boxes ...


Microbiology
September 2013 vol. 159 no. Pt 9 1911-1919 DOI: 10.1099/mic.0.064709-0

Identification and characterization of biofilm formation-defective mutants of Xanthomonas citri subsp. citri

Malamud et al.,
1Instituto de Ciencia y Tecnologia Dr Cesar Milstein, Fundacion Pablo Cassara, CONICET, Saladillo 2468, C1440FFX Ciudad de Buenos Aires, Argentina 2Embrapa Recursos Geneticos e Biotecnologia and Centro APTA Citros Sylvio Moreira, Instituto Agronomico de Campinas, Cordeiropolis, Sao Pablo, Brazil

... Tn5. An analysis was performed for each mutant, taking into account the relative position of the transposon and the presence of promoter regions predicted by BProm (Softberry, http://linux1.softberry.com/berry.phtml) (Fig. S2 ...


Microbiology
November 2013 mic.0.074773-0 DOI:10.1099/mic.0.074773-0

Exopolyphosphatase of Pseudomonas aeruginosa is essential for the production of virulence factors and its expression is controlled by NtrC and PhoB, acting at two interspaced promoters.

Gallarato et al.,
1 Dep Biologia Molecular, FCEFQyN, Universidad Nacional de Rio Cuarto; 2 Dep Ingenieria Celular y Biocatalisis, Inst Biotecnologia, UNAM, Cuernavaca

... PRODORIC was used to determine the Integration 182 Host Factor (IHF) consensus (Munch et al., 2003). The BPROM tool from the SoftBerry server 183 (http://linux1.softberry.com) was used to identify ?70-dependent promoters. NtrC and PhoB 184 ...


Antimicrob. Agents Chemother.
July 2013 vol. 57 no. 7 3430-3433 DOI:10.1128/AAC.00515-13

SatR Is a Repressor of Fluoroquinolone Efflux Pump SatAB

Escudero et al.,
Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Madrid, Spaina Centro de Vigilancia Sanitaria Veterinaria (VISAVET), Universidad Complutense de Madrid, Madrid, Spainb

... Positive results were obtained for both strains, proving that satR is part of the satRAB operon (data not shown). Upstream from satRAB, we found two 9-bp pseudopalindromic regions overlapping the predicted ?10 box (BPROM software; Softberry) (Fig. ...


Archives of Virology
Volume 158, Issue 11 , pp 2409-2413 DOI:10.1007/s00705-013-1726-3

Genome sequence analysis of the Vibrio parahaemolyticus lytic bacteriophage VPMS1

Martin Ramirez-Orozco, Vania Serrano-Pinto, Norma Ochoa-Alvarez, Roman Makarov, Sergio F. Martinez-Diaz
1. Centro de Investigaciones Biologicas del Noroeste (CIBNOR), Instituto Politecnico Nacional, 195, Col. Playa Palo de Santa Rita Sur, 23096, La Paz, B.C.S, Mexico 2. Centro Interdisciplinario de Ciencias Marinas-IPN (CICIMAR), Av. Instituto Politecnico Nacional, s/n Col. Playa Palo de Santa Rita, 23096, La Paz, B.C.S, Mexico

... results were visually inspected. Results were taken as significant when e-values were under 0.01. Promoter candidates were determined using the BPROM 0.3.2 software (Softberry, Mount Kisco, NY). A CD search to identify ...


BMC Biotechnol.
2013; 13: 25. DOI: 10.1186/1472-6750-13-25

Development of a Fur-dependent and tightly regulated expression system in Escherichia coli for toxic protein synthesis

Lingyu Guan, 1 Qin Liu, 1 Chao Li,1 and Yuanxing Zhang 1
1State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, P. R. China

... Its characteristic regions were demonstrated as the same result by three online promoter prediction tools-Softberry, BDGP and SCOPE. ... PfhuA characteristic regions were predicted by online tools: BPROM-bacterial promoter prediction program from Softberry ...


Tuberculosis
Volume 93, Issue 4, July 2013, Pages 389–397 DOI:10.1016/j.tube.2013.03.007

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis

Rathor et al.,
a Department of Microbiology, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi 110007, India b Medicinal Chemistry Division, Dr B.R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi 110007, India

... (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). To know fidelity of these softwares, known promoter sequences of purC (Rv0780), katG (Rv1908c), rpsl (Rv0682) and recA (Rv2737c) genes of M. tuberculosis were also analyzed. ...


Annals of Microbiology
August 2013 DOI:10.1007/s13213-013-0717-7

Characterization of the cryptic plasmid pWCZ from Lactobacillus paracasei WCZ isolated from silage

Yezhi Fu, Zhengyuan Zhai, Haoran An, Yanling Hao
1. Key Laboratory of Functional Dairy, College of Food Science and Nutritional Engineering, China Agricultural University, 17 Qing Hua East Road, Hai Dian District, Beijing, 100083, China

... DNASTAR software package was employed to detect direct and inverted repeats. Putative promoter and terminator predictions were analyzed with BPROM and FindTerm, respectively (http://linux1.softberry.com/berry.phtml). ...


Biochemical and Biophysical Research Communications
Volume 435, Issue 1, 24 May 2013, Pages 28–33 DOI:10.1016/j.bbrc.2013.04.017

Structural and genomic DNA analysis of a putative transcription factor SCO5550 from Streptomyces coelicolor A3(2): Regulating the expression of gene sco5551 as a transcriptional activator with a novel dimer shape

Hayashi et al.,
a Department of Food and Fermentation Science, Faculty of Food and Nutrition, Beppu University, Beppu 874-8501, Japan b Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810, Japan c Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Sapporo 062-8517, Japan

... 4A. The translational start site, putative ribosomal binding site (RBS), putative –10, and –35 promoter elements of the sco5550 and sco5551 were found using the bacterial promoter predictor BPROM program (SoftBerry, Mt. ...


J. Bacteriol. December
2013 vol. 195 no. 23 5370-5380 DOI:10.1128/JB.00615-13

The sll1951 Gene Encodes the Surface Layer Protein of Synechocystis sp. Strain PCC 6803

Christoph Trautner and Wim F. J. Vermaas
School of Life Sciences, Arizona State University, Tempe, Arizona, USA

... A possible ribosome-binding site (AGGAG) is located at bp ?19 from the start codon, whereas the most probable ?10 and ?35 transcriptional signals, as predicted via BPROM (Softberry Inc., Mount Kisco, NY), appear to be distant at positions ?95 (TGCTATGAT) and ?114 ...


Appl. Environ. Microbiol.
February 2013 vol. 79 no. 4 1150-1159 DOI:10.1128/AEM.03556-12

Genomic Plasticity Enables a Secondary Electron Transport Pathway in Shewanella oneidensis

M. Schicklberger, G. Sturm and J. Gescher
Institute for Applied Biosciences (IAB), Department of Applied Biology, Karlsruhe Institute of Technology (KIT), Karlsruhe, Germany

... (35). Promoter prediction.The BPROM bacterial promoter predictor was used to identify entire (?35/?10) putative promoter regions (SoftBerry, Mt. Kisco, NY). ... Analysis of the hybrid region by use of bioinformatic tools (BPROM; SoftBerry, Mt. ...


PloS one
October 07, 2013DOI: 10.1371/journal.pone.0076630

Evolutionary Insight into the Functional Amyloids of the Pseudomonads

Morten S. Dueholm, Daniel Otzen, Per Halkj?r Nielsen
Department of Biotechnology, Chemistry and Environmental Engineering, Aalborg University, Aarhus, Denmark Interdisciplinary Nanoscience Center (iNANO), Centre for Insoluble Protein Structures (inSPIN), Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark

... to fapF. A promoter region containing -35 and -10 regions could be identified in front of the lone fapF in Chromobacterium using the prokaryotic promoter prediction tool Softberry-BPROM (http://linux1.softberry.com). No promoter ...


Biotechnology Letters
Volume 35, Issue 8 , pp 1331-1337 DOI:10.1007/s10529-013-1209-3

Expression of mosquito-larvicidal toxin genes under the control of a native promoter in Enterobacter amnigenus An11

Wachiraporn Toopaang, Boonsri Jongsareejit, Sumarin Soonsanga, Boonhiang Promdonkoy
1. Department of Microbiology, Faculty of Science, Silpakorn University, Nakhon Pathom, 73000, Thailand 2. National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, 113 Pahonyothin Road, Khlong Nueng, Khlong Luang, Pathum Thani, 12120, Thailand

... Promoter sequence of the inserted fragment was analyzed using BPROM (http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/ promoter.html) programs. Measurement of GFP intensity. Enterobacter ...


PLoS Pathog
2013 June; 9(6): e1003428. DOI:10.1371/journal.ppat.1003428

A Novel Two-Component Signaling System Facilitates Uropathogenic Escherichia coli's Ability to Exploit Abundant Host Metabolites

Cai et al.,
1Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, Iowa, United States of America 2Laboratory Animal Resources, College of Veterinary Medicine, Iowa State University, Ames, Iowa, United States of America

... The promoter regions of c5032 and c5038 were predicted by BProm program (http://linux1.softberry.com) [45]. . ...


Extremophiles
Volume 17, Issue 5 , pp 809-819 DOI:10.1007/s00792-013-0562-4

Characterization of a cold-adapted and salt-tolerant esterase from a psychrotrophic bacterium Psychrobacter pacificensis

Guojie Wu, Gaobing Wu, Tao Zhan, Zongze Shao, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China 2. College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml), amino acid alignments by BLASTP (http://www.ncbi.nlm.nih.gov/), and Signal peptide by the SignaIP 4.0 ...


American Journal of Bioinformatics Research
2013; 3(2): 11-20 doi:10.5923/j.bioinformatics.20130302.01

nsilico Analysis of Novel hipAB, ccdBA, and yoeB-yefM Toxin-Antitoxin Homolog’s from the Genome of Xenorhabdus nematophila

Jitendra Singh Rathore, Mahendra Pal Singh, Pradeep Gautam
School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, 201308, India

... 2.5. Promoter Analysis. Identification of putative pro- moters associated with ORFs was determined by software BPROM (www.softberry.com). 2.6. Genomic DNA Isolation. X. nematophila culture was inoculated from glycerol stock in 50 ml and grown overnight at 28?, 200 rpm. ...


Microbiology
May 2013 mic.0.066332-0 DOI:10.1099/mic.0.066332-0

A modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius

Jeremy Bartosiak-Jentys, Ali H. Hussein, Claire J. Lewis and David J. Leak1
University of Bath

... 113 A 293nt DNA fragment containing the cellobiose specific phosphotransferase system operon's 114 promoter sequence (P?glu), predicted using BPROM software (SoftBerry), was amplified using primers 115 SalI_P?glu_F and XmaI_ClaI_P?glu_R. ...


Biochemical Genetics
Volume 51, Issue 9-10 , pp 766-779 DOI:10.1007/s10528-013-9605-x

Molecular Characterization of a Fungicidal Endoglucanase from the Cyanobacterium Calothrix elenkinii

Chitra Natarajan, Vishal Gupta, Kanika Kumar, Radha Prasanna
1. Division of Microbiology, Indian Agricultural Research Institute, New Delhi, 110012, India 3. Centre for Cellular and Molecular Biology (CCMB), Council of Scientific and Industrial Research (CSIR), Hyderabad, 500007, Andhra Pradesh, India 2. National Research Centre for Plant Biotechnology, IARI, New Delhi, 110012, India

... For each sequence, SignalP-HMM reports the overall signal peptide probability, equal to the posterior probability of signal peptide (S) for position 1. The bacterial promoter prediction program BPROM (http://linux1.softberry.com/berry.html) was used to identify the position of the ...


Journal of Molecular Catalysis B: Enzymatic
Volume 98, 30 December 2013, Pages 119–126 DOI:10.1016/j.molcatb.2013.10.012

A novel esterase from a psychrotrophic bacterium Psychrobacter celer 3Pb1 showed cold-adaptation and salt-tolerance

Guojie Wu a, Shuo Zhang a, Houjin Zhang b, Shanshan Zhang a, Ziduo Liu a,
a State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan 430070, PR China b School of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430070, PR China

... of the esterase-encoding gene, est12, was carried out by Basic Local Alignment Search Tool (BLAST) program on the NCBI online database (http://www.ncbi.nlm.nih.gov), and the promoter region was analyzed by FGENSB and BPROM (http://linux1.softberry.com/berry.phtml ...


DNA Res
(2013) doi: 10.1093/dnares/dst050 First published online: November 25, 2013

Global Transcriptional Response to Heat Shock of the Legume Symbiont Mesorhizobium loti MAFF303099 Comprises Extensive Gene Downregulation

Ana Alexandre 1,2, Marta Laranjo 1,2 and Solange Oliveira 1
1ICAAM – Instituto de Ciencias Agrarias e Ambientais Mediterranicas (Laboratorio de Microbiologia do Solo), Universidade de Evora, Nucleo da Mitra, Ap. 94, 7002-554 Evora, Portugal 2IIFA – Instituto de Investigacao e Formacao Avancada, Universidade de Evora, Ap. 94, 7002-554 Evora, Portugal

... MicrobesOnline Operon Predictions (www.micro-besonline.org/operons/) was used for operon prediction. 36 The identification of putative promoter sequences was performed using BPROM-Prediction of bacterial promoters software (www.softberry.com). ...


J. Bacteriol.
September 2013 vol. 195 no. 18 4264-4273 DOI:10.1128/JB.00471-13

Gene Content and Diversity of the Loci Encoding Biosynthesis of Capsular Polysaccharides of the 15 Serovar Reference Strains of Haemophilus parasuis

Howell et al.,
Department of Veterinary Medicine, University of Cambridge, Cambridge, United Kingdoma The Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, United Kingdomb

... Each capsule locus was analyzed for the presence of promoters using BPROM (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), where the top scores were found and mapped to within 150 bp preceding the start codon of each CDS of ...


Russian Journal of Genetics
Volume 49, Issue 5 , pp 477-486 DOI:10.1134/S1022795413050116

Organization and maintenance features of IncP-7 naphthalene degradation plasmid pFME5 basic replicon

O. V. Volkova, I. A. Kosheleva, A. M. Boronin
19806. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences, Pushchino, 142290, Russia 29806. Pushchino State Educational Institute of Natural Sciences, Pushchino, 142290, Russia

... substituted nucleotides are underlined. Page 4. 480 RUSSIAN JOURNAL OF GENETICS Vol. 49 No. 5 2013 VOLKOVA et al. SOSUI, and BPROM (Softberry) software available online. RESULTS AND DISCUSSION pFME5 Basic ...


PloS one
January 28, 2013DOI: 10.1371/journal.pone.0054479

A Non-Classical LysR-Type Transcriptional Regulator PA2206 Is Required for an Effective Oxidative Stress Response in Pseudomonas aeruginosa

F. Jerry Reen, Jill M. Haynes, Marlies J. Mooij, Fergal O'Gara
BIOMERIT Research Centre, Department of Microbiology, University College Cork, Cork, Ireland

... Genome sequences were obtained from the www.pseudomonas.com resource [24] and compared using the ARTEMIS Comparison Tool on the www.webact.org site [25]. Promoter predictions were performed using BProm software on the http://linux1.softberry.com site. ...


mBio
doi: 10.1128/mBio.00366-13 27 August 2013 vol. 4 no. 5 e00366-13

Vibrio cholerae ToxR Downregulates Virulence Factor Production in Response to Cyclo(Phe-Pro)

X. Renee Bina, Dawn L. Taylor, Amit Vikram, Vanessa M. Ante, James E. Bina
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA

... encoding a hypothetical protein. Analysis of the leuO locus using BPROM promoter prediction software (http://www.softberry.com) indicated the presence of a single promoter upstream of VC2486. Consistent with this, VC2486 ...


Genome Biol Evol
(2013) 5 (2): 418-438. doi: 10.1093/gbe/evt008

Strikingly Bacteria-Like and Gene-Rich Mitochondrial Genomes throughout Jakobid Protists

Gertraud Burger 1,*, Michael W. Gray 2, Lise Forget 1 and B. Franz Lang 1
1Department of Biochemistry, Robert-Cedergren Center in Bioinformatics and Genomics, Universite de Montreal, Montreal, Quebec, Canada 2Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada

... Potential bacteria-like promoters were predicted with BPROM (http://linux1.softberry.com), which was chosen among various public web-accessible predictors, because it yields for jakobid mtDNAs a reasonable number (in the order of 200) of potential sites per genome, instead ...


PloS one
October 21, 2013DOI: 10.1371/journal.pone.0076030

Divergent Control of Two Type VI Secretion Systems by RpoN in Pseudomonas aeruginosa

Thibault G. Sana, Chantal Soscia, Celine M. Tonglet, Steve Garvis, Sophie Bleves
Laboratoire d’Ingenierie des Systemes Macromoleculaires (UMR7255), CNRS & Aix-Marseille Univ, Marseille, France

... 2C). The BProm algorithm identified one ? 70 dependent promoter upstream of the lip3 gene and another, in the opposite direction, upstream of the hsiB3 gene (http://linux1.softberry.com/ berry.phtml??topic=bprom&group=programs&subgroup=gfin?db) (Fig. 2C). ...


BMC Genomics
2013, 14:73 doi:10.1186/1471-2164-14-73

Genomic analysis of the regulatory elements and links with intrinsic DNA structural properties in the shrunken genome of Buchnera

Lilia Brinza 123, Federica Calevro 1 and Hubert Charles 12
1 UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, INSA-Lyon, INRA, Universite de Lyon, Villeurbanne, France 2 BAMBOO, INRIA Rhone-Alpes, Montbonnot Saint-Martin, France 3 Present address: Universite de Lyon, Universite Lyon1, CNRS, UMR 5558, Laboratoire de Biometrie et Biologie Evolutive, Lyon, France

... Promoters and transcription starts were predicted, in the four Buchnera strains, using the software BPROM © (http://linux1.softberry.com/berry.phtml webcite) and MacVector (MacVector, Cary, NC, USA) for ? 70 and ? 32 promoters, respectively. ...


Microbiology
June 2013 vol. 159 no. Pt 6 1097-1108 DOI:10.1099/mic.0.065763-0

Identification of multiple putative S-layer genes partly expressed by Lysinibacillus sphaericus JG-B53

Lederer et al.,
1Helmholtz-Institute Freiberg for Resource Technology, Helmholtz-Zentrum Dresden-Rossendorf, 01314 Dresden, Germany 2Institute of Resource Ecology, Helmholtz-Zentrum Dresden-Rossendorf, 01314 Dresden, Germany

... Miller, 1991). The analyses of the promoter regions were performed with the program BPROM (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb; Solovyev & Shahmuradov, 2003). The ...


Microbiology
April 2013 vol. 159 no. Pt 4 737-747 DOI:10.1099/mic.0.064782-0

Type 1 and type 2 strains of Mycoplasma pneumoniae form different biofilms

Simmons et al.,
1Department of Genetics, University of Alabama at Birmingham, Birmingham, AL 35294, USA 2Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA

... Artemis (version 14.0.0; Wellcome Trust Sanger Institute). Promoter sequences were analysed using bprom (Prediction of Bacterial Promoters; http://linux1.softberry.com). The genome reference sequences for M. pneumoniae ...


Appl. Environ. Microbiol.
June 2013 vol. 79 no. 11 3494-3502 DOI:10.1128/AEM.03693-12

Identification and Expression of Genes Involved in the Conversion of Daidzein and Genistein by the Equol-Forming Bacterium Slackia isoflavoniconvertens

Christine Schroder a, Anastasia Matthies a, Wolfram Engst b, Michael Blaut a and Annett Braune a
Department of Gastrointestinal Microbiologya Analytics Group,b German Institute of Human Nutrition Potsdam-Rehbruecke, Nuthetal, Germany

... blast). Searching for putative transcription promoter and terminator sequences was done using the Web-based programs BPROM (Softberry, Mount Kisco, NY) and ARNold (http://rna.igmors.u-psud.fr/toolbox/arnold), respectively. ...


J. Bacteriol.
April 2013 vol. 195 no. 7 1504-1514 DOI:10.1128/JB.01999-12

Identification of the Mutation Responsible for the Temperature-Sensitive Lipopolysaccharide O-Antigen Defect in the Pseudomonas aeruginosa Cystic Fibrosis Isolate 2192

Michael R. Davis Jr et al.,
aDepartment of Microbiology, Immunology, and Cancer Biology, University of Virginia Health Sciences Center, Charlottesville, Virginia, USA bComplex Carbohydrate Research Center, University of Georgia, Athens, Georgia, USA

... The deletion in this strain was verified by PCR and sequencing. Promoter identification.An approximately 1 kb sequence located directly 5? of the wbpM start codon was scanned for promoters by using the neural network promoter prediction program BPROM (Softberry). ...


PloS one
October 02, 2013DOI: 10.1371/journal.pone.0076198

Pseudomonas putida AlkA and AlkB Proteins Comprise Different Defense Systems for the Repair of Alkylation Damage to DNA – In Vivo, In Vitro, and In Silico Studies

Mielecki et al.,
Department of Molecular Biology, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland Department of Genetics, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia

... Also, the putative -35 and -10 boxes responsible for RNA polymerase interaction are marked in pink (retrieved from RegulonDB, http://regulondb.ccg.unam.mx) or grey (SoftBerry BPROM prediction tool, http://linux1.softberry.com). ...


Appl. Environ. Microbiol.
July 2013 vol. 79 no. 13 3967-3973 DOI:10.1128/AEM.00867-13

Biofilm Formation by Psychrobacter arcticus and the Role of a Large Adhesin in Attachment to Surfaces

Shannon M. Hinsa-Leasur a, Cassandra Koid a, James M. Tiedj b and Janna N. Schultzhaus a
Biology Department, Grinnell College, Grinnell, Iowa, USAa Center for Microbial Ecology, Michigan State University, East Lansing, Michigan, USAb

... with 64 bp separating the two genes. Based on results of the sequence analysis programs FGENESB and BPROM (SoftBerry), the Psyc_1602-encoding gene and cat1 reside in an operon. Located 379 bp downstream of cat1 ...


AEM
01197-13 DOI:10.1128/AEM.01197-13

Lytic infection of Lactococcus lactis by bacteriophages Tuc2009 and c2 trigger alternative transcriptional host responses

Stuart Ainsworth 1, Aldert Zomer 2, Jennifer Mahony 1 and Douwe van Sinderen 1, 3
1Department of Microbiology, University College Cork, Western Road, Cork, Ireland 2Centre for Molecular and Biomolecular Informatics, Nijmegen Centre for Molecular Life Sciences, Radboud University Medical Centre, Nijmegen 3Alimentary Pharmabiotic Centre, Biosciences Institute, University College Cork, Western Road, Cork, Ireland

... orf10. Analysis using BPROM 208 (http://www.softberry.com/berry.html) suggests a previously undetected promoter upstream of 209 orf10 (with proposed -35 and (extended) -10 sequences that correspond to ATGTAT and 210 ...


Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 113, Issue 3 , pp 387-396 DOI:10.1007/s11240-012-0278-7

Plant tissue-specific promoters can drive gene expression in Escherichia coli

Jopcik et al.,
1. Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, P.O. Box 39A, 950 07, Nitra, Slovak Republic 2. Animal Production Research Centre, 951 41, Nitra, Slovak Republic 3. Constantine the Philosopher University, 949 74, Nitra, Slovak Republic

... elements and are capable to trigger gene expression in E. coli, we analyzed the sequences of DNA fragments carrying the plant embryo- and/or pollen-specific promoters using the bacterial sigma70 promoter recognition program BPROM (http://linux1.softberry.com/berry.phtml ...


J. Basic Microbiol.
doi: 10.1002/jobm.201300037

Multiple pqqA genes respond differently to environment and one contributes dominantly to pyrroloquinoline quinone synthesis.

Ge et al.,
1Laboratory of Microorganism Engineering, Beijing Institute of Biotechnology, Beijing, China 2School of Life Science and Biochemical Pharmaceutical, Shenyang Pharmaceutical University, Shenyang, China

... S2c), indicating that the transcriptional regulation events of these five genes were likely to be different. A high-score of putative prokaryotic promoter and regulation elements were predicted upstream of the coding sequence of ppqA2 by BProm software (www.softberry.com). ...


World Journal of Microbiology and Biotechnology
Volume 29, Issue 11 , pp 2067-2076 DOI:10.1007/s11274-013-1370-9

Characterization of a serine hydroxymethyltransferase for l-serine enzymatic production from Pseudomonas plecoglossicida

Wei Jiang, Bingzhao Xia, Junjie Huang, Ziduo Liu
1. State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... 1 Phylogenetic tree of PplglyA. The immediate upstream sequence from the ORF was analyzed; the promoter of the glyA gene was predicated by the tool of the Prediction of bacterial promoters (BPROM, http://linux1.softberry.com); and the putative ?10 box (GGTTAGAAT, from ...


Plasmid
Volume 70, Issue 1, July 2013, Pages 52–60 DOI:10.1016/j.plasmid.2013.01.006

Role of plasmid- and chromosomally encoded Hha proteins in modulation of gene expression in E. coli O157:H7

Sonia Paytubi a, Manuela Dietric b, Mario H. Queiroz b, Antonio Juarez a, b
a Departament de Microbiologia, Facultat de Biologia, Universitat de Barcelona, Avda. Diagonal 643, 08028 Barcelona, Spain b Institut de Bioenginyeria de Catalunya (IBEC), Baldiri i Reixac 10-12, 08028 Barcelona, Spain

... Promoter region was analysed via the BPROM program developed by Softberry, which predicted two promoters for the hha pO157 gene (TTTTCA-15bp-TCGTAT and TGGAGA-17bp-TGGCAA) with the respective Pribnow boxes located at positions -243 and -36 relative to the ...


Molecular Plant Pathology
14: 119–130. February 2013 doi: 10.1111/j.1364-3703.2012.00835.x

The ESX/type VII secretion system modulates development, but not virulence, of the plant pathogen Streptomyces scabies

Fyans, J. K., Bignell, D., Loria, R., Toth, I. and Palmer, T.
1Division of Molecular Microbiology, College of Life Sciences, University of Dundee, Dundee, UK 2James Hutton Institute, Invergowrie, Dundee, UK

... carrying esxA and esxB, together with 225 base pairs upstream of esxA, which should cover the natural promoter region (predicted to lie approximately 100 base pairs upstream of the esxA start codon according to the bprom prediction program; http://linux1.softberry.com/berry ...


PloS one
October 25, 2013DOI: 10.1371/journal.pone.0076341

Utilisation of Mucin Glycans by the Human Gut Symbiont Ruminococcus gnavus Is Strain-Dependent

Crost et al.,
The Gut Health and Food Safety Institute Strategic Programme, Institute of Food Research, Norwich, United Kingdom Laboratoire de Chimie Bacterienne, Institut de Microbiologie de la Mediterranee, CNRS and Aix-Marseille University, Marseille, France

... Prediction of the promoters was performed using the BPROM program (http://linux1.softberry. com/berry.phtml??topic=bprom&group=programs&subgroup=gfin?db). Results. Comparative analysis of R. gnavus E1 and R. gnavus ATCC 29149 glycobiome. ...


RNA
2013. 19: 1341-1348 DOI:10.1261/rna.038794.113

S6:S18 ribosomal protein complex interacts with a structural motif present in its own mRNA

Matelska et al.,
1Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology, Warsaw, 02-109, Poland 2Bioinformatics Laboratory, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, Poznan, 61-614, Poland

... was analyzed. Full sequence alignment is available as Supplemental File 1. ? 70 promoters associated with the representative motifs (Fig. 2) were predicted with BPROM (http://linux1.softberry.com/berry.phtml). To estimate ...


ACS Synth. Biol.
2013, 2 (2), pp 111–120 DOI: 10.1021/sb300114d

Promoter Element Arising from the Fusion of Standard BioBrick Parts

Yao et al.,
†Department of Biomedical Engineering, ‡UC Davis Genome Center, and §Department of Computer Science, University of California Davis, One Shields Avenue, Davis, California 95616, United States Cellular and Molecular Biology Program, University of Michigan, 1011 North University Avenue, Ann Arbor, Michigan 48109, United States

... in silico methods for detecting pKAT or pKAT-like promoters, we examined the DNA sequence composed of 200 base pairs flanking either side of the barcode (for a 425 bp total sequence) in BBa_K327001 with the following algorithms: BPROM (http://www.softberry.com/berry ...


J. Bacteriol.
November 2013 vol. 195 no. 22 5025-5040 DOI:10.1128/JB.00669-13

Phosphate Concentration and the Putative Sensor Kinase Protein CckA Modulate Cell Lysis and Release of the Rhodobacter capsulatus Gene Transfer Agent

Westbye et al.,
Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada

... 2A). Analysis of the region upstream of ORF g1 using the bioinformatic tool BPROM (Softberry) indicated putative ?10 and ?35 sequences (light green in Fig. 2A). However, the location of these sequences did not correspond to either of the two RNA 5? ends mapped. ...


Molecular Microbiology
(2013), 88: 936–950. doi: 10.1111/mmi.12234

Integrated stress response of Escherichia coli to methylglyoxal: transcriptional readthrough from the nemRA operon enhances protection through increased expression of glyoxalase I

Ozyamak, E., de Almeida, C., de Moura, A. P. S., Miller, S. and Booth, I. R.
1School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen, Aberdeen, UK 2Institute of Complex Systems & Mathematical Biology, School of Natural & Computer Sciences, University of Aberdeen, Aberdeen, UK

... Averages from two independent experiments are shown. Black arrows indicate locations of known promoters. Gray arrows indicate promoters predicted by BPROM (http://linux1.softberry.com). Data smoothing and labels are as described in Fig. 3. Download figure to PowerPoint. ...


The Journal of Pathology
DOI:10.1002/path.4313

Versatile and enhanced tumour modeling in mice via somatic cell transduction

Rodriguez et al.,
1CRUK Cambridge Institute, Department of Molecular Imaging, University of Cambridge, Li Ka Shing Centre, Cambridge, UK 2Histopathology Department, Addenbrookes Hospital, Cambridge, UK

... Nat Protoc 2009; 4: 495-505. 14. BPROM: Available from: http://linux1.softberry.com/berry.phtml? topic=bprom&group=programs&subgroup=gfind b 15. BDGP Neural Network Promoter Prediction: Available from: http://www.fruitfly.org/seq_tools/promoter.html 16. ...


PLoS One.
2013; 8(9): e74495. doi: 10.1371/journal.pone.0074495

Determination of sRNA Expressions by RNA-seq in Yersinia pestis Grown In Vitro and during Infection

Yan et al.,
1State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing, China 2Microbiology Laboratory, Sichuan Agricultural University, Yaan, Sichuan province, China

... were further removed. Bacterial promoter regions were predicted by BPROM (http://linux1.softberry.com/) and Neural Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter.html). Rho-independent transcription ...


J. Bacteriol.
April 2013 vol. 195 no. 8 1834-1844 DOI:10.1128/JB.01946-12

Sigma Factor RpoS Controls Alkylresorcinol Synthesis through ArpR, a LysR-Type Regulatory Protein, during Encystment of Azotobacter vinelandii

Yanet Romero, Soledad Moreno, Josefina Guzman, Guadalupe Espin and Daniel Segura
Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico

... By using the bacterial promoter recognition program BPROM (http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb), ?35 and ?10 promoter elements showing similarity to RpoD-dependent promoters were identified in the arsA upstream region ...


Biotechnol. Bioeng.
(2013), 110: 2959–2969. doi: 10.1002/bit.24954

Isolation of fully synthetic promoters for high-level gene expression in Corynebacterium glutamicum.

Yim, S. S., An, S. J., Kang, M., Lee, J. and Jeong, K. J.
1Department of Chemical and Biomolecular Engineering, KAIST, Daejeon, Republic of Korea 2Department of Food Science & Biotechnology, Kyungsung University, Busan, Korea 3Institute for the BioCentury, KAIST, Daejeon, Republic of Korea

... All clones were 74 bp long, except for clone I29 that contained one more base in the promoter region, which might have been inserted during synthesis with the random primer (Synpro-F). BPROM software (http://www.softberry.com/berry.phtml) successfully predicted the ...


BMC Biotechnology
2013, 13:22 http://www.biomedcentral.com/1472-6750/13/22

Cloning and characterization of a novel cold-active glycoside hydrolase family 1 enzyme with b-glucosidase, b-fucosidase and b-galactosidase activities

Anna Wierzbicka-Wos 1†, Paulina Bartasun2†, Hubert Cieslinski2* and Jozef Kur2
1 Department of Microbiology, Faculty of Biology, University of Szczecin, Felczaka 3c, Szczecin 71-412, Poland. 2 Department of Microbiology, Gdansk University of Technology, Narutowicza 11/12, Gdansk 80-233, Poland.

... As described on the BProm website, the program has an E. coli promoter recognition accuracy of approximately 80%, and the most recent version is accessible at http://linux1.softberry.com/ berry.phtml?topic=bprom&group=programs &subgroup=gfindb. ...


Phil. Trans. R. Soc. B
19 April 2013 vol. 368 no. 1616 20120317 DOI:10.1098/rstb.2012.0317

Regulation of reductive dehalogenase gene transcription in Dehalococcoides mccartyi

Wagner et al.,
1Institute of Biology/Microbiology, Martin-Luther-University Halle-Wittenberg, Halle 06099, Germany 2Helmholtz Centre for Environmental Research, UfZ Leipzig, Leipzig 04318, Germany 3Laboratory of Microbiology, Wageningen University, Wageningen 6703 HB, The Netherlands

... start sites; the short arrows above the inverted repeat sequences represent the putative recognition sequences of the regulator; bold and italic letters depict the consensus sequences of the ?10 and ?35 region predicted by the BPROM software (http://linux1.softberry.com/berry ...


International journal of molecular sciences
2013, 14(8), 16901-16916. DOI:

Bioinformatic Prediction of Gene Functions Regulated by Quorum Sensing in the Bioleaching Bacterium Acidithiobacillus ferrooxidans

Banderas A., Guiliani N.
Laboratory of Bacterial Communication, Department of Biology, Faculty of Sciences, University of Chile, Santiago 780-0024, Chile

... Manipulation Suite [50] and FaBox [51]. Consensus sigma 70 bacterial promoter -10 and -35 elements were inferred using the Bprom predictor (www.softberry.com) Type I and Type II PBS sequences with additional 100 bp flanking each side ware used as input for Bprom. ...


Genetics and Molecular Biology
(2013). 36(2), 243-251. DOI:

Characterization of the omlA gene from different serotypes of Actinobacillus pleuropneumoniae: a new insight into an old approach

Rossi, C. C., Araujo, E. F. D., Queiroz, M. V. D., & Bazzolli, D. M. S.
Laboratorio de Genetica Molecular de Micro-organismos, Departamento de Microbiologia, Universidade Federal de Vicosa, Vicosa, MG, Brazil

... pseudogenes. Nucleic Acids Res 31:5338-5348. Internet Resources Bacterial Promoter Prediction Program BPROM, http://www.softberry.com (March 16, 2013). Associate Editor: Celia Maria de Almeida Soares License information ...


PloS one
(2013). 8(4), e61808. DOI:

Characterization of the Biocontrol Activity of Pseudomonas fluorescens Strain X Reveals Novel Genes Regulated by Glucose

Kremmydas, G. F., Tampakaki, A. P., & Georgakopoulos, D. G.
Department of Agricultural Biotechnology, Agricultural University of Athens, Athens, Greece

... The putative promoter site prediction was performed with two bioinformatic applications, BPROM software (Softberry Inc., Mount Kisco, NY, USA) and NNPP 2.2 software (Berkeley Drosophila Genome Project-BDGP, Berkeley, CA, USA). ...


Scientific reports
(2013). 3.e DOI:10.1038/srep02240

Acinetobacter phage genome is similar to Sphinx 2.36, the circular DNA copurified with TSE infected particles

ThLongkumer et al.,
Department of Animal Sciences, School of Life Sciences, University of Hyderabad, Hyderabad – 500 046, India Dept. of Plant Sciences, School of Life Sciences, University of Hyderabad, Hyderabad – 500 046, India Bioinformatics Centre, Pondicherry University, Puducherry - 605 014, India

...and for promoter prediction, BPROM software (www.softberry.com/berry.phtml?topic=bprom) was used. ...


Appl. Environ. Microbiol.
September 2012 vol. 78 no. 18 6568-6575 July 2012, doi: 10.1128/?AEM.01060-12

Mercury Resistance and Mercuric Reductase Activities and Expression among Chemotrophic Thermophilic Aquificae

Zachary Freedman a,b,*, Chengsheng Zhu a and Tamar Barkay a,b
aDepartment of Biochemistry and Microbiology bGraduate Program in Ecology and Evolution, Rutgers University, New Brunswick, New Jersey, USA

... (50). Of the 284 gene homologs available, 99 were selected for reconstruction; the selected homologs represented all major clusters in the MerA phylogeny. Putative promoter regions were determined using the BPROM tool (Softberry Inc., Mt. Kisco, NY). ...


Antimicrob. Agents Chemother.
January 2012 vol. 56 no. 1 565-568 doi: 10.1128/?AAC.00081-11

Description of a 2,683-Base-Pair Plasmid Containing qnrD in Two Providencia rettgeri Isolates

Thomas Guillard et al.,
aCHU Reims, Hopital Robert Debre, Laboratoire de Bacteriologie-Virologie-Hygiene, Reims, France bUFR Medecine, Universite Reims Champagne-Ardenne, Reims, France cUniversite Paris Diderot-Paris 7, Paris, France

... 2) (9): (i) an AT-rich region, (ii) iterons, (iii) three DnaA boxes, and (iv) two pairs of inverted repeats were identified using REPFIND (2). In addition, a putative promoter and transcription start site have been identified for Orf4 using BPROM (Softberry) and the promoter prediction ...


Extremophiles
Volume 16, Issue 3 , pp 363-376 DOI 10.1007/s00792-012-0435-2

Plasmid pP62BP1 isolated from an Arctic Psychrobacter sp. strain carries two highly homologous type II restriction-modification systems and a putative organic sulfate metabolism operon

Robert Lasek (1) Lukasz Dziewit (1) Dariusz Bartosik bartosik@biol.uw.edu.pl (1)
1. Department of Bacterial Genetics, Faculty of Biology, Institute of Microbiology, University of Warsaw, Miecznikowa 1, 02-096, Warsaw, Poland

... 2010). Sequence alignments were per- formed using MUSCLE (Edgar 2004). Putative promoter sequences were predicted using BPROM (http://www. softberry.com/berry.html). Protein secondary structures were determined with the application of PredictProtein (Rost et al. ... Ïîõîæèå ñòàòüè Âñå âåðñèè ñòàòüè (5)


Enzyme and Microbial Technology
Volume 50, Issues 6–7, 10 May 2012, Pages 280–286 http://dx.doi.org/10.1016/j.enzmictec.2012.02.001

The direct repeat sequence upstream of Bacillus chitinase genes is cis-acting elements that negatively regulate heterologous expression in E. coli

Liang Xiao a, b, 1, Chuan Liu a, b, 1, Chi-chu Xie a, b, Jun Cai a, b, c, Yue-hua Chen a, b, c,
a Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, PR China b Department of Microbiology, College of Life Sciences, Nankai University, Weijin Road 94, Tianjin 300071, PR China

... The chitinase genes were sequenced and the upstream regions were analyzed using online softwares REPFIND (http://zlab.bu.edu/repfind/form.html) and BPROM (http://linux1.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Appl. Environ. Microbiol.
February 2012 vol. 78 no. 4 1298-1301 doi: 10.1128/?AEM.07278-11

Requirement for RNA Helicase CsdA for Growth of Yersinia pseudotuberculosis IP32953 at Low Temperatures

Eveliina Palonen et al.,
Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland

... An important role of CsdA at low temperatures was further confirmed by successful complementation of the csdA mutation. csdA and its putative native promoter, as predicted by BPROM (softberry, Inc., Mount Kisco, NY). were ...


Applied Microbiology and Biotechnology
Volume 93, Issue 4 , pp 1585-1599 DOI 10.1007/s00253-011-3684-6

Isolation of a strong promoter fragment from endophytic Enterobacter cloacae and verification of its promoter activity when its host strain colonizes banana plants

Yu Guang Wang et al.,
1. Key Laboratory of Tropical Crop Biotechnology, Ministry of Agriculture, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou, 571101, People’s Republic of China 2. Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Danzhou, 571737, People’s Republic of China

... Promoters were predicted with Neural Network Promoter Prediction (NNPP) v2.2 (http://www.fruitfly.org/ index.html) and BPROM of SoftBerry (http://linux1.softberry. com/berry.phtml). Identification of primary promoter functional fragments of complex cloned ...


Antimicrob. Agents Chemother.
doi: 10.1128/?AAC.00846-12 October 2012 vol. 56 no. 10 5171-5179

Reduced Expression of the rplU-rpmA Ribosomal Protein Operon in mexXY-Expressing Pan-Aminoglycoside-Resistant Mutants of Pseudomonas aeruginosa

Calvin Ho-Fung Lau a, Sebastien Fraud a, Marcus Jones b, Scott N. Peterson b and Keith Poole a
aDepartment of Biomedical and Molecular Sciences, Queen's University, Kingston, Ontario, Canada bThe J. Craig Venter Institute, Rockville, Maryland, USA

... Intriguingly, the mutation upstream of this operon occurred within the putative ?10 Pribnow box of the only predicted promoter for rplU-rpmA (SoftBerry BPROM promoter prediction software; SoftBerry, Inc., Mount Kisco, NY), 135 bp upstream of the rplU start codon (TTGCCT ...


BMC Microbiology
2012, 12:10 doi:10.1186/1471-2180-12-10

Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

Eva Arrebola 1* et al.,
1 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC), Estacion Experimental La Mayora, Algarrobo-Costa, 29750 Malaga, Spain 2 Instituto de Hortofruticultura Subtropical y Mediterranea "La Mayora" (IHSM-UMA-CSIC). Departamento de Microbiologia, Facultad de Ciencias, Universidad de Malaga, Unidad Asociada al CSIC, Campus de Teatinos, 29071 Malaga, Spain

... The promoter prediction software BPROM (SoftBerry Inc.) was used to identify possible promoters in the putative mgo operon. ... The entire sequence of 118 bp was also analysed by FindTerm software (SoftBerry Inc.) to locate putative Rho-independent bacterial terminators. ...


BMC Microbiology
2012, 12:226 doi:10.1186/1471-2180-12-226

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

Valeria C Caballero et al.,
1 Program of Microbiology and Mycology, Institute of Biomedical Science (ICBM), Faculty of Medicine, University of Chile, Santiago, Chile 2 Area of Biochemistry, Faculty of Dentistry, University of Chile, Santiago, Chile

... By mean of bioinformatics tools, including BPROM from the Softberry software package (http://linux1.softberry.com/berry.phtml), we identified those promoters in S. flexneri and included all three promoters in the constructs indicated in Figure 3A. ...


Front Microbiol.
2012; 3: 2. doi: 10.3389/fmicb.2012.00002

IncP-1e Plasmids are Important Vectors of Antibiotic Resistance Genes in Agricultural Systems: Diversification Driven by Class 1 Integron Gene Cassettes

Holger Heuer et al.,
1Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Julius Kuhn-Institut, Braunschweig, Germany 2Department de Ciencias Biologicas, Universidad Adolfo Ibanez, Santiago, Chile

... to GenBank sequences. Additional searches for genes, operons, promoters, and terminators were done using FGENESB, BPROM, and FindTerm at www.softberry. com (Softberry, Mount Kisco, NY, USA). The sequence data ...


Microbiology.
2012 Jun;158(Pt 6):1581-92. doi: 10.1099/mic.0.055863-0. Epub 2012 Mar 1.

Vru (Sub0144) controls expression of proven and putative virulence determinants and alters the ability of Streptococcus uberis to cause disease in dairy cattle.

Egan SA, Ward PN, Watson M, Field TR, Leigh JA.
The School of Veterinary Medicine and Science, The University of Nottingham, Sutton Bonington, Leicestershire, UK.

... Sequence analysis of the intergenic and promoter regions of the genes sub0144 (vru) and sub0145 (lbp) was performed using Artemis (Rutherford et al., 2000) and bprom from Softberry sequence analysis tools (http://linux1.softberry.com/berry.phtml?topic=bprom&group ...


AMB Express
2:41 DOI 10.1186/2191-0855-2-41

Revelation of the ability of sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer

Nyok-Sean Lau (1) Kumar Sudesh (1)
1. Ecobiomaterial Research Laboratory, School of Biological Sciences, Universiti Sains Malaysia, Penang, 11800, Malaysia

... Center for Biotechnology Information) and ClustalW Multiple Sequence Alignment program (Thompson et al., 1994). The potential promoter regions recognized by Sigma factor D (?D) were predicted using prediction of bacterial promoters (BPROM) provided by Softberry Inc. ...


Antimicrob. Agents Chemother.
April 2012 vol. 56 no. 4 1698-1702 doi: 10.1128/AAC.06199-11

Novel Plasmid and Its Variant Harboring both a blaNDM-1 Gene and Type IV Secretion System in Clinical Isolates of Acinetobacter lwoffii

Hongyan Hu et al.,
aDepartment of Laboratory Medicine, The General Hospital of Chinese People's Armed Police Forces, Beijing, China bCAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China

... constructing the phylogenetic tree. A multiple-sequence alignment was constructed using ClustalX version 1.8 (27). Promoter searches were performed by using Softberry's BPROM (Softberry Inc., Mt. Kisco, NY), PPP-Prokaryotic ...


Appl. Environ. Microbiol.
February 2012 vol. 78 no. 4 1228-1236

Identification of an Enzyme System for Daidzein-to-Equol Conversion in Slackia sp. Strain NATTS

Hirokazu Tsujia, Kaoru Moriyamaa, Koji Nomotoa and Hideyuki Akazab
aYakult Central Institute for Microbiological Research, Kunitachi, Tokyo, Japan bSystems Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, Tokyo, Japan

... For analysis of nucleotide sequences and amino acid sequences, DDBJ-BLAST (http://www.ddbj.nig.ac.jp/), BPROM (SoftBerry), GeneMark version 2.5 (http://opal.biology.gatech. edu/GeneMark/), FindTerm (SoftBerry), and PSORT (http://psort.ims.u-tokyo.ac.jp/) were used. ...


Applied Biochemistry and Biotechnology
September 2012 Online ISSN 1559-0291 DOI 10.1007/s12010-012-9889-z

Characterization of a Glycoside Hydrolase Family 1 b-Galactosidase from Hot Spring Metagenome with Transglycosylation Activity

Richa Gupta, Tanvi Govil, Neena Capalash, Prince Sharma
1. Department of Biotechnology, Panjab University, Chandigarh, 160014, India 2. Department of Microbiology, Panjab University, Chandigarh, 160014, India

... Motifs in the considered sequences were scanned using PROSITE [19]. N-terminal signal peptide analysis was done using Signal IP version 3.0 program [20], and the promoter was located using SoftBerry BPROM tool (http://www.soft berry.com/berry.html). ...


Antimicrob. Agents Chemother.
June 2012 vol. 56 no. 6 3392-3394

Functional Characterization of a Cassette-Specific Promoter in the Class 1 Integron-Associated qnrVC1 Gene

Erica Lourenco da Fonseca and Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, FIOCRUZ, Rio de Janeiro, Brazil

... presence of internal cassette-specific promoters of aadA2 and qnrVC1 using four promoter prediction programs: Neural Network for Promoter Prediction (NNPP) version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html), BPROM (SoftBerry, http://linux1 ...


Journal of Biomedical Science and Engineering
Year: 2011 Volume: 04 Issue: 01 Pages: 70-75 DOI: 10.4236/jbise.2011.41009

Analysis of the arginine biosynthetic gene cluster argCJBDFR of Corynebacterium crenatum

Haitao Jiao, Yong Yuan, Yonghua Xiong, Xuelan Chen

... The sequence data were compiled, aligned and ana- lyzed using Lasergene software (DNASTAR), Soft- berry's BPROM (www.softberry.com) and RNAshapes WebServices (BiBiServ) et al. 3. RESULTS AND DISCUSSION 3.1. ...


Biologia
2011, vol. 66, no4, pp. 565-573

The role of TerW protein in the tellurite resistance of uropathogenic Escherichia coli

Valkovicova et al.,
(1) Department of Molecular Biology, Faculty of Natural Sciences, Comenius University, SK-84215, Bratislava, Slovakia

... and cloning of a potential promoter se- quence The potential promoter rich region (PPRR) of the ter operon was determined with the help of the Neural Network Promoter Prediction software (http://www.fruitfly.org/ seq tools/promoter.html) and Softberry-BPROM software (http ...


Antonie van Leeuwenhoek
Volume 99, Issue 2 , pp 409-416 DOI: 10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz, Ireneusz Babiak, Waleria Hryniewicz
1. Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland 2. Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ...


FEMS Microbiology Letters
314: 18–24. doi: 10.1111/j.1574-6968.2010.02132.x

ISPsa2, the first mobile genetic element to be described and characterized in the bacterial facultative intracellular pathogen Piscirickettsia salmonis.

Marshall, S. H., Henriquez, V., Gomez, F. A. and Cardenas, C.
1 Laboratorio de Genetica e Inmunologia Molecular, Instituto de Biologia, Facultad de Ciencias, Pontificia Universidad Catolica de Valparaiso, Valparaiso, Chile 2 NBC, Nucleo de Biotecnologia Curauma, Curauma, Valparaiso, Chile

... sequencing by Macrogen Inc. (Korea). Sequence analysis. The DNA sequence data were analyzed with softberry server software (http://linux1.softberry.com/berry.phtml) using the FgenesB and Bprom algorithms. FgenesB is a suite ...


J. Antimicrob. Chemother.
(2011) 66 (4): 797-801. doi: 10.1093/jac/dkr011

Pc promoter from class 2 integrons and the cassette transcription pattern it evokes

Erica Lourenco da Fonseca*, Fernanda dos Santos Freitas and Ana Carolina Paulo Vicente
Laboratorio de Genetica Molecular de Microrganismos, Instituto Oswaldo Cruz, Fundacao Oswaldo Cruz, Rio de Janeiro, RJ, Brazil

... The attI2 site sequence and the intI2* gene were submitted to four promoter predictor programs: Neural Network for Promoter Prediction version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html); BPROM (SoftBerry, http://linux1.softberry.com/berry.phtml ...


J. Antimicrob. Chemother.
(2011) 66 (5): 1005-1012. DOI: 10.1093/jac/dkr041

Variation in the genetic environments of blaCTX-M-15 in Escherichia coli from the faeces of travellers returning to the United Kingdom

Dhanji et al.,
1Antibiotic Resistance Monitoring and Reference Laboratory, Health Protection Agency Microbiology Services – Colindale, 61 Colindale Avenue, London NW9 5EQ, UK 2North West London NHS Trust, Northwick Park Hospital, London HA1 3UJ, UK

... DNA sequences that did not contain published bla CTX-M promoters were analysed with 'SoftBerry BPROM' software. 23. A potential alternative promoter region (promoter X) was investigated by cloning and northern blotting. ...


BMC Genomics
2011, 12:282 doi:10.1186/1471-2164-12-282

Comparative genomics of four closely related Clostridium perfringens bacteriophages reveals variable evolution among core genes with therapeutic potential

Oakley et al.,
1 Poultry Microbiological Research Unit, Richard B. Russell Agricultural Research Center, Agricultural Research Service, USDA, 950 College Station Road, Athens, GA 30605, USA 2 Department of Infectious Diseases & Center for Tropical and Emerging Global Diseases University of Georgia, Athens, GA 30306, USA

... The transcriptional regulation of these genes in our phages remains unknown, but searches for transcriptional promoters and terminators using BPROM (Softberry, Inc., Mount Kisco, NY, USA; http://linux1.softberry.com/berry.phtml webcite) and TransTerm (http://nbc3.biologie.uni ...


Biochem. J.
(2011) 433 (107–117) (Printed in Great Britain) doi:10.1042/BJ20101186

Escherichia coli glycogen genes are organized in a single glgBXCAP transcriptional unit possessing an alternative suboperonic promoter within glgC that directs glgAP expression

Montero et al.,
Agrobioteknologiako Instituta, Nafarroako Unibertsitate Publikoa and Consejo Superior de Investigaciones Cientificas, Mutiloako etorbidea zenbaki gabe, 31192 Mutiloabeti, Nafarroa, Spain

... Protein content was measured by the Bradford method using a Bio-Rad prepared reagent. Computer analyses. Promoters were predicted using the BPROM program (SoftBerry, http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Molecular Microbiology
(2011) 79: 1602–1614. doi: 10.1111/j.1365-2958.2011.07543.x

tRNA accumulation and suppression of the bldA phenotype during development in Streptomyces coelicolor.

Pettersson, B. M. F. and Kirsebom, L. A.
Department of Cell and Molecular Biology, Box 596, Biomedical Centre, SE-751 24 Uppsala, Sweden.

...The Softberry BPROM promoter prediction software (http://linux1.softberry.com/berry.phtml) was used to predict the tRNAHisGUG and the known tRNALeuUAA transcription start sites, while the tRNALeuCAA transcription start site was manually predicted on the basis of similarity to Escherichia coli?70 promoters....


Antimicrob. Agents Chemother.
December 2011 vol. 55 no. 12 5850-5860 doi: 10.1128/AAC.00498-11

Fluoroquinolone Efflux in Streptococcus suis Is Mediated by SatAB and Not by SmrA

Escudero et al.,
1Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, Madrid, Spain 2Centro de Vigilancia Sanitaria Veterinaria (VISAVET), Universidad Complutense de Madrid, Madrid, Spain

... Promoter sequence analysis was performed with Bprom (Softberry, Inc., Mount Kisco, NY). Protein modeling was done using Phyre server (23) and illustrated using the PyMOL molecular graphics system (version 1.3; Schrodinger, LLC). ...


Metallomics,
2011,3, 1009-1018 DOI: 10.1039/C1MT00127B

A novel nickel responsive MerR-like regulator, NimR, from Haemophilus influenzae

Kidd et al.,
School of Molecular and Biomedical Science, The University of Adelaide, North Terrace Campus, Adelaide, South Australia 5005, Australia.

... Our in silico analysis identified the promoter regions for each of these using BPROM (Softberry: www.softberry.com) and the likely MerR-like binding site .19 HI1623 is annotated as CadR, indicating that it is a cadmium responsive protein . ...


Antimicrob. Agents Chemother.
January 2011 vol. 55 no. 1 361-363 doi: 10.1128/AAC.01672-09

A Novel Insertion Sequence, ISAba10, Inserted into ISAba1 Adjacent to the blaOXA-23 Gene and Disrupting the Outer Membrane Protein Gene carO in Acinetobacter baumannii

Lee et al.,
1Department of Laboratory Medicine and Research Institute of Bacterial Resistance, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752, South Korea 2Korean Institute of Tuberculosis, 14 Woomyun-dong, Seocho-gu, Seoul 137-900, South Korea

... additional promoter sequences to the bla OXA-23 gene. Analyses using the online tool BPROM (Softberry, Inc., Mount Kisco, NY) suggested the presence of a putative promoter within the ISAba10 element (Fig. 1). View this table ...


Virology Journal
2011, 8:142 http://www.virologyj.com/content/8/1/142

Complete genome sequence of the lytic Pseudomonas fluorescens phage fjIBB-PF7A

Sillankorva et al.,
IBB-Institute for Biotechnology and Bioengineering, Centre of Biological Engineering, Universidade do Minho, Campus de Gualtar 4710-057, Braga, Portugal

... proteins were determined using the ExPASy Compute pI/Mw tool http://au.expasy.org/ tools/pi_tool.html. Promoter predictions were made using promoter predictor http://www.fruitfly. org/seq_- tools/promoter.html, PHIRE 1.0 [28] and BPROM http:// linux1.softberry.com/berry.phtml ... ...Terminators were predicted using FindTerm http://linux1.softberry. com/berry.phtml?topic=findterm&group=programs&subgroup=gfindb ...


Antimicrob. Agents Chemother.
April 2011 vol. 55 no. 4 1460-1469 doi: 10.1128/AAC.01094-10

Role of VltAB, an ABC Transporter Complex, in Viologen Tolerance in Streptococcus mutans

Saswati Biswas and Indranil Biswas
Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Centre, Kansas City, Kansas 66160

... In silico analysis by BPROM software (Softberry, Inc.) indicates that this region contains a weak promoter-like sequence (?10 box [TATATT] at position 362), indicating that vltAB may be transcribed separately from SMU.902. ...


Antimicrob. Agents Chemother
December 2011 vol. 55 no. 12 5942-5945 doi: 10.1128/AAC.05142-11

Quinolone Induction of qnrVS1 in Vibrio splendidus and Plasmid-Carried qnrS1 in Escherichia coli, a Mechanism Independent of the SOS System

Okumura et al.,
1Division of Infectious Diseases, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 2 Biological Research Laboratories, Daiichi Sankyo Co., Ltd., Tokyo, Japan

... host (Table 3), we amplified by PCR (primer pairs in Table 4) and cloned a 1,011-bp BamHI-EcoRI fragment containing qnrVS1, 258 bp of upstream sequence, including the potential native promoter sequence (bacterial promoter prediction program from Softberry), and 85 bp of ...


Veterinary Microbiology
Volume 153, Issues 3–4, 15 December 2011, Pages 403–406 DOI: 10.1016/j.vetmic.2011.05.050

The cps locus of Streptococcus suis serotype 16: Development of a serotype-specific PCR assay

Kaicheng Wang a, b, c, Weixing Fan c, Henk Wisselink d, Chengping Lu a, b
a Key Lab Animal Disease Diagnostic & Immunology, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, China

... Vector NTI. Putative promoter and terminator sequences were predicted by BPROM and FindTerm program on http://www.softberry.ru/berry.phtml, respectively. 2.4. Screening of serotype-specific gene. Cross-hybridization experiments ...


FEMS Microbiology Letters
(2011), 323: 97–104. doi: 10.1111/j.1574-6968.2011.02365.x

The copper responding surfaceome of Methylococccus capsulatus Bath

Karlsen, O. A., Larsen, O., Jensen, H. B.
1Department of Molecular Biology, University of Bergen, Norway 2UNI Research, Bergen, Norway

... b Predicted upstream promoter using bprom (http://linux1.softberry.com/all.htm) or promscan (http://molbiol-tools.ca/promscan/) promotor prediction software. c (Y, yes) or (N, no) indicates if the encoding gene is part of an operon structure. ...


Infect. Immun.
January 2011 vol. 79 no. 1 342-352 doi: 10.1128/IAI.00736-10

Characterization of a Staphylococcus aureus Surface Virulence Factor That Promotes Resistance to Oxidative Killing and Infectious Endocarditis

Malachowa et al.,
1Department of Microbiology, Molecular Biology, and Biochemistry, University of Idaho, Moscow, Idaho 83844 2Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland

... The BPROM program (Softberry, Inc., Mount Kisco, NY) was used to predict bacterial promoter. DNA isolation.Genomic DNA was isolated by using Genomic DNA Prep Plus kits (A&A Biotechnology, Gdynia, Poland) facilitated by a method to promote S. aureus lysis (41). ...


Applied Microbiology and Biotechnology
Volume 90, Issue 1 , pp 159-172 DOI: 10.1007/s00253-010-3028-y

Discovery and characterization of d-phenylserine deaminase from Arthrobacter sp. TKS1

Muramatsu et al.,
1. Multidisciplinary Science Cluster, Research and Education Faculty, Kochi University, B200 Monobe, Nankoku, Kochi, 783-8502, Japan 2. Graduate School of Integrated Arts and Sciences, Kochi University, B200 Monobe, Nankoku, Kochi, 783-8502, Japan

... Institute (Finn et al. 2008). The prediction of the bacterial promoter was performed with the BPROM software at SoftBerry (http:// linux1.softberry.com/berry.phtml). Nucleotide sequence accession number The nucleotide sequence ...


World Journal of Microbiology and Biotechnology
Volume 27, Issue 2 , pp 431-441 DOI: 10.1007/s11274-010-0475-7

Gene cloning, expression and characterization of a cold-adapted lipase from a psychrophilic deep-sea bacterium Psychrobacter sp. C18

Ruipeng Chen, Lizhong Guo, Hongyue Dang
1. College of Life Sciences, Qingdao Agricultural University, 266109, Qingdao, China 2. State Key Laboratory of Heavy Oil Processing and Centre for Bioengineering and Biotechnology, China University of Petroleum (East China), 266555, Qingdao, China

... version 2.0; Larkin et al. 2007). The upstream regulatory sequence signatures of the putative lipase genes were analyzed using the online BPROM program (http://linux1. softberry. com/berry.phtml?topic=index&group=programs&subgroup ...


International Journal of Food Microbiology
Volume 151, Issue 2, 2 December 2011, Pages 171–181 DOI: 10.1016/j.ijfoodmicro.2011.08.019

Characterization of Streptococcus thermophilus two-component systems: In silico analysis, functional analysis and expression of response regulator genes in pure or mixed culture with its yogurt partner, Lactobacillus delbrueckii subsp. bulgaricus

Thevenard et al.,
a INRA, UMR1319 Micalis, F-78350 Jouy-en-Josas, France b AgroParisTech, UMR1319 Micalis, F-78350 Jouy-en-Josas, France

... Presence of putative promoters, terminators and operons was evaluated using BPROM (http://linux1.softberry.com/berry.phtml) and BDGP (http://www.fruitfly.org/seq_tools/promoter. html), FINDTERM (http://linux1.softberry.com/berry.phtml), TransTermHP (http://transterm.cbcb ...


Antimicrob. Agents Chemother.
January 2011 vol. 55 no. 1 118-123 doi: 10.1128/AAC.01062-10

Metallo-b-Lactamase Production by Pseudomonas otitidis: a Species-Related Trait

Thaller et al.,
1Dipartimento di Biologia, Universita di Roma “Tor Vergata,” I-00133 Rome, Italy 2Dipartimento di Biologia Molecolare, Sezione di Microbiologia, Universita di Siena, I-53100 Siena, Italy

... phylogenetic trees. Signal peptide cleavage site was predicted using SignalP (version 3.0). Putative promoter sequences were detected using Bprom software (Softberry, Inc., Mount Kisco, NY). Nucleotide sequence accession ...


BioData Mining
2011, 4:22 http://www.biodatamining.org/content/4/1/22

Detection of putative new mutacins by bioinformatic analysis using available web tools

Guillaume G Nicolas
Departement de Biochimie Microbiologie et Bioinformatique, Faculte des Sciences et Genie, Universite Laval, Quebec (Quebec), G1K7P4, Canada

... Upstream genomic coding sequence was analyse to detect putative promoter regions and transcription factor binding sites using the bacterial promoter recognition program BPROM (Softberry inc.) (Figure 2). Many putative mutacin-encoding genes have been previously ...


Appl. Environ. Microbiol.
January 2011 vol. 77 no. 1 281-290 doi: 10.1128/AEM.01403-10

Ethanolamine Utilization Contributes to Proliferation of Salmonella enterica Serovar Typhimurium in Food and in Nematodes

Shabarinath Srikumar and Thilo M. Fuchs
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany

... The home pages for NCBI and Microbes Online were used to determinate the distribution of the pdu and eut clusters in different serotypes of S. enterica. Promoter sequences located upstream of the genes identified were predicted with BPROM (Softberry). ...


J. Bacteriol.
October 2011 vol. 193 no. 19 5300-5313 doi: 10.1128/JB.05287-11

Genomes and Characterization of Phages Bcep22 and BcepIL02, Founders of a Novel Phage Type in Burkholderia cenocepacia

Jason J. Gill et al.,
1Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843-2128 2Center for Phage Technology, Texas A&M University, College Station, Texas 77843-2128

... Protein sequences were compared to the NCBI protein database by using BLASTp (9); tRNA genes were detected with tRNAscan (68); rho-independent terminators were detected with TransTerm HP (37); promoters were detected using BPROM (Softberry). ...


Infection, Genetics and Evolution
Volume 11, Issue 6, August 2011, Pages 1352–1360 DOI: 10.1016/j.meegid.2011.04.029,

Pseudomonas entomophila and Pseudomonas mendocina: Potential models for studying the bacterial type VI secretion system

Panagiotis F. Sarris a, b, Effie V. Scoulica b
a Department of Biology, University of Crete, P.O. Box 2208, 71409 Heraklion, Greece b Laboratory of Clinical Bacteriology, Parasitology, Zoonoses and Geographical Medicine, School of Medicine, University of Crete, 71409 Heraklion, Greece

.. Thereby, in order to identify T6SS gene clusters potentially controlled by sigma factors we performed a survey using the BPROM algorithm (www.softberry.com). ... The sequences were used for analysis by the BPROM algorithm (www.softberry.com) (Table S1). ...


Appl. Environ. Microbiol.
March 2011 vol. 77 no. 5 1608-1618 doi: 10.1128/AEM.01862-10

Identification and Characterization of Novel and Potent Transcription Promoters of Francisella tularensis

Zaide et al.,
Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, P.O. Box 19, Ness Ziona 74100, Israel

... Computational analysis of promoter elements.The sequences of all the unique promoter clone DNA inserts were subjected to regulatory element analysis using the BPROM bacterial promoter prediction program (Softberry). ...


Antimicrob. Agents Chemother.
February 2011 vol. 55 no. 2 917-920 doi: 10.1128/AAC.00491-10

SAba825, a Functional Insertion Sequence Modulating Genomic Plasticity and blaOXA-58 Expression in Acinetobacter baumannii

Pablo Ravasi, Adriana S. Limansky, Ramiro E. Rodriguez, Alejandro M. Viale and Maria A. Mussi
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, 2000 Rosario, Argentina

... The ?35 and ?10 motifs inferred for each of the different promoters are boxed, and the transcription initiation site (G in bold) resulting from the hybrid promoter (as determined by 5? RACE-PCR) is indicated by +1. Promoter prediction was done using BPROM (SoftBerry). ...


BMC Genomics
2011, 12:198 doi:10.1186/1471-2164-12-198

Characterization and genome sequencing of two Propionibacterium acnes phages displaying pseudolysogeny

Rolf Lood* and Mattias Collin
Department of Clinical Sciences, Division of Infection Medicine, BMC-B14, Lund University, SE-221 84 Lund, Sweden

... The genome of PAD20, PAS50 and PA6 were screened for putative sigma70- promoters using SAK and BPROM (Softberry, Inc.). ... Terminator structures were identified using FindTerm (Softberry, Inc.) and EMBOSS Explorer [43]. ...


J Proteomics Bioinform
4: 179-183. doi:10.4172/jpb.1000187

Bacillus clausii and Bacillus halodurans lack GlnR but Possess Two Paralogs of glnA

Farazmand A, Yakhchali B, Shariati P, Ofoghi H
1Department of Biotechnology, Iranian Research Organization for Science and Technology (IROST), 15815-3538, Tehran, Iran 2Department of Industrial and Environmental Biotechnology, National Institute of Genetic Engineering and Biotechnology (NIGEB), 14965-161 Tehran, Iran

...the bacterial promoter prediction program, BPROM (www.softberry.com/berry.html) was used. ...


PLoS ONE
(2011) 6(3): e18197. doi:10.1371/journal.pone.0018197

Identification of a Cryptic Prokaryotic Promoter within the cDNA Encoding the 5? End of Dengue Virus RNA Genome.

Li D, Aaskov J, Lott WB
Infectious Diseases Program, Institute of Health and Biomedical Innovation (IHBI), Queensland University of Technology, Brisbane, Australia

... The BPROM promoter prediction program (SoftBerry, Mount Krisco, NY) identified potential ?35 and ?10 bacterial promoter elements at DENV2 cDNA nt positions 53 (TCAACG) and 72 (TTTTTAAT), respectively, which share sequence homology with the wild type E. coli ...


J. Bacteriol.
December 2011 vol. 193 no. 24 6824-6833 doi: 10.1128/JB.05492-11

Mycobacterium smegmatis RoxY Is a Repressor of oxyS and Contributes to Resistance to Oxidative Stress and Bactericidal Ubiquitin-Derived Peptides

Aaron Daugherty, Katelyn M. Powers, Melissa S. Standley, Cathy S. Kim and Georgiana E. Purdy
Department of Molecular Microbiology and Immunology, Oregon Health and Sciences University, Portland, Oregon 97239

... (D) A diagram of the roxY promoter as well as the homologous synthetic oligonucleotides. The bent arrow denotes the putative transcription start site and the black boxes the putative ?10 and ?35 regions, respectively, as predicted by Bprom (Softberry, Inc.). ...


BMC Microbiology
2011, 11:259 doi:10.1186/1471-2180-11-259

The small heat shock proteins from Acidithiobacillus ferrooxidans: gene expression, phylogenetic analysis, and structural modeling

Ribeiro et al.,
1 Center for Molecular Biology and Genetic Engineering (CBMEG), State University of Campinas - UNICAMP, Candido Rondon Avenue 400, 13083-875 - Campinas, SP, Brazil 2 National Biosciences Laboratory (LNBio), National Laboratory of Energy and Materials Research (CNPEM), Giuseppe Maximo Scolfaro Street 10000, 13083-970 - Campinas, SP, Brazil

... The alignment was edited with the GeneDoc program [15]. Prediction of the transcription start site was performed with BPROM software (Softberry, Inc.). A widely accepted theoretical informational approach was adopted to identify potential ? 32 sites [16,17]. ...


Applied Microbiology and Biotechnology
Volume 90, Issue 6 , pp 1963-1971 DOI: 10.1007/s00253-011-3203-9

Characterization of a gene cluster and its putative promoter region for violacein biosynthesis in Pseudoalteromonas sp. 520P1

Xi Zhang, Keiichi Enomoto
1. Department of Environmental Systems Engineering, Kochi University of Technology, 185 Miyanokuchi, Tosayamada, Kami, Kochi, 782-8502, Japan

... 2008), was obtained by PCR using primers 520P1-before-vioA-Fw2 and 520P1-vioA- Rv1. Promoter prediction was performed with BPROM software (SoftBerry, Mount Kisco, NY, USA). Cloning and expression of the violacein gene cluster ...


Appl. Environ. Microbiol.
July 2011 vol. 77 no. 14 4802-4810 doi: 10.1128/AEM.05149-11

Cholesterol Degradation by Gordonia cholesterolivorans

O. Drzyzga 1, L. Fernandez de las Heras 1, V. Morales 2, J. M. Navarro Llorens 1 and J. Perera 1
1Departamento de Bioquimica y Biologia Molecular I, Universidad Complutense de Madrid, 28040 Madrid, Spain 2Departamento de Biologia Medioambiental, Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas (CSIC), 28040 Madrid, Spain

... Putative promoters were analyzed by using the Neural Network Promoter Prediction (NNPP), Promscan, and BPROM programs (http://www.fruitfly.org/seq_tools/promoter.html, http://molbiol-tools.ca/promscan/, and http://linux1.softberry.com/berry.phtml, respectively), in ...


Iranian Journal of Microbiology
2011;3(1) : 13-20

The influence of riboflavin and nicotinic acid on Shigella sonnei colony conversion

Dr. Bagher Yakhchali
National Institute of Genetic Engineering and Biotechnology (NIGEB), Shahrak-e-Pajoohesh, km 15, Tehran-Karaj Highway, Tehran, Iran.

... CP000038) and analyzed by “Virtual Footprint Online Software” for the presence of OxyR binding site (19) and by online software “BPROM - Prediction of bacterial promoters of Softberry” for promoter prediction. All primers were analyzed by in silico simulation of PCR (20). ...


J. Bacteriol.
February 2011 vol. 193 no. 3 611-619 doi: 10.1128/JB.01185-10

The Three Vibrio cholerae Chromosome II-Encoded ParE Toxins Degrade Chromosome I following Loss of Chromosome II

Jie Yuan ,2,3, Yoshiharu Yamaichi 1, and Matthew K. Waldor 1,2
1Channing Laboratory, Brigham and Women's Hospital and Department of Microbiology and Molecular Genetics, Harvard Medical School 2HHMI

... However, bioinformatic analyses of parDE1/3 and parDE2 using BPROM (Softberry, Inc., Mount Kisco, NY) suggested that, in addition to the expected ParD promoters, P parD1 and P parD2 , the parE genes might have their own promoters, P parE1 and P parE2 . ...


Proc. R. Soc.
January 2011 vol. 278 no. 1702 115-121 DOI: 10.1098/rspb.2010.1304

Sources of variation in dietary requirements in an obligate nutritional symbiosis

Kevin J. Vogel* and Nancy A. Moran
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA

... Of the 87 single nucleotide changes, six were located in the region immediately upstream of a coding region, although none was found in a ?10/?35 promoter region as identified by BPROM (http://www.softberry.com), suggesting that these mutations have no effect on gene ...


Front Microbiol.
2011; 2: 147. DOI: 10.3389/fmicb.2011.00147

Regulation of Multiple Carbon Monoxide Consumption Pathways in Anaerobic Bacteria

Techtmann et al.,
1Institute of Marine and Environmental Technology, University of Maryland, Baltimore, MD, USA 2Department of the Geophysical Sciences, University of Chicago, Chicago, IL, USA

... These sequences were run through the bprom program (http://softberry.com) to predict the putative -10 and -35 sites. From this prediction, primers were designed to create a product that started at the putative -150 site and stretched to start codon. ...


J. Bacteriol.
May 2011 vol. 193 no. 9 2158-2167 DOI: 10.1128/JB.00029-11

Regulation of Type VI Secretion Gene Clusters by ?54 and Cognate Enhancer Binding Proteins

Christophe S. Bernard, Yannick R. Brunet, Marthe Gavioli, Roland Lloubes and Eric Cascales
Laboratoire d'Ingenierie des Systemes Macromoleculaires Institut de Microbiologie de la Mediterranee Aix-Marseille Universite CNRS—UPR9027, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France

... RESULTS. Identification of ? 54 binding boxes.To identify T6SS gene clusters potentially controlled by ? 54 , we performed a survey using the BProm algorithm (SoftBerry). The putative ? 54 -dependent T6SS promoter list includes ...


AEM
Published ahead of print 18 November 2011, doi: 10.1128/AEM.07480-11

Genomic and functional analysis of the IncP-1b plasmids pWDL7::rfp and pNB8c explains their role in chloroaniline catabolism

Krol et al.,
1Department of Biological Sciences, Institute for Bioinformatics and Evolutionary Studies, University of Idaho, PO Box 443051, Moscow, ID 83844-3051,U.S.A. 2Department of Microbiology, University of California, Davis, One Shields Avenue, Davis, CA 95616, U.S.A.

... with identity scoring by ClustalW. The pdca promoter region was analyzed using BPROM 154 (Softberry Inc., Mount Kisco, NY). 155 To infer the phylogenetic relationships of various IncP-1 plasmids, the deduced amino 156 ...


Archives of Microbiology
Volume 193, Issue 9 , pp 641-650 DOI: 10.1007/s00203-011-0705-x

Genomic analysis of the phenylacetyl-CoA pathway in Burkholderia xenovorans LB400

Patrauchan et al.,
1. Department of Microbiology and Immunology, University of British Columbia, Vancouver, BC, V6T 1Z3, Canada 2. Department of Microbiology and Molecular Genetics, Oklahoma State University, 307 LSE, Stillwater, OK, 74075, USA

... 2001) was used to search for conserved domains and motifs and to validate predicted gene function. Potential promoter regions were calculated using BPROM software (www.softberry.com) for paa genes using the gene sequence with a 100-bp upstream fragment. ...


Microbiological Research
Volume 166, Issue 5, 20 July 2011, Pages 403–418 DOI: 10.1016/j.micres.2010.05.003

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014

Fernandez de Las Heras L, Mascaraque V, Garcia Fernandez E, Navarro-Llorens JM, Perera J, Drzyzga O.
a Departamento de Bioquimica y Biologia Molecular I, Universidad Complutense de Madrid, 28040 Madrid, Spain b Departamento de Biologia Medioambiental, Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, 28040 Madrid, Spain

... Putative prokaryotic promoters were analysed by the Neural Network Promoter Prediction (NNPP) server (http://www.fruitfly.org/seq_tools/promoter.html) (Reese et al., 1996), Promscan server (http://molbiol-tools.ca/promscan/) and Bprom server (http://linux1.softberry.com/berry ...


J. Bacteriol.
May 2011 vol. 193 no. 9 2312-2321 DOI: 10.1128/JB.01355-10

Partial Functional Replacement of CymA by SirCD in Shewanella oneidensis MR-1

Carmen D. Cordova 2, Marcus F. R. Schicklberger 2,#, Yang Yu 2 and Alfred M. Spormann 1,2
1 Departments of Chemical Engineering 2 Civil & Environmental Engineering, Stanford University, Stanford, California

... coli based) (http://www.prodoric.de/vfp/) (29). The BPROM bacterial promoter predictor was used to identify entire (?35/?10) putative promoter regions (SoftBerry, Mt. Kisco, NY). E. coli-based predictions were deemed suitable ...


Nucl. Acids Res.
(2011) 39 (13): 5622-5632. doi: 10.1093/nar/gkr166

Antisense RNA associated with biological regulation of a restriction–modification system

Iwona Mruk 1,2, Yaoping Liu 2,3, Liying Ge 2 and Ichizo Kobayashi 2,3,4
1Department of Microbiology, University of Gdansk, Kladki 24, Gdansk, 80-822, Poland, 2Department of Medical Genome Sciences, Graduate School of Frontier Sciences

... to agar plates. Bioinformatic analyses. In silico promoter prediction and terminator prediction were performed using the BPROM and FindTerm software, respectively (http://www.softberry.com/all.htm). RNA secondary structure ...


Bioscience, Biotechnology, and Biochemistry
Vol. 75 (2011) No. 5 P 944-952 DOI: 10.1271/bbb.100921

The Genome of Bacillus subtilis Phage SP10: A Comparative Analysis with Phage SPO1

YEE et al.,
1) Area of Biochemistry and Molecular Biology, Division of Life Science, Graduate School of Science and Engineering, Saitama University 2) Genome Research Center, NODAI Research Institute, Tokyo University of Agriculture 3) Department of Bioscience, Tokyo University of Agriculture

... 2. The promoters recognized by the RNA polymerase holoenzyme containing sigma-A and the & independent terminators were predicted using the BPROM and the FindTerm program respectively (http://www.softberry.ru/ berry.phtml). They are shown in Fig. ...


PLoS Genet
(2011), 7(11): e1002349. doi:10.1371/journal.pgen.1002349

Attenuation of the Sensing Capabilities of PhoQ in Transition to Obligate Insect–Bacterial Association.

Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C
Department of Biology, University of Utah, Salt Lake City, Utah, United States of America Department of Biological Sciences, Institute of Tropical Medicine, Antwerp, Belgium

... PhoP boxes (inverted text) and putative ribosomal binding site (bold) were identified by visual inspection of the promoter regions. Putative -35 and -10 regions (underlined) were identified using the online BPROM tool (SoftBerry, Inc.). doi:10.1371/journal.pgen.1002349.g004. ...


Archives of Microbiology
Volume 193, Issue 4 , pp 263-274 DOI: 10.1007/s00203-010-0669-2

Two promoters and two translation start sites control the expression of the Shigella flexneri outer membrane protease IcsP

Hensley et al.,
1. School of Life Sciences, University of Nevada, 4505 Maryland Parkway, Las Vegas, NV, 89154-4004, USA 2. Department of Molecular Biology, University of Wyoming, Laramie, WY, 82071, USA

... To identify putative promoter sequences, the intergenic region upstream of icsP was entered into the BPROM program for prediction of promoters regulated by the r70 subunit of RNA polymerase (http://www.linux1. softberry.com). ...


Molecular Microbiology
(2011), 80: 1260–1275. doi: 10.1111/j.1365-2958.2011.07641.x

Antagonistic regulation of dgkA and plsB genes of phospholipid synthesis by multiple stress responses in Escherichia coli.

Wahl, A., My, L., Dumoulin, R., Sturgis, J. N. and Bouveret, E.
LISM, CNRS, Aix-Marseille University, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France.

... ?E-dependent promoter. We ran a search on the dgkA-plsB intergenic sequence for a putative promoter using a set of bioinformatic servers and got a low hit using BPROM (http://www.softberry.com/berry.phtml). A +1 transcription ...


Journal of Bioscience and Bioengineering
Volume 112, Issue 5, November 2011, Pages 422–431 DOI: 10.1016/j.jbiosc.2011.07.020

Molecular cloning and characterization of two inducible NAD+-adh genes encoding NAD+-dependent alcohol dehydrogenases from Acetobacter pasteurianus SKU1108

Uraiwan Masud 1, Kazunobu Matsushita 2, Gunjana Theeragool 1, 3
1 Interdisciplinary Graduate Program in Genetic Engineering, The Graduate School, Kasetsart University, Bangkok 10900, Thailand, 2 Department of Biological Chemistry, Faculty of Agriculture, Yamaguchi University, Yamaguchi 753–8515, Japan,

... Based on the E. coli sigma 70 promoter recognition program (BPROM tool of Softberry), the predicted ? 35 and ? 10 sequences of sigma 70, TTTATT and TGTTTGTAAAAT, were located from the 961st to 966th and 976th to 987th nucleotide (nt) of the adhI gene, respectively. ...


J. Bacteriol.
May 2011 vol. 193 no. 10 2575-2586 doi: 10.1128/JB.00217-11

Transcription Antitermination by a Phosphorylated Response Regulator and Cobalamin-Dependent Termination at a B12 Riboswitch Contribute to Ethanolamine Utilization in Enterococcus faecalis

Kris Ann Baker and Marta Perego
The Scripps Research Institute, Department of Molecular and Experimental Medicine, La Jolla, California 92037

... In order to determine whether the promoter activity in the eutT-eutG intergenic region was upstream or downstream from the riboswitch, the sequence of the eutT-eutG intergenic region was analyzed with the Softberry BPROM program. ...


J. Bacteriol.
May 2011 vol. 193 no. 10 2536-2548 doi: 10.1128/JB.00815-10

Identification of ArgP and Lrp as Transcriptional Regulators of lysP, the Gene Encoding the Specific Lysine Permease of Escherichia coli

Jimena Ruiz ‡, Ina Haneburger and Kirsten Jung
Ludwig-Maximilians-Universitat Munchen, Munich Center for integrated Protein Science (CiPSM) at the Department of Biology I, Microbiology, Grosshaderner Strasse 2-4, 82152 Martinsried, Germany

... Predicted ?35 and ?10 promoter motifs (BProm; http://linux1.softberry.com/berry.phtml? topic=bprom&group=help&subgroup=gfindb) and the start of transcription (position +1) previously identified by primer extension analysis (32) are indicated. ...


Antimicrob. Agents Chemother.
April 2011 vol. 55 no. 4 1638-1649 doi: 10.1128/AAC.01366-10

Mutational Analysis of the Thienamycin Biosynthetic Gene Cluster from Streptomyces cattleya

Rodriguez et al.,
Departamento de Biologia Funcional e Instituto Universitario de Oncologia del Principado de Asturias, Universidad de Oviedo, 33006 Oviedo, Spain

... operon thnKJI. Other putative promoter sequences have also been identified for the ThnI-independent genes (Fig. 1C) by the use of the BPROM bacterial promoter prediction server (Softberry Inc., Mount Kisco, NY). Upstream of ...


J. Bacteriol.
August 2011 vol. 193 no. 15 3988-3997 doi: 10.1128/JB.05186-11

A Sulfite Respiration Pathway from Thermus thermophilus and the Key Role of Newly Identified Cytochrome c550

Robin et al.,
1Chemical and Environmental Science Department, Materials and Surface Science Institute, University of Limerick, Limerick, Ireland 2Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche c/o Dipartimento di Scienze Biochimiche, Sapienza Universita di Roma Piazzale Aldo Moro 5, I-00185 Rome, Italy

... are yet to be elucidated. A unique promoter upstream of TTHA1325 and a unique terminator region downstream of TTHA1327 were identified using BPROM and FindTerm (Softberry), respectively. Those findings showed that ...


BMC Genomics
2011, 12:479 doi:10.1186/1471-2164-12-479

Single-nucleotide resolution analysis of the transcriptome structure of Clostridium beijerinckii NCIMB 8052 using RNA-Seq

Yi Wang 1,2, Xiangzhen Li 3, Yuejian Mao 3 and Hans P Blaschek 2,4,5
1 Department of Agricultural and Biological Engineering, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA 2 Institute for Genomic Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA

... A prediction of the promoters for primary sigma factors for all the putative HKGs was carried out using BPROM (http://linux1.softberry.com/berry.phtml webcite). ...


FEMS Microbiology Letters
(2011), 325: 56–63. doi: 10.1111/j.1574-6968.2011.02416.x

Genetic analysis of the pnp–deaD genetic region reveals membrane lipoprotein NlpI as an independent participant in cold acclimatization of Salmonella enterica serovar Typhimurium

Rouf, S. F., Anwar, N., Clements, M. O. and Rhen, M.
BGI

.. Although S. Typhimurium pnp and nlpI are separated by 109 base pairs, the promoter prediction software bprom (www.Softberry.com) failed to define any tentative nlpI promoter within this intergenic region (data not shown). ...


Applied Microbiology and Biotechnology
Volume 90, Issue 2 , pp 625-634 DOI: 10.1007/s00253-011-3121-x

Co-transcription of the celC gene cluster in Clostridium thermocellum

Michael Newcomb, Jonathan Millen, Chun-Yu Chen, J. H. David Wu
1. Department of Chemical Engineering, University of Rochester, Room 206 Gavett Hall, Rochester, NY, 14627-0166, USA 2. Novozymes North America Inc., 77 Perry Chapel Church Road, Franklinton, NC, 27525, USA

... The palindromic GlyR3 binding site (Newcomb et al. 2007) is bolded. The ?10 and ?35 sigma factor binding sites predicted by BProm (http:// linux1.softberry.com/berry. phtml, accessed 3 January 2011) are noted by a solid and a dashed box, respectively 630 ...


BMC Microbiology
2011, 11:90 doi:10.1186/1471-2180-11-90

Integration Host Factor (IHF) binds to the promoter region of the phtD operon involved in phaseolotoxin synthesis in P. syringae pv. phaseolicola NPS3121

Arvizu-Gomez et al.,
1 Departamento de Ingenieria Genetica, Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional Unidad Irapuato, Apdo Postal 629, CP 36821, Irapuato, Gto, Mexico 2 Laboratorio Nacional de Genomica para la Biodiversidad, Centro de Investigacion y de Estudios Avanzados del Instituto Politecnico Nacional, Apdo Postal 629, CP 36821, Irapuato, Gto, Mexico

...we evaluated the presence of putative cis-acting elements within the phtD promoter region using a transcription factor search program (BPROM, http://www.softberry.com webcite) [26]....


The Journal of Biological Chemistry
November 11, 2011 , 286, 38854-38864, doi: 10.1074/jbc.M111.260992

Identification of a Novel Streptococcal Adhesin P (SadP) Protein Recognizing Galactosyl-a1–4-galactose-containing Glycoconjugates

Kouki et al.,
‡Department of Medical Biochemistry and Genetics, University of Turku, Kiinamyllynkatu 10, Turku FI-20520, Finland, the ?Department of Biosciences, Division of Biochemistry and Biotechnology, University of Helsinki, P.O.B. 56, Helsinki FI-00014, Finland,

... terminators. SadP was not located in an operon, and promoter sequences typical for Gram-positive bacteria upstream of the gene and a Rho-independent terminator were predicted using the program Bprom on the Softberry server. ...


BMC Microbiology
2011, 11:72 doi:10.1186/1471-2180-11-72

Contribution of SecDF to Staphylococcus aureus resistance and expression of virulence factors

Quiblier et al.,
1 Institute of Medical Microbiology, University of Zurich, Gloriastr. 32, 8006 Zurich, Switzerland 2 Division of Infectious Diseases and Hospital Epidemiology, University Hospital Zurich, University of Zurich, Raemistr. 100, 8091 Zurich, Switzerland

...Promoter predictions were performed by BPROM http://linux1.softberry.com/berry.phtml...


J. Bacteriol.
July 2011 vol. 193 no. 13 3207-3219 doi: 10.1128/JB.00044-11

The Anaerobe-Specific Orange Protein Complex of Desulfovibrio vulgaris Hildenborough Is Encoded by Two Divergent Operons Coregulated by ?54 and a Cognate Transcriptional Regulator

Fievet et al.,
1Laboratoire Interactions et Modulateurs de Reponses, Institut de Microbiologie de la Mediterranee, CNRS 13402 Marseille Cedex 20, France 2Laboratoire d'Ingenierie des Systemes Macromoleculaires, Institut de Microbiologie de la Mediterranee, CNRS 13402 Marseille Cedex 20, France

. lactate/sulfate conditions. To characterize the cis elements required for transcription of the orp1 and orp2 operons, in silico analyses were carried out using the Softberry (BProm) and PromScan algorithms. These analyses predicted ...


Appl. Environ. Microbiol.
May 2011 vol. 77 no. 9 2823-2830 doi: 10.1128/AEM.02633-10

Important Role of Class I Heat Shock Genes hrcA and dnaK in the Heat Shock Response and the Response to pH and NaCl Stress of Group I Clostridium botulinum Strain ATCC 3502

Selby et al.,
1Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finland 2Center for Biomolecular Sciences, University of Nottingham, Nottingham, United Kingdom

... However, using the bacterial sigma70 promoter recognition software BPROM freeware (Softberry, Mount Kisco, NY), only one promoter with a ? A binding site was predicted upstream of the groE operon of C. botulinum strain ATCC 3502. ...


Eukaryotic Cell
December 2011 vol. 10 no. 12 1670-1678 doi: 10.1128/EC.05043-11

Novel Shuttle Markers for Nuclear Transformation of the Green Alga Chlamydomonas reinhardtii

Laurence Meslet-Cladiere† and Olivier Vallon
Centre National de la Recherche Scientifique, Unite Mixte de Recherche 7141/Universite Pierre et Marie Curie, Institut de Biologie Physico-Chimique, Paris 75005, France

... As analyzed using the program BPROM (SoftBerry), the sequence upstream of the CDS, which by and large corresponds to the first intron of RBCS2, appears to contain a reasonably strong bacterial promoter (score of 2.93 versus 2.85 for the bla promoter and 5.91 for the ...


PNAS
September 13, 2011 vol. 108 no. 37 E709-E717 doi: 10.1073/pnas.1101655108

Global discovery of small RNAs in Yersinia pseudotuberculosis identifies Yersinia-specific small, noncoding RNAs required for virulence

Jovanka T. Koo a, Trevis M. Alleyne b,1, Chelsea A. Schiano a, Nadereh Jafari b, and Wyndham W. Lathem a,2
aDepartment of Microbiology-Immunology and bCenter for Genetic Medicine, Northwestern University Feinberg School of Medicine, Chicago, IL, 60611

...Predicted sRNAs were inspected for the presence of promoters and ?-independent terminators using the BProm and TermFind/RNAFold programs (Softberry)....


BMC Plant Biology
2011, 11:64 doi:10.1186/1471-2229-11-64

Evolution of the rpoB-psbZ region in fern plastid genomes: notable structural rearrangements and highly variable intergenic spacers

Lei Gao 1, Yuan Zhou 1, Zhi-Wei Wang 1, Ying-Juan Su 2* and Ting Wang 1
1 CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China 2 State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou 510275, China

...The putative promoters were identified by running BPROM [43]....


mBio
doi: 10.1128/mBio.00045-11 3 May 2011 vol. 2 no. 3 e00045-11

Hypervirulent Chlamydia trachomatis Clinical Strain Is a Recombinant between Lymphogranuloma Venereum (L2) and D Lineages

Somboonna et al.,
Center for Immunobiology and Vaccine Development, Children’s Hospital Oakland, Research Institute, Oakland, California, USAa; Health Sciences Research Institute and School of Natural Sciences, University of California, Merced, Merced, California, USAb;

...The L2c consensus chromosome and plasmid sequences were annotated automatically using the Integrative Services for Genomics Analysis pipeline (16). Promoter 2.0 prediction (http://www.cbs.dtu.dk/services/Promoter/), Bacterial PROMoter prediction (http://www.softberry.ru/berry.phtml), and ...


(2011), Molecular Microbiology
81: 1271–1285. doi: 10.1111/j.1365-2958.2011.07760.x

Multimodal dynamic response of the Buchnera aphidicola pLeu plasmid to variations in leucine demand of its host, the pea aphid Acyrthosiphon pisum.

Vinuelas et al.,
UMR203 BF2I, Biologie Fonctionnelle Insectes et Interactions, INSA-Lyon, INRA, Universite de Lyon, Bat. Louis Pasteur, 20 av. Albert Einstein, F-69621 Villeurbanne, France

...putative promoters via the BPROM promoter prediction tool (http://linux1.softberry.com/berry.phtml?topic=gfindb);...


Front Microbiol.
2011; 2: 51. DOI: 10.3389/fmicb.2011.00051

Regulation of Dissimilatory Sulfur Oxidation in the Purple Sulfur Bacterium Allochromatium Vinosum

Frauke Grimm, 1 Bettina Franz, 1,† and Christiane Dahl
Institut fur Mikrobiologie und Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Bonn, Germany

...Promoter prediction for prokaryotic sequence was achieved with Neural Network Promoter Prediction1 and BPROM 2. ...


The Journal of Infectious Diseases
2010;201:414–419

Protein E of Haemophilus influenzae Is a Ubiquitous Highly Conserved Adhesin

Birendra Singh,1 Marta Brant,1 Mogens Kilian,3 Bjorn Hallstrom,2 and Kristian Riesbeck1
1Medical Microbiology, Department of Laboratory Medicine, University Hospital Malmo, Lund University, Malmo, and 2Department of Cell and Organism Biology, Division of Evolutionary Molecular Systematics, Lund University, Lund, Sweden

... DNA and pe promoter sequences were analyzed by ClustalW2 alignment and BPROM (Softberry), respectively. The interactive similarity matrix was prepared by EMBOSS Pairwise Alignment Algorithms (European Bioinformatics Institute). ...


Journal of Economic Entomology
Volume 103, Number 3, June 2010 , pp. 887-897(11)

Limited Endosymbiont Variation in Diuraphis noxia (Hemiptera: Aphididae) Biotypes From the United States and South Africa

Swanevelder, Z. H.; Surridge, A.K.J.; Venter, E.; Botha, A.-M.

... Structural Analysis. Bacterial promoters on the leucine plasmid were predicted with BPROM (http://softberry.com). ... The plasmids were screened for Rho-independent terminators using FindTerm (http://softberry.com). Plasmid Copy Numbers. ... 


Antimicrob. Agents Chemother.
doi:10.1128/AAC.01062-10

Metallo-{b}-Lactamase Production by Pseudomonas otitidis: a Species-Related Trait

Thaller et al.,
Dipartimento di Biologia, Universita di Roma "Tor Vergata", I-00133 Rome, Italy; Dipartimento di Biologia Molecolare, Sezione di Microbiologia, Universita di Siena, I-53100 Siena, Italy

... phylogenetic trees. Signal peptide cleavage site was predicted using SignalP (version 108 3.0). Putative promoter sequences were detected using the Bprom software at the 109 Softberry site (http://linux1.softberry.com/berry.phtml). 110 Nucleotide sequence accession number. ...


PLoS ONE
2010, 5(11): e15528. doi:10.1371/journal.pone.0015528

Activation of the SMU.1882 Transcription by CovR in Streptococcus mutans

Chong P, Chattoraj P, Biswas I
Department of Microbiology, Molecular Genetics and Immunology, University of Kansas Medical Center, Kansas City, Kansas, United States of America

... 1A. Sequence analysis, confirmed using BPROM online software (Prediction of bacterial promoters, Softberry, http://linux1.softberry.com), indicates the presence of putative -35 (GTGAGT) and -10 (TATAAT) box motifs 151- and 127-bp, respectively, upstream of the putative start ... 


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

... Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ... 


Journal of Microbiology
doi:10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)  Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland (2)  Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ... 


Journal of Bacteriology
May 2010, p. 2583-2595, Vol. 192, No. 10 doi:10.1128/JB.01526-09

The Actinomycin Biosynthetic Gene Cluster of Streptomyces chrysomallus: a Genetic Hall of Mirrors for Synthesis of a Molecule with Mirror Symmetry

Ullrich Keller,* Manuel Lang, Ivana Crnovcic, Frank Pfennig,§ and Florian Schauwecker
Institut fur Chemie, Arbeitsgruppe Biochemie und Molekulare Biologie, Technische Universitat Berlin, Franklinstrasse 29, D-10587 Berlin-Charlottenburg, Germany

.. Open reading frames (ORFs), operons, transcriptional start points, promoters, and terminators were identified using various computer programs such as FGENES-B (Softberry Inc.), SAK (21), BPROM (Softberry Inc.), and FindTerm (Softberry Inc.). ...


Journal of Microbiology
doi:10.1007/s10482-010-9476-7

Characterization of transcription within sdr region of Staphylococcus aureus

Izabela Sitkiewicz 1 , Ireneusz Babiak 2 and Waleria Hryniewicz 1
(1)  Department of Epidemiology and Clinical Microbiology, National Medicines Institute, Chelmska 30/34, Warszawa, Poland (2)  Department of Orthopedics and Traumatology of Locomotory System, Medical University of Warsaw, Warsaw, Poland

... The presence of putative promoters and transcrip- tional organization of the sdr region was detected using the BPROM and FGENESB algorithms (www. softberry.com) based on region 611262 bp–623152 bp (GeneBank number CP000730.1) of the S. aureus subsp. ... 


J Microbiol.
2010 Jun;48(3):318-24. Epub 2010 Jun 23.

Cel8H, a novel endoglucanase from the halophilic bacterium Halomonas sp. S66-4: molecular cloning, heterogonous expression, and biochemical characterization

Huang et al.,
State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Huazhong Agricultural University, Wuhan, 430070, PR China.

... The open reading frame (ORF) and the promoter region in the obtained DNA fragments were predicted using FGENSB and BPROM (http://linux1.softberry.com/berry.phtml). ... Genes in the 3.3 kb DNA fragment were predicted using FGENSB in the softberry website. ... 


Nucl. Acids Res.
2010 Volume 38, Issue 22 Pp. 8196-8207 doi: 10.1093/nar/gkq709

Diversity and strength of internal outward-oriented promoters in group IIC-attC introns

Leon G, Quiroga C, Centron D, Roy PH
Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec, Quebec, Canada.

... intron to the nucleotide opposite the start codon of the ORF encoding the IEP on the bottom strand, using the Neural Network for Promoter Prediction (NNPP) version 2.2 (Berkeley Drosophila Genome Project, http://www.fruitfly.org/index.html) and BPROM (SoftBerry, http://linux1 ...


Journal of Bacteriology
April 2010, p. 2013-2019, Vol. 192, No. 7, doi:10.1128/JB.01085-09

Precise Excision of IS5 from the Intergenic Region between the fucPIK and the fucAO Operons and Mutational Control of fucPIK Operon Expression in Escherichia coli

Zhongge Zhang, Ming Ren Yen, and Milton H. Saier Jr.
Division of Biological Sciences, University of California at San Diego, La Jolla, California 92093-0116

... Using the SoftBerry BPROM program (http://linux1.softberry.com/berry.phtml?topic= bprom&group=programs&subgroup=gfindb), the same promoters were identified in the 13-bp deletion and the 7-bp insertion strains but not in the 1-bp insertion strain. ... 


Biochimie
Volume 92, Issue 8, August 2010, Pages 1003-1009, doi:10.1016/j.biochi.2010.04.018

The role of a 2-on-2 haemoglobin in oxidative and nitrosative stress resistance of Antarctic Pseudoalteromonas haloplanktis TAC125

Parrilli et al.,
a Dipartimento di Chimica Organica e Biochimica, Universita di Napoli Federico II – Complesso Universitario M.S. Angelo, via Cinthia 4, 80126 Naples, Italy b Facolta di Scienze Biotecnologiche Universita di Napoli Federico II, Naples, Italy

... This plasmid contains the PSHAa0030 gene and its upstream region (237 bp long), in which the presence of a putative promoter sequence was predicted by SoftBerry BPROM – Prediction of bacterial promoters software (http://softberry.com/berry). As shown in Table 3 and Fig. ... 


Applied and Environmental Microbiology
October 2010, p. 6329-6337, Vol. 76, No. 19, doi:10.1128/AEM.01217-10

Functional Characterization of pGKT2, a 182-Kilobase Plasmid Containing the xplAB Genes, Which Are Involved in the Degradation of Hexahydro-1,3,5-Trinitro-1,3,5-Triazine by Gordonia sp. Strain KTR9

Indest et al.,
U.S. Army Engineer Research and Development Center, Environmental Laboratory, Vicksburg, Mississippi,1 Department of Microbiology and Immunology, University of British Columbia, Vancouver, British Columbia, Canada2

... 232 233 Open reading frames (ORFs) were identified using FGENESB program (Softberry Inc., 234 ... pGKT2 were analyzed for bacterial promoter elements and Rho independent terminator 236 sequences using BPROM and FindTerm programs (Softberry Inc.). ... 


Infection and Immunity
January 2010, p. 413-422, Vol. 78, No. 1 doi:10.1128/IAI.00664-09

Human Platelets Recognize a Novel Surface Protein, PadA, on Streptococcus gordonii through a Unique Interaction Involving Fibrinogen Receptor GPIIbIIIa

Petersen et al.,
Department of Oral and Dental Science, University of Bristol, Lower Maudlin Street, Bristol BS1 2LY, United Kingdom,1 Molecular and Cellular Therapeutics, School of Pharmacy, Royal College of Surgeons in Ireland, Dublin 2, Ireland

... Putative promoters with –35 and –10 regions were identified with BPROM software available from Softberry (Mount Kisco, NY), and putative transcriptional terminator regions were identified with mfold (37). DNA manipulations. ... 


Microbiology
156 (2010), 211-219; DOI 10.1099/mic.0.032342-0

PssA is required for {alpha}-amylase secretion in Antarctic Pseudoalteromonas haloplanktis

Parrilli et al.,
1 Dipartimento di Chimica Organica e Biochimica, Universita di Napoli Federico II – Complesso Universitario M.S. Angelo via Cinthia 4, 80126 Napoli, Italy 2 Facolta di Scienze Biotecnologiche Universita di Napoli Federico II – Complesso Universitario M.S. Angelo via Cinthia 4, 80126 Napoli, Italy

... This plasmid contains both the amy Ct gene and the DNA sequence encoding pssA and its upstream region (150 bp long), in which the presence of a putative promoter sequence was predicted (SoftBerry BPROM software: http://linux1.softberry.com/berry.phtml). ... 


Infect. Immun.
doi:10.1128/IAI.00736-10

Characterization of a Staphylococcus aureus surface virulence factor promoting resistance to oxidative killing and infectious endocarditis

Malachowa et al.,
Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, 30-387 Krakow, Poland; Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, National Institute of Health, Hamilton, MT, 59840, USA;

... server, hydrophobicity (ProtScale), and transmembrane topology (MEMSAT, The PSIPRED 99 Protein Structure Prediction Server). BPROM program (Softberry, Inc. Mount Kisco, NY, USA) 100 was used to predict bacterial promoter. 101 DNA isolation. ...


Microbiology
156 (2010), 128-138; DOI 10.1099/mic.0.032250-0

myo-Inositol transport by Salmonella enterica serovar Typhimurium

Carsten Kroger 1, Jurgen Stolz 2 and Thilo M. Fuchs 1
1 Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85350 Freising, Germany 2 Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Biochemie, Technische Universitat Munchen, Gregor-Mendel-Str. 2, D-85350 Freising, Germany

... negative species. Promoter sequences located upstream of the identified genes were predicted with BPROM (http://www.softberry.com/), and transmembrane domains with TOPCONS (http://topcons.cbr.su.se/). The cladogram ... 


FEBS Letters
Volume 584, Issue 21, Pages 4419-4425

A novel secreted metzincin metalloproteinase from Bacillus intermedius

Sabirova et al.,

... nlm.nih.gov) [23]. Promoter regions were identified using the BPROM program (http://www.softberry.com). Signal peptide was identified using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP). The coding region ...


Antimicrobial Agents and Chemotherapy
August 2010, p. 3107-3112, Vol. 54, No. 8 doi:10.1128/AAC.00128-10

Contribution of a Plasmid-Borne blaOXA-58 Gene with Its Hybrid Promoter Provided by IS1006 and an ISAba3-Like Element to b-Lactam Resistance in Acinetobacter Genomic Species 13TU

Chen et al.,
Institute of Clinical Medicine, School of Medicine, National Yang-Ming University, Taipei,1 Division of Infectious Diseases, Department of Medicine, Taipei Veterans General Hospital, Taipei,2, Taiwan

... and sequenced. The transcription start site was determined, and conserved motifs of promoter sequences were identified using the BPROM program (Softberry, Mount Kisco, NY). Transformation of recombinant plasmids. The ...


Applied and Environmental Microbiology
April 2010, p. 2500-2508, Vol. 76, No. 8 doi:10.1128/AEM.00666-09

Identification of the Biosynthetic Gene Cluster for 3-Methylarginine, a Toxin Produced by Pseudomonas syringae pv. syringae 22d/93

Braun et al.,
Institute of Microbiology, Microbial Phytopathology, University of Jena, Neugasse 25, 07743 Jena, Germany,1 Jacobs University Bremen, School of Engineering and Science, Campus Ring 1, 28759 Bremen, Germany,2

... ClustalX2 (28), and TreeViewX (20). Promoter site prediction was performed with BPROM software (Softberry Inc., Mount Kisco, NY). Cloning of the SAM-dependent methyltransferase MrsA. The SAM-dependent methyltransferase ... 


Appl. Environ. Microbiol.
doi:10.1128/AEM.01403-10

Ethanolamine utilization contributes to proliferation of Salmonella enterica serovar Typhimurium in food and in nematodes

Shabarinath Srikumar and Thilo M. Fuchs
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany

.. determinate the distribution of the pdu and eut clusters in different serotypes of S. enterica. 133 Promoter sequences located upstream of the identified genes were predicted with BPROM 134 (http://www.softberry.com/). 135 Construction of deletion mutants. ...


Environmental Microbiology
2010. 12: 105–117. doi: 10.1111/j.1462-2920.2009.02049.x

dentification and characterization of new LuxR/LuxI-type quorum sensing systems from metagenomic libraries

Hao, Y., Winans, S. C., Glick, B. R. and Charles, T. C.
1. Department of Biology, University of Waterloo, Waterloo, ON, Canada. 2. Department of Microbiology, Cornell University, Ithaca, NY, USA.

... examined. Using promoter prediction software BPROM (Softberry, Mt. Kisco, NY, USA) or SAK (Gordon et al., 2003), a possible ? 70 promoter was identified upstream of both the luxI QS6-1 and luxI QS10-1 regions. Possible ... 


INTERNATIONAL MICROBIOLOGY
2010 13:113-121 DOI: 10.2436/20.1501.01.116

Induction, structural characterization, and genome sequence of Lv1, a prophage from a human vaginal Lactobacillus jensenii strain

Rebeca Martin, 1 Susana Escobedo, 1 Juan E. Suarez1, 2
1Microbiology Unit, University Institute of Biotechnology, University of Oviedo, Oviedo, Spain. 2Institute of Dairy Products of Asturias-CSIC, Villaviciosa, Spain

... services/TMHMM-2.0/]. Sequences of the s70 pro- moter were identified using Bprom [http://www.softberry.com]. Putative ter- minator sequences were detected with the Terminator function of GCG (ver- sion 10.2). Putative tRNA ... 


Journal of Bacteriology
September 2010, p. 4337-4347, Vol. 192, No. 17 doi:10.1128/JB.00359-10

Complete Nucleotide Sequence of TOL Plasmid pDK1 Provides Evidence for Evolutionary History of IncP-7 Catabolic Plasmids

Yano et al.,
Department of Environmental Life Sciences, Graduate School of Life Sciences, Tohoku University, 2-1-1 Katahira, Sendai 980-8577,1 Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa 277-8561, Japan2

... helix, respectively. The putative transcriptional promoter and Rho-independent terminator were predicted using BPROM and FindTerm, respectively (Softberry). Nucleotide sequence accession number. Nucleotide sequence ... 


Journal of Microbiological Methods
Volume 83, Issue 2, November 2010, Pages 156-163 doi:10.1016/j.mimet.2010.08.004

Novel plasmid-based genetic tools for the study of promoters and terminators in Streptococcus pneumoniae and Enterococcus faecalis

Sofia Ruiz-Cruz a, Virtu Solano-Collado a, Manuel Espinosa a and Alicia Bravo , a,
a Centro de Investigaciones Biologicas, Consejo Superior de Investigaciones Cientificas, Ramiro de Maeztu, 9. E-28040 Madrid, Spain

... A further analysis of the TpolA fragment using the BPROM prediction program (Softberry, Inc.) revealed a near-consensus 10 hexamer (TAgAAT) located 5 nucleotides downstream of the TpolA palindrome, as well as a near-consensus extended 10 element (TGTa) (see Fig. ... 


Infection and Immunity
March 2010, p. 1176-1184, Vol. 78, No. 3 doi:10.1128/IAI.01014-09

Haemophilus ducreyi SapA Contributes to Cathelicidin Resistance and Virulence in Humans

Mount et al.,
Departments of Microbiology and Immunology,1 Medicine,2 Pathology and Laboratory Medicine,3 Center for Immunobiology, Indiana University School of Medicine, 635 Barnhill Drive, Room MS 420, Indianapolis, Indiana 46202-5124 4

... the 5' end of the sapA clone. Using BPROM software (SoftBerry, Inc., Mount Kisco, NY), a putative promoter was identified starting 177 bp upstream of tyrR in an untranslated region. To place the putative promoter upstream of ... 


Microbiology
156 (2010), 764-773; DOI 10.1099/mic.0.034645-0

Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum

Frauke Grimm, Nadine Dobler and Christiane Dahl
Institut fur Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Meckenheimer Allee 168, D-53115 Bonn, Germany

... upstream of dsrA. Promoter prediction for prokaryotic sequence was achieved with Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) and BPROM (http://www.softberry.com/berry.phtml). RESULTS. ... 


Antimicrob. Agents Chemother.
2010 doi:10.1128/AAC.00491-10

ISAba825, a Functional Insertion Sequence Modulating Genomic Plasticity and blaOXA-58 Expression in Acinetobacter baumannii

Pablo Ravasi, Adriana S. Limansky, Ramiro E. Rodriguez, Alejandro M. Viale, and Maria A. Mussi
Instituto de Biologia Molecular y Celular de Rosario (IBR, CONICET) and Departamento de Microbiologia, Facultad de Ciencias Bioquimicas y Farmaceuticas, Universidad Nacional de Rosario, 2000 Rosario, Argentina

... boxed, and the transcription initiation site (G in bold) resulting from the hybrid 8 promoter (as determined by 5? RACE-PCR) is indicated by +1. Promoter prediction was 9 done using BPROM, (http://linux1.softberry.com). The different ATG codons for 10 ...


J. Bacteriol.
2009 doi:10.1128/JB.01185-10

The three Vibrio cholerae chromosome II-encoded ParE toxins degrade chromosome I following loss of chromosome II

Jie Yuan, Yoshiharu Yamaichi, and Matthew K. Waldor
Channing Laboratory, Brigham and Women's Hospital and Department of Microbiology and Molecular Genetics, Harvard Medical School, and HHMI and Immunology Program, Tufts University School of Medicine

... However, bioinformatic analyses of parDE1/3 and parDE2 using BPROM 15 (http://www.softberry. com/berry.phtml) suggested that in addition to the expected ParD 16 promoters, PparD1, and PparD2, the parE genes might have their own promoters, PparE1, and PparE2. 17 ...


Proc Biol Sci.
2011 Jan 7;278(1702):115-21. Epub 2010 Jul 28. doi: 10.1098/rspb.2010.1304

Sources of variation in dietary requirements in an obligate nutritional symbiosis

Vogel KJ, Moran NA.
Department of Ecology and Evolutionary Biology, The University of Arizona, Tucson, AZ 85721, USA

... Of the 87 single nucleotide changes, six were located in the region immediately upstream of a coding region, although none was found in a ?10/?35 promoter region as identified by BPROM (http://www.softberry.com), suggesting that these mutations have no effect on gene ... 


BMC Microbiology
2010, 10:229 doi:10.1186/1471-2180-10-229

Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, Carbon fixation in A. ferrooxidans

Esparza M, Cardenas JP, Bowien B, Jedlicki E, Holmes DS.
1 Center for Bioinformatics and Genome Biology, MIFAB, Fundacion Ciencia para la Vida and Depto. de Ciencias Biologicas, Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, Chile 2 ICBM, Faculty of Medicine, University of Chile, Santiago, Chile

... Promoters of the ? 70 -type and rho- independent transcriptional stops were predicted for operons cbb1-4 using the programs BPROM (http://www.softberry.com) and Transterm [31], respectively. The organization of gene clusters in facultative and obligate autotrophs involved in ... 


BMC Microbiol.
2010 Jul 28;10:202.

Genetic and phenotypic diversity in Burkholderia: contributions by prophage and phage-like elements

Ronning et al.,
J Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA

... replication, and host lysis); (ii) promoter and terminator prediction analysis with BPROM (www. Softberry.com), PPP ( bioinformatics.biol.rug.nl/websoftware), PROMSCAN [35] or Promoter Prediction by Neural Network [36]; (iii) prediction of terminators with ... 


Antimicrobial Agents and Chemotherapy
October 2010, p. 4389-4393, Vol. 54, No. 10 doi:10.1128/AAC.00155-10

Overexpression of Resistance-Nodulation-Cell Division Pump AdeFGH Confers Multidrug Resistance in Acinetobacter baumannii

Sebastien Coyne, 1 Nicolas Rosenfeld, 1 Thierry Lambert, 1,2 Patrice Courvalin, 1* and Bruno Perichon 1
Institut Pasteur, Unite des Agents Antibacteriens, 75724 Paris Cedex 15,1 Centre d'Etudes Pharmaceutiques, Chatenay-Malabry, France2

... The HelixTurnHelix program (http://mobyle.pasteur.fr/) predicted the presence of a helix-turn-helix (HTH) DNA-binding motif between residues 11 and 32, typical of the LTTR family. Sequence analysis of the adeL-adeF intergenic region using BProm software (Softberry, Inc., ... 


J. Bacteriol.
2010 doi:10.1128/JB.00752-10

Radiation Desiccation Response Motif (RDRM) like sequences are involved in transcriptional activation of deinococcal ssb gene by ionizing radiation, but not by desiccation

Aman Kumar Ujaoney, Akhilesh A. Potnis, Pratiksha Kane, Rita Mukhopadhyaya, and Shree Kumar Apte

... 3a). In 179 silico analysis of 351 bp region upstream of ssb ORF using BPROM software 180 (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfin 181 db) predicted the putative -10 and -35 promoter like sequences, while manual sequence 182 ... 


Journal of Bacteriology
April 2010, p. 1965-1974, Vol. 192, No. 7 doi:10.1128/JB.01616-09

Analysis of the dbpBA Upstream Regulatory Region Controlled by RpoS in Borrelia burgdorferi

Zhiming Ouyang, Shayma Haq, and Michael V. Norgard
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas 75390

... When analyzing the 5' sequence upstream of the dbpBA operon using BPROM (http://linux1. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb), a bacterial 70 promoter recognition program, a typical bacterial 70 promoter harboring canonical –10/–35 ... 


Bioscience, Biotechnology, and Biochemistry
Vol. 74 (2010) , No. 8 pp.1564-1571 doi:10.1271/bbb.100135

Effects of Depletion of RNA-Binding Protein Tex on the Expression of Toxin Genes in Clostridium perfringens

Kimihiro ABE 1), Nozomu OBANA 1) and Kouji NAKAMURA 1)
1) Graduate School of Life and Environmental Sciences, University of Tsukuba

... Putative A10 (AATTACTAT) and A35 (TTTAAA) sequences were detected by BPROM software (http://linux1.softberry.com) 46 and 68nt up- stream of the translational start codon respectively. These data also suggest that tex is monocistronically transcribed. ... 


Appl Microbiol Biotechnol.
2010 Mar;86(2):567-76. Epub 2009 Oct 21

Analysis of extracellular alginate lyase and its gene from a marine bacterial strain, Pseudoalteromonas atlantica AR06

Matsushima et al.,
National Research Institute of Fisheries Science, Fisheries Research Agency, 2-12-4 Fukuura, Yokohama, 236-8648, Japan.

... www. generunner.net/). The promoter motifs and N-terminal signal peptide sequences were predicted by the BPROM (http:// linux1.softberry.com/berry.phtml) and PSORT (http://psort. hgc.jp/) programs, respectively. Homology ... 


Journal of Bacteriology
July 2010, p. 3780-3787, Vol. 192, No. 14 doi:10.1128/JB.00161-10

Regulation of High-Affinity Iron Acquisition Homologues in the Tsetse Fly Symbiont Sodalis glossinidius

Runyen-Janecky LJ, Brown AN, Ott B, Tujuba HG, Rio RV
Department of Biology, University of Richmond, Richmond, Virginia 23173,1 Department of Biology, West Virginia University, Morgantown, West Virginia 265062

... are shown. The putative –10/–35 sequences and the transcriptional initiation sites, identified using BPROM (www.softberry.com), are shown as straight lines and asterisks above the DNA sequences, respectively. The putative ... 


ournal of Experimental Microbiology and Immunology (JEMI)
2010 Vol. 14: 74-78

Confirmation of Caspase-3-Like-Protease, Clp, in Pseudomonas aeruginosa as an Individually Regulated Gene and its Involvement in Healthy Colony Formation

wenn Farrell, Alexis Handley, Carol Lewis and Alexander Sio
Department of Microbiology and Immunology, UBC

... high homology. The putative operon PA4577-fklB gene sequence found in the Pseudomonas Genome Database V2 was searched using BPROM on www.softberry.com for promoter and manually searched for stop codons. The ... 


Infection and Immunity
June 2010, p. 2607-2619, Vol. 78, No. 6 Epub 2010 Apr 12. doi:10.1128/IAI.00134-10

Francisella tularensis dpyrF Mutants Show that Replication in Nonmacrophages Is Sufficient for Pathogenesis In Vivo

Horzempa J, O'Dee DM, Shanks RM, Nau GJ
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261, USA

... 2. Promoter characterization of F. tularensis pyrF. (A) Genomic arrangement of pyrF where the three predicted –10 and –35 promoter regions are shaded (BPROM; www.softberry. ru). The start codon of pyrF is boxed and in boldface type. ...


Genetics
Vol. 185, 823-830, July 2010, doi:10.1534/genetics.110.114462

IscR Regulates RNase LS Activity by Repressing rnlA Transcription

Otsuka et al.,
* Department of Biological Sciences, Graduate School of Science, Osaka University, Osaka 560-0043, Japan and {dagger} Division of Life Science, Graduate School of Science and Engineering, Saitama University, Saitama 338-8570, Japan

... Although a promoter corresponding to these sites was not predicted by GENETYX, another program, BPROM (http://linux1.softberry.com/berry.phtml?topic=bprom&group= programs&subgroup=gfindb), identified a promoter matching these sites as transcription start ...


Journal of Molecular Biology
Volume 399, Issue 5, 25 June 2010, Pages 759-772 doi:10.1016/j.jmb.2010.04.040

A Bacterial GAP-Like Protein, YihI, Regulating the GTPase of Der, an Essential GTP-Binding Protein in Escherichia coli

Jihwan Hwang and Masayori Inouye
Department of Biochemistry, Center for Advanced Biotechnology and Medicine, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, 679 Hoes Lane, Piscataway, NJ 08854, USA

... The - 35, - 10, and Shine–Dalgarno regions are underlined. The putative promoter sequence was also predicted by using BPROM (available at http://www.softberry.com.). "+ 1" is the transcriptional start site, and "M" is the initiation methionine codon. ...


PLoS ONE
2010 5(1): e8601. doi:10.1371/journal.pone.0008601

Sequence Analysis of pKF3-70 in Klebsiella pneumoniae: Probable Origin from R100-Like Plasmid of Escherichia coli

Yi et al.,
1 Institute of Biomedical Informatics/Zhejiang Provincial Key Laboratory of Medical Genetics, Wenzhou Medical College, Wenzhou, China, 2 T-Life Research Center, Fudan University, Shanghai, China

... CD-search was used to identify the conserved domains in some uncharacterized proteins [47]. Promoters were predicted using BPROM (http://linux1.softberry.com/berry.phtml) and insertion sequences were predicted using IS-finder (http://www-is.biotoul.fr/is.html). ...


New Biotechnology
Volume 27, Issue 1, 28 February 2010, Pages 1-9 doi:10.1016/j.nbt.2009.12.003

Isolation of novel Pseudomonas syringae promoters and functional characterization in polyhydroxyalkanoate-producing pseudomonads

Daniel K.Y. Solaiman and Bryan M. Swingle
1 Eastern Regional Research Center, Agricultural Research Service, U.S. Department of Agriculture, 600 E. Mermaid Lane, Wyndmoor, PA 19038, USA 2 R.W. Holley Center for Agriculture and Health, Agricultural Research Service, U.S. Department of Agriculture, Tower Rd., Ithaca, NY 14853-2901, USA

... 4a). We next subjected the sequence in pBS29-P2-gfp that includes the P2 promoter and the coding region of the gfp gene to a promoter and transcription factor (TF) analysis using a BPROM program (www.softberry.com, Mount Kisco, NY, USA). ...


PLoS ONE
2010 5(5): e10877. doi:10.1371/journal.pone.0010877

The GimA Locus of Extraintestinal Pathogenic E. coli: Does Reductive Evolution Correlate with Habitat and Pathotype?

Homeier T, Semmler T, Wieler LH, Ewers C
1 Institute for Microbiology and Epizootics, Veterinary Faculty, Free University Berlin, Berlin, Germany, 2 Institute of Animal Hygiene and Veterinary Public Health, Faculty of Veterinary Medicine, University of Leipzig, Leipzig, Germany

... in the remnant. Additionally, using the BPROM promoter prediction tool (provided on http://linux1.softberry.com) we could identify a transcriptional factor binding site upstream of the start codon (data not shown). However, it is ...


Carbohydrate Research
Volume 345, Issue 10, 2 July 2010, Pages 1422-1431 doi:10.1016/j.carres.2010.04.010

Cell surface display of chimeric glycoproteins via the S-layer of Paenibacillus alvei

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 50 Bacterial promoters, transcriptional terminators, operons and genes were 1 predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in 2 Molquest software (SoftBerry, Mount Kisco, NY, USA). ...


Glycobiology
20 (6): 787-798. doi: 10.1093/glycob/cwq035

Protein tyrosine O-glycosylation—A rather unexplored prokaryotic glycosylation system

Zarschler et al.,
Department fur NanoBiotechnologie, Vienna Institute of BioTechnology, Universitat fur Bodenkultur Wien, Muthgasse 11, A-1190 Vienna, Austria

... 2000). Bacterial promoters, transcriptional terminators, operons and ORFs were predicted by the BProm and FindTerm modules of the FGenesB gene prediction program in Molquest software (SoftBerry Inc., Mount Kisco, NY). ...


Molecular Microbiology
Volume 77, Issue 4, pages 1009–1020, August 2010 DOI: 10.1111/j.1365-2958.2010.07269.x

Functional amyloid in Pseudomonas

Dueholm et al.,
1 Centre for Insoluble Protein Structures, Interdisciplinary Nanoscience Center (iNANO), Department of Molecular Biology, University of Aarhus (iNANO), 8000 Aarhus C, Denmark 2 Department of Biotechnology, Chemistry, and Environmental Engineering, Aalborg University, 9000 Aalborg, Denmark

... Sequence coverage was calculated by reference genome assembly of reads to the aligned sequence using the CLC Genomics Workbench 3.0.1. Promotor regions were predicted using BPROM (http://linux1.softberry.com/berry.phtml). Cloning of pMMB190-UK4fapA–F. ...


BMC Microbiology
2010, 10:153 doi:10.1186/1471-2180-10-153

Transcriptome analysis of the mobile genome ICEclc in Pseudomonas knackmussii B13

Gaillard M, Pradervand N, Minoia M, Sentchilo V, Johnson DR, van der Meer JR.
1 Department of Fundamental Microbiology, University of Lausanne, Batiment Biophore, Quartier UNI-Sorge, 1015 Lausanne, Switzerland

... Bioinformatic tools. Putative promoters, terminators and transcription factor binding sites were predicted by using the BPROM and FindTerm programs on http://www.Softberry.com. The map of ICEclc was designed from SeqBuilder of the Lasergene software package ...


Journal of Bacteriology
January 2009, p. 333-346, Vol. 191, No. 1

Characterization of YmgF, a 72-Residue Inner Membrane Protein That Associates with the Escherichia coli Cell Division Machinery

Gouzel Karimova, Carine Robichon, and Daniel Ladant
Institut Pasteur, CNRS URA 2185, Unite de Biochimie des Interactions Macromoleculaires, Departement de Biologie Structurale et Chimie, 25 rue du Dr Roux, Paris Cedex 15, France

... Bacterial promoter recognition programs (E. coli promoter map from nostradamus.cs.rhul. ac.uk/vigen (30); BPROM from SoftBerry, Inc.) predicted a putative promoter within a 60-bp DNA fragment immediately upstream from the ymgF ORF start codon. ...


Nucleic Acids Research
2009 37(6):e46; doi:10.1093/nar/gkp080

Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA depletion and parallel sequencing

Liu et al.,
1HHMI and Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, MA 02111, 2HHMI and Channing Laboratory, Boston, MA 02115 and 3Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA

... several sRNAs (IGR4, IGR6) were not identified in other bacteria by BLASTN analysis (Table 2). In addition, we analyzed the candidate sRNAs for nearby promoters and Rho-independent terminators using BPROM and FindTerm software available from Softberry (Mount Kisco ...


Journal of Bacteriology
July 2009, p. 4427-4440, Vol. 191, No. 13

A Metabolic Operon in Extraintestinal Pathogenic Escherichia coli Promotes Fitness under Stressful Conditions and Invasion of Eukaryotic Cells

Rouquet et al.,
INRA, UR1282, Unite d'Infectiologie Animale et de Sante Publique, Laboratoire de Pathogenie Bacterienne, Centre de Recherche de Tours, F-37380 Nouzilly, France

... program. Putative 70 transcriptional promoters (bent arrows) and transcriptional terminators ( ) were predicted with the BPROM (SoftBerry, Inc.) and the mfold (www.bioinfo.rpi.edu/ ~ zukerm/rna/) programs, respectively. Direct ...


Archives of Microbiology
Volume 191, Number 5 / May, 2009, pp. 441-450

Localization and characterization of VVA0331, a 489-kDa RTX-like protein, in Vibrio vulnificus YJ016

Li-Fang Chou 1 , Hwei-Ling Peng2, Yu-Chung Yang 2, Min-Chieh Kuo 1 and Hwan-You Chang 1
(1) Institute of Molecular Medicine, National Tsing Hua University, Hsin Chu, Taiwan, ROC (2) Department of Biological Science and Technology, National Chiao Tung University, 300 Hsin Chu, Taiwan, ROC

... 2005) and the program BPROM (SoftBerry, Mount Kisco, NY). Our results demonstrate that VVA0331 protein was secreted from V. vulniWcus YJ016 in exponential growth phase. Nevertheless, the functional roles of VVA0331 Fig. ...


PLoS Genet.
2009 March; 5(3): e1000439.

A Toxin–Antitoxin System Promotes the Maintenance of an Integrative Conjugative Element

Rachel A. F. Wozniak 1,2,3 and Matthew K. Waldor 1,2,3*
1Channing Laboratory, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts, United States of America 2Howard Hughes Medical Institute, Chevy Chase, Maryland, United States of America

... 5? RACE experiments to identify the +1 nucleotide of the mosA transcript (Figure 5B) suggested that the true mosA transcript begins upstream from the original annotation (Figure 5). Promoter and ORF predictions (BProm, FGENESB; http://linux1.softberry.com/berry.phtml) for ...


Journal of Bacteriology
April 2009, p. 2530-2540, Vol. 191, No. 8

Interplay between Two RND Systems Mediating Antimicrobial Resistance in Brucella suis

Martin et al.,
Fundacion Instituto Leloir, IIBBA CONICET and FCEyN, Universidad de Buenos Aires, Patricias Argentinas 435, (C1405BWE) Buenos Aires, Argentina,1 Instituto de Biotecnologia, CICVyA, INTA-Castelar, Las Cabanas y Los Reseros s/n (B1712WAA) Castelar, Buenos Aires, Argentina,2

... bepDE. Our analysis using the promoter prediction software BPROM (SoftBerry Inc.) indicated the presence of two overlapping and divergent putative promoters within the 172-bp intergenic region between bepR and bepD (Fig. ...


BMC Microbiology
2009, 9:247 doi:10.1186/1471-2180-9-247

Transcriptional analysis of the jamaicamide gene cluster from the marine cyanobacterium Lyngbya majuscula and identification of possible regulatory proteins

Adam C Jones 1, Lena Gerwick 1, David Gonzalez 2,3, Pieter C Dorrestein 2,3,4,5 and William H Gerwick *1,5
1Center for Marine Biotechnology and Biomedicine, Scripps Institution of Oceanography, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093 USA, 2Department of Chemistry, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093 USA

... [22]. A software prediction program (BPROM, www.softberry.com) was used to predict ... for conserved binding regions (in comparison to the?70 E. coliconsensus promoter) using the BPROM predictor (www.softberry.com; Table 1). The upstream (up-) regions of genes ...


Gene
Volume 442, Issues 1-2, 1 August 2009, Pages 1-7

Characterization of the Haloarcula hispanica amyH gene promoter, an archaeal promoter that confers promoter activity in Escherichia coli

Zeng et al.,
aState Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan 430072, PR China bSchool of Biology and Pharmaceutical Engineering, Wuhan Polytechnic University, Wuhan 430023, PR China

... In addition, computer analysis of the 5?-flanking region using the BPROM program (http://www.softberry.com) revealed a typical E. coli ? 70 promoter structure located ? 86 to ? 59 bp upstream of the amyH start codon, where the putative ? 10 box (TAGAAT) matches the ...


Journal of Bacteriology
March 2009, p. 1933-1940, Vol. 191, No. 6

Analysis by Mutagenesis of a Chromosomal Integron Integrase from Shewanella amazonensis SB2BT

Andre Larouche 1,2 and Paul H. Roy 1,2
Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec,1 Departement de Biochimie et de Microbiologie, Faculte des Sciences et de Genie, Universite Laval, Quebec, Canada2

... There is no ORF between attC2 and attC3. The promoter recognition program BPROM sigma70 (http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) indicates that a mobile promoter region could be within this cassette. ...


Antimicrobial Agents and Chemotherapy
May 2009, p. 1998-2004, Vol. 53, No. 5

Genetic Organization of Transposase Regions Surrounding blaKPC Carbapenemase Genes on Plasmids from Klebsiella Strains Isolated in a New York City Hospital

Gootz et al.,
Department of Infectious Diseases,1 Molecular Biology, Pfizer Global Research and Development, Groton, Connecticut 06340

... primers: CETnF1 (5'-CATGGCGTAGGTTGTTGTCGC) and CETnR1 (5'- GCGGCAGAAGCCAAAATCG). Promoter analysis for all 15 bla KPC genes was determined using the BProm software (http://www.softberry.com). RESULTS. ...


Journal of Bacteriology
January 2009, p. 403-410, Vol. 191, No. 1

The AsaP1 Peptidase of Aeromonas salmonicida subsp. achromogenes Is a Highly Conserved Deuterolysin Metalloprotease (Family M35) and a Major Virulence Factor

Arnadottir et al.,
Institute for Experimental Pathology, University of Iceland, Keldur v/Vesturlandsveg, IS-112 Reykjavik, Iceland,1 Institute for Veterinary Bacteriology, University of Bern, Langastrasse 122, Postfach, CH-3001, Bern, Switzerland2

... html). Prediction of promoter sequences was performed with the software Prediction of Bacterial Promoters (BPROM) (Softberry) and Prokaryotic Promoter Prediction (PPP) (http://bioinformatics.biol.rug.nl/websoftware/ppp). The ...


Applied and Environmental Microbiology
October 2009, p. 6581-6590, Vol. 75, No. 20

ACC (1-Aminocyclopropane-1-Carboxylate) Deaminase Activity, a Widespread Trait in Burkholderia Species, and Its Growth-Promoting Effect on Tomato Plants

Janette Onofre-Lemus,1 Ismael Hernandez-Lucas,2 Lourdes Girard,1 and Jesus Caballero-Mellado1
Centro de Ciencias Genomicas, Universidad Nacional Autonoma de Mexico, Ap. Postal No. 565-A, Cuernavaca, Morelos, Mexico,1 Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Cuernavaca, Morelos, Mexico2

... In silico analysis of the resulting sequence was performed with the programs FGENESB, BPROM (http://linux1.softberry.com/berry.phtml), and virtual footprint promoter analysis version 3.0 (http://www.prodoric.de/vfp/vfp_promoter.php). ...


Applied and Environmental Microbiology
July 2009, p. 4506-4515, Vol. 75, No. 13

bdhA-patD Operon as a Virulence Determinant, Revealed by a Novel Large-Scale Approach for Identification of Legionella pneumophila Mutants Defective for Amoeba Infection

P. Aurass, B. Pless, K. Rydzewski, G. Holland, N. Bannert, and A. Flieger
Robert Koch Institute, Berlin, Germany

... _legion). Nucleotide sequences were also analyzed for promoters using the Web-based program BPROM (www.softberry.com) and for secretion signals using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP). ...


BMC Microbiol.
2009 Jul 27;9:151.

A new cold-adapted beta-D-galactosidase from the Antarctic Arthrobacter sp. 32c - gene cloning, overexpression, purification and properties

Hildebrandt P, Wanarska M, Kur J.
Department of Microbiology, Chemical Faculty, Gdansk University of Technology, Narutowicza 11/12, 80-952 Gdansk, Poland.

... 32c b-D-galactosidase gene with the promoter prediction tool (BPROM software, http://www.softberry.com) revealed a potential promoter sequence with CTTACA and TACAAT as -35 and -10 sequences, respectively. A putative ribosomal binding site was ...


Current Genetics
Volume 55, Number 5 / October, 2009, pp. 583-591

Identification of transcribed and persistent variants of the psbA gene carried by plastid minicircles in a dinoflagellate

Satoko Iida 1, Atsushi Kobiyama 2, Takehiko Ogata 2 and Akio Murakami 1
1) Kobe University Research Center for Inland Seas, 2746 Iwaya, Awaji 656-2401, Japan (2) School of Marine Biosciences, Kitasato University, 160-4 Okiraiazautou, Sanriku, Ofunato 022-0101, Japan

... nlm.nih.gov/projects/gorf/). A start codon was assigned based on sequence alignment, upstream in-frame TAG and no ATG around the psbA 5 end. Predictions of prokary- otic-type promoters were performed using BPROM pro- grams (http://www.softberry.com). ...


FEMS Microbiol Lett.
2009 Jun;295(1):96-102.

Transcriptome analysis of Escherichia coli O157:H7 EDL933 during heat shock

Carruthers MD, Minion C.
Department of Veterinary Microbiology and Preventive Medicine, Iowa State University, Ames, IA, USA.

... Z5121). Motifs were deemed significant if identified by BIOOPTIMIZER using both MEME and BIOPROSPECTOR output as input. BPROM (http:// www.softberry.com) was used for promoter prediction. Validation of microarray data ...


Nucleic Acids Research
2009 37(16):5465-5476; doi:10.1093/nar/gkp501

Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence

Homologs of the small RNA SgrS are broadly distributed in enteric bacteria but have diverged in size and sequence
Department of Microbiology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA

... determined (15,28). In addition, promoter predictions were generated using the Softberry BPROM network server and the Neural Network Promoter Prediction by the BDGP using prokaryotic settings. The sequences analyzed ...


BMC Microbiology
2009, 9:7doi:10.1186/1471-2180-9-7

Characterization of the meningococcal DNA glycosylase Fpg involved in base excision repair

Tibballs et al.,
1 Centre for Molecular Biology and Neuroscience and Institute of Microbiology, University of Oslo, Rikshospitalet, NO-0027 Oslo, Norway 2 Institute of Microbiology, Rikshospitalet, NO-0027 Oslo, Norway

... Putative promoters were identified with the transcription promoter predictor available at the Berkeley Drosophila Genome Project http://www.fruitfly.org/seq_tools/promoter.html webcite and the BPROM predictor of bacterial promoters http://www.softberry.com/berry.phtml webcite ...


In Silico Biology
Volume 9, Number 1-2 / 2009, pp. S1-S16

Analysis of n-Gram based Promoter Recognition Methods and Application to Whole Genome Promoter Prediction

T. Sobha Rani 1, Raju S. Bapi 1
1Computational Intelligence Lab, Department of Computer and Information Sciences, University of Hyderabad, Hyderabad, India

... TATA box and Inr (Neural Network Promoter Predictor, indicated as a tool for promoter prediction of both prokaryotes and eukaryotes) (http://www.fruitfly.org/seq tools/promoter.html), BPROM uses functional motifs and oligonucleotide information (http://www.softberry.com/berry ...


Journal of Microbiological Methods
Volume 79, Issue 1, October 2009, Pages 23-31

Characterization of pNC1, a small and mobilizable plasmid for use in genetic manipulation of Desulfovibrio africanus

I. Nydia Castaneda-Carrion, Marvin Whiteley and Lee R. Krumholz
aDepartment of Botany and Microbiology, University of Oklahoma, Norman, OK 73019, United States bSection of Molecular Genetics and Microbiology, University of Texas at Austin, Austin, TX 78712, United States

... et al., 2002). ORFs greater than 300 nucleotides long were compared to the GenBank protein database using the blastp algorithm (Altschul et al., 1997). Promoters were detected by BPROM from Softberry. Direct repeats and ...


Appl. Environ. Microbiol.
doi:10.1128/AEM.01864-09 2009

Functional genomic analysis of two Staphylococcus aureus phages isolated from the dairy environment

Garcia et al.,
Instituto de Productos Lacteos de Asturias (IPLA-CSIC). Apdo. 85. 33300- Villaviciosa, Asturias, Spain; Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven, Belgium;

... YASPIN (http://www.ibi.vu.nl/programs/yaspinwww/). s70 promoter sequences were identified using Bprom (http://www.softberry.com) and PPP (Prokaryotic Promoter Prediction, http://bioinformatics.biol.rug.nl/websoftware/ppp/ppp_start.php). Putative ...


The Journal of Infectious Diseases
2009;199:513–521

Penicillin-Binding Protein 7/8 Contributes to the Survival of Acinetobacter baumannii In Vitro and In Vivo

Russo et al.,
Veterans Administration Western New York Healthcare System and 2The Witebsky Center for Microbial Pathogenesis

... Finally, a promoter prediction analysis was performed on the 5' DNA sequence to the predicted transcriptional start site of pbpG (BPROM [SoftBerry]; available at: http://www.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Journal of Bacteriology
May 2009, p. 3142-3148, Vol. 191, No. 9 doi:10.1128/JB.01575-08

Isolation and Characterization of Azotobacter vinelandii Mutants Impaired in Alkylresorcinol Synthesis: Alkylresorcinols Are Not Essential for Cyst Desiccation Resistance

Segura et al.,
Departamento de Microbiologi'a Molecular, Instituto de Biotecnologi'a, Universidad Nacional Auto'noma de Me'xico, Cuernavaca, Morelos, Me'xico,1 Centro de Investigaciones en Ciencias Microbiolo'gicas, Beneme'rita Universidad Auto'noma de Puebla, Puebla, Me'xico2

... nucleotides in each case. In addition, no promoter consensus sequences were identified in the 83-nucleotide intergenic arsA-arsB sequence (SoftBerry BPROM program; http://linux1.softberry.com/berry.phtml). Because a mutation ...


Plasmid
Volume 62, Issue 1, July 2009, Pages 44-49

Characterization of a cryptic plasmid pSFKW33 from Shewanella sp. 33B

Katarzyna Werbowy a, Hubert Cies'lin'ski a, and Jo'zef Kur
aDepartment of Microbiology, Chemical Faculty, Gdan'sk University of Technology, Narutowicza 11/12, 80-952 Gdan'sk, Poland

... The prediction of bacterial promoters was carried out with BPROM software (www.softberry.com). ... Furthermore, the analysis of DNA sequence upstream ORF3 with the promoter prediction tool (BPROM software, http://www.softberry.com) revealed a potential promoter sequence. ...


Biochem. J.
2009, 418, 431–441 (Printed in Great Britain) doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

KHURANA et al.,
CSIRO Entomology, Canberra, ACT 2601, Australia, and †Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia

... Genomic and phylogenetic analysis FGENESB (http://www.softberry.com) was used to detect ORFs (open reading frames), which were then manually confirmed. ... Identification of promoters utilized the program BPROM (http://www.softberry.com). ...


Journal of Bacteriology
October 2009, p. 5953-5963, Vol. 191, No. 19 doi:10.1128/JB.00647-09

The pgaABCD Locus of Acinetobacter baumannii Encodes the Production of Poly-?-1-6-N-Acetylglucosamine, Which Is Critical for Biofilm Formation

Alexis H. K. Choi, Leyla Slamti, Fikri Y. Avci, Gerald B. Pier, and Tomas Maira-Litran
Channing Laboratory, Department of Medicine, Brigham and Women's Hospital, Harvard Medical School, Boston, Massachusetts

... of molecular biology applications (http://www.emboss.org/). Promoter prediction was done with BPROM (http://www.softberry.com/all.htm) (Softberry, Inc., Mt. Kisco, NY). PNAG purification. PNAG was prepared from a 6-liter culture ...


Microbiology
155 (2009), 2490-2497; DOI 10.1099/mic.0.027433-0

SoxS regulates the expression of the Salmonella enterica serovar Typhimurium ompW gene

Hernandez-Lucas et al.,
1 Laboratorio de Microbiologi'a Molecular, Departamento de Ciencias Biolo'gicas, Universidad Andre's Bello, Santiago, Chile 2 Departamento de Microbiologi'a Molecular, Instituto de Biotecnologi'a, Universidad Nacional Auto'noma de Me'xico, Cuernavaca, Mexico 3 Laboratorio de Bioqui'mica, Departamento de Ciencias Biolo'gicas, Universidad Andre's Bello, Santiago, Chile

... To support these results, a bioinformatic search was performed using the Softberry BPROM program (www.softberry.com/berry.phtml? Topic=bprom). Thus, a 400 bp region upstream of the start codon was analysed for putative -35 and -10 promoter regions. ...


Appl. Environ. Microbiol.
2009 doi:10.1128/AEM.01366-09

Long term survival of Campylobacter jejuni at low temperature is dependent on polynucleotide phosphorylase activity

Nabila Haddad et al.,
Division

... 210 Transcriptional start site was predicted using Softberry BPROM program 211 (http://linux1.softberry.com/cgi-bin/programs/gfindb/bprom.pl). ... Therefore, a putative transcriptional start site was identified 100 bp from the start codon by 242 Softberry-BPROM programme (Fig. ...


Applied and Environmental Microbiology
March 2009, p. 1471-1477, Vol. 75, No. 6

Role of proP and proU in Betaine Uptake by Yersinia enterocolitica under Cold and Osmotic Stress Conditions

Thirunavukkarasu Annamalai 1 and Kumar Venkitanarayanan 2
Department of Biochemistry and Molecular Biology, New York Medical College, Valhalla, New York 10595,1 Department of Animal Science, Unit 4040, University of Connecticut, Storrs, Connecticut 062692

... extracted plasmid DNA. The sequences generated were analyzed by using Sequencher 4.1.4 (Gene Codes Corporation, Ann Arbor, MI), BPROM (http://www. softberry.com), ClustalW (EMBnet), and Blastn (NCBI). View this table ...


Biochem. J.
2009, 418, 431–441 (Printed in Great Britain) doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

KHURANA et al.,
CSIRO Entomology, Canberra, ACT 2601, Australia, and †Research School of Chemistry, Australian National University, Canberra, ACT 0200, Australia

... Genomic and phylogenetic analysis FGENESB (http://www.softberry.com) was used to detect ORFs (open reading frames), which were then manually confirmed. ... Identification of promoters utilized the program BPROM (http://www.softberry.com). ...


J Bacteriol.
2009 Vol. 191, No. 1, p. 210-219

Interaction between bacteriophage DMS3 and host CRISPR region inhibits group behaviors of Pseudomonas aeruginosa

Zegans et al.
Dept. of Microbiology & Immunology, Rm 505 Vail Building, Dartmouth Medical School, Hanover, NH 03755; Department of Surgery, Dartmouth-Hitchcock Medical Center, Lebanon, NH 03756

... the forward 161 and reverse strands, and with BPROM bacterial promoter predictor (Softberry, Mt. Kisco, NY; 162 http://www.softberry ...


Journal of Bacteriology
January 2009, p. 545-554, Vol. 191, No. 2

Characterization of the myo-inositol utilization island of 2 Salmonella enterica serovar Typhimurium

Kroger C, Fuchs TM
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Technische Universitat Munchen, Weihenstephaner Berg 3, D-85354 Freising, Germany

.. species. Promoter sequences located upstream of the identified genes were predicted with 114 BPROM (http://www.softberry.com/). 115 ...


Appl. Environ. Microbiol.
2008. doi:10.1128/AEM.01644-08

Characterizing the role of proP and proU in betaine uptake by Yersinia enterocolitica during cold and osmotic stress

Thirunavukkarasu Annamalai and Kumar Venkitanarayanan
Department of Biochemistry and Molecular Biology, New York Medical College Valhalla, NY 10595; Department of Animal Science, Unit-4040, University of Connecticut, Storrs 06269

... The sequences generated were analyzed by Sequencher 2 4.1.4 (Gene Codes Corporation, Ann Arbor, MI), BPROM (http://www.softberry.com), 3 ...


In Silico Biology
8, 0042 (2008)

Analysis of n-gram based promoter recognition methods and application to whole genome promoter prediction

T. Sobha Rani and Raju S. Bapi
Computational Intelligence Lab, Department of Computer and Information Sciences, University of Hyderabad, Hyderabad, India

... and eukaryotes) (http://www.fruitfly.org/seq_tools/promoter.html), BPROM uses functional motifs and oligonucleotide information (http://www.softberry.com/berry ...


Genes & Dev.
2008. 22: 3497-3508 doi: 10.1101/gad.1729508

YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity

Kwang-sun Kim, Robert Manasherob, and Stanley N. Cohen
Department of Genetics, Stanford University School of Medicine, Stanford, California 94305, USA

... 2007), as well as ymdB, were identified using BPROM (Softberry, Inc.)-which detects consensus sequences for RNA polymerase ? 70 recognition sites (Campbell ...


BMC Microbiol.
2008; 8: 214. doi: 10.1186/1471-2180-8-214.

Insecticidal genes of Yersinia spp.: taxonomical distribution, contribution to toxicity towards Manduca sexta and Galleria mellonella, and evolution

Fuchs et al.,
Zentralinstitut fur Ernahrungs- und Lebensmittelforschung (ZIEL), Abteilung Mikrobiologie, Germany

... TREECON [28]. Promoter sequences located upstream of the identified genes were deduced with BPROM http://www.softberry.com/. The ...


BMC Genomics
2008, 9:229 doi:10.1186/1471-2164-9-229

Photorhabdus luminescens genes induced upon insect infection

Anna Munch, Lavinia Sting, Kirsten Jung and Ralf Heermann
1Ludwig-Maximilians-Universitat Munchen, Department Biologie I, Bereich Mikrobiologie, Maria-Ward-Str. 1a, D-80638 Munchen, Germany, 2Munich Center for Integrated Protein Science (CIPSM), Ludwig-Maximilians-Universitat Munchen, Munchen, Germany,

.. analysis using the software BProm. ... BProm within the sequence of clone 1. In summary, 29 promoters of different genes or operons ...


Antimicrob Agents Chemother.
2008 Jul;52(7):2573-80. Epub 2008 Apr 28

Acquisition of a plasmid-borne blaOXA-58 gene with an upstream IS1008 insertion conferring a high level of carbapenem resistance to Acinetobacter baumannii

Chen TL, Wu RC, Shaio MF, Fung CP, Cho WL
Division of Infectious Diseases, Department of Internal Medicine, Taipei Veterans General Hospital, Taipei, Taiwan

... RACE fragments and conserved motifs. Promoter sequences were identified using the BPROM program. RT-PCR. Bacterial RNA was isolated ...


J Bacteriol.
2008 Oct 24. [Epub ahead of print]

The AsaP1 peptidase of Aeromonas salmonicida subsp. achromogenes is a highly conserved deuterolysin metalloprotease (family M35) and a major virulence factor

Arnadottir et al.

.. Prediction of Bacterial Promoters (BPROM), http://www.softbery.com, and Prokaryotic 145 ACCEPTED at Google Indexer on November 18, 2008 jb.asm.org ...


Mol Genet Genomics.
2008 Jul;280(1):59-72. Epub 2008 Apr 30

Global consequences of phosphatidylcholine reduction in Bradyrhizobium japonicum.

Hacker S, Godeke J, Lindemann A, Mesa S, Pessi G, Narberhaus F.
Lehrstuhl fur Biologie der Mikroorganismen, Ruhr-Universitat Bochum, NDEF 06/783, 44780 Bochum, Germany.

The BPROM program (http://www.softberry.com/berry.phtml) predicts a s70-type-10 promotor region (TACAAT) located about 85 bp upstream from the ATG start codon.


Appl Environ Microbiol.
2008 Jan;74(1):336-41. Epub 2007 Nov 16

Genomic markers for differentiation of Francisella tularensis subsp. tularensis A.I and A.II strains.

Molins-Schneekloth CR, Belisle JT, Petersen JM
Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases, Bacterial Diseases Branch, 3150 Rampart Road, Fort Collins, CO 80521, USA

.. RDs within intergenic regions were analyzed for putative promoter sequences (BPROM). See Table S2 in the supplemental material for a summary of this analysis. ...


Appl Environ Microbiol.
2008 Dec;74(24):7552-60. Epub 2008 Oct 24

Isolation of new stenotrophomonas bacteriophages and genomic characterization of temperate phage s1

Garcia et al.
Area de Microbiologi'a, Facultad de Medicina, Universidad de Oviedo, Asturias, Spain.

... (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Likely ? 70 target promoter 19 sequences were identified using Bprom (http://www.softberry.com). Putative 20 ...


FEMS Microbiol Lett.
2008 Jun;283(1):36-41

Effect of growth conditions on poly-N-acetylglucosamine expression and biofilm formation in Escherichia coli

Cerca N, Jefferson KK
Department of Microbiology and Immunology, Virginia Commonwealth University, Richmond, VA, USA

... We investigated the possible role of other regulators in pga expression, and analysis of the pga promoter region using the BPROM online promoter analysis tool ...


Biochem. J.
(2008) Immediate Publication, doi:10.1042/BJ20081488

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup

Khurana et al.
Division of Entomology, CSIRO, Canberra, ACT 2601, Australia.

.. Search Tools (BLAST; [23]). Identification of promoters utilised the program BPROM (http://www.softberry.com). BioEdit version 7.0 ...


Antimicrob Agents Chemother.
2008 Jul;52(7):2473-9. Epub 2008 Apr 28

Functional diversity among metallo-beta-lactamases: characterization of the CAR-1 enzyme of Erwinia carotovora

Stoczko M, Frere JM, Rossolini GM, Docquier JD
Dipartimento di Biologia Molecolare, Laboratorio di Fisiologia e Biotecnologia dei Microrganismi, Universita` di Siena, I-53100, Siena, Italy

... predicted using SignalP (version 3.0) (5). Putative promoter sequences and binding sites for regulatory proteins were performed using bprom software (Softberry ...


Appl Environ Microbiol.
2008 Apr;74(7):2161-70. Epub 2008 Feb 1.

Characterization and application of a glucose-repressible promoter in Francisella tularensis

Horzempa J, Tarwacki DM, Carlson PE Jr, Robinson CM, Nau GJ.
Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine, E1256 BSTWR, 200 Lothrop St., Pittsburgh, PA 15261, USA.

... An analysis of the FGRp sequence near and upstream of the truncation of pTC3Dt3 with the BPROM program (Softberry) revealed the presence of putative -10 and ...


Antimicrob Agents Chemother.
2008 Apr;52(4):1472-80. Epub 2008 Feb 11

Different pathways to acquiring resistance genes illustrated by the recent evolution of IncW plasmids

Revilla et al.
Departamento de Biologi'a Molecular e Instituto de Biomedicina y Biotecnologi'a de Cantabria, Universidad de Cantabria-CSIC-IDICAN, C. Herrera Oria s/n, 39011 Santander, Spain.

... promoter is located upstream of aadA13 in the 'osa region (detected using the bacterial promoter prediction BPROM program at http://www.softberry.com) (see Fig ...


Microbiology.
2008 May;154(Pt 5):1372-83.

Instability of the Salmonella RcsCDB signalling system in the absence of the attenuator IgaA

Mariscotti JF, Garci'a-Del Portillo F.
Departamento de Biotecnologi'a Microbiana, Centro Nacional de Biotecnologi'a-Consejo Superior de Investigaciones Cienti'ficas (CSIC), Darwin 3, 28049 Madrid, Spain

... The BPROM program, which predicts 70 promoter sites (http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb), was used to analyse in ...


J Bacteriol.
2008 Mar;190(6):2096-105. Epub 2008 Jan 11

Regulation of type IV secretion apparatus genes during Ehrlichia chaffeensis intracellular development by a previously unidentified protein

Cheng Z, Wang X, Rikihisa Y.
Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, 1925 Coffey Road, Columbus, OH 43210-1093, USA

... sites and 70 -like promoter elements of virB8-2, virB9-2, and virB4-2 upstream of these three genes were predicted by the BPROM program (Softberry, Inc., Mount ...


J Bacteriol.
2008 Jul;190(13):4559-67. Epub 2008 May 9.

Lactobacillus reuteri DSM 20016 produces cobalamin-dependent diol dehydratase in metabolosomes and metabolizes 1,2-propanediol by disproportionation

Sriramulu et al.
Department of Microbiology, University College Cork, Cork, Ireland

... 26). Promoter prediction was performed with BPROM (software available from SoftBerry (Mount Kisco, NY). Primer extension analysis. ...


Research in Microbiology
2008 May;159(4):270-8. Epub 2008 Mar 29

The omp50 gene is transcriptionally controlled by a temperature-dependent mechanism conserved among thermophilic Campylobacter species

Dedieu L, Pages JM, Bolla JM.
UMR-MD-1, IFR 48, Faculte de Medecine, Universite' de la Mediterranee, 27 Boulevard Jean Moulin, Marseille Cedex 5, France

... codon of the C. jejuni NCTC 11168 strain was computer-analyzed using a bacterial promoter prediction tool (BPROM at the URL: http://www.softberry.com/berry ...


Microbiology.
2008 Jun;154(Pt 6):1719-28.

flhDC, but not fleQ, regulates flagella biogenesis in Azotobacter vinelandii, and is under AlgU and CydR negative control

Leon R, Espin G
Departamento de Microbiologia Molecular, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo Postal 510-3, Cuernavaca, Morelos 62250, Mexico.

... For putative RpoD (sigma 70)-recognized promoters, we used BPROM (http://www.softberry. com/berry.phtml), which is a program for the prediction of bacterial ...


Infect Immun.
2008 Jul 21

A tripartite efflux pump involved in gastrointestinal colonization by Klebsiella pneumoniae confers a tolerance response to inorganic acid

Sophie Coudeyras, Laurence Nakusi, Nicolas Charbonnel, Christiane Forestier
Univ Clermont 1, UFR Pharmacie, Laboratoire de Bacte'riologie, Clermont-Ferrand, France.

... A promoter consensus sequence was detected upstream of the eefX start codon (-35 : CTTTCC; -10 : TCGTATAAT, softberry bprom). Analysis ...


Antimicrob Agents Chemother.
2008 May;52(5):1703-12. Epub 2008 Feb 25

Transcriptional and translational control of the mlr operon, which confers resistance to seven classes of protein synthesis inhibitors

Smith LK, Mankin AS.
Center for Pharmaceutical Biotechnology, m/c 870, University of Illinois, 900 S. Ashland Ave., Chicago, IL 60607, USA

... Analysis of the nucleotide sequence of the erm(B)-cfr intergenic spacer with the BPROM algorithm of the Softberry genome analysis suite (http://softberry.com ...


Infect Immun.
2008 Sep;76(9):4000-8. Epub 2008 Jun 23

Genome of Mycoplasma arthritidis

Dybvig et al.
Department of Genetics, University of Alabama Birmingham, Birmingham, Alabama 35294-0024, USA.

... Potential promoters in genes containing upstream poly(T) or poly(A) tracts were identified using BPROM at http://www.softberry.com/berry.phtml. ...


Infect Immun.
2008 Nov;76(11):5392-401. Epub 2008 Sep 2

Analysis of the isoprenoid biosynthesis pathways in Listeria monocytogenes reveals a role for the alternative 2-C-methyl-D-erythritol 4-phosphate pathway in murine infection.

Begley et al.
Alimentary Pharmabiotic Centre, Department of Microbiology, University College Cork, Cork, Ireland

... Predicted promoter regions were analyzed using BPROM (http://www.softberry. com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb). ...


Expert Opinion on Drug Discovery
August 2008, Vol. 3, No. 8, Pages 903-929 (doi:10.1517/17460441.3.8.903)

Systems biology of cyanobacterial secondary metabolite production and its role in drug discovery

Nishikant V Wase & Phillip C Wright
The University of Sheffield, Biological and Environmental Systems Group, Department of Chemical and Process Engineering, Mappin St., Sheffield, S1 3JD, UK +44 0 114 2227577; +44 0 114 2227501

... of software packages found on Softberry [63], including fgenesB [64] (Pattern/Markov chain-based bacterial operon and gene prediction), BPROM [65] (Prediction ...


Infection and Immunity
August 2008, p. 3587-3594, Vol. 76, No. 8 doi:10.1128/IAI.01568-07

D-Alanylation of Lipoteichoic Acid Contributes to the Virulence of Streptococcus suis

Nahuel Fittipaldi et al.,
Groupe de Recherche sur les Maladies Infectieuses du Porc and Centre de Recherche en Infectiologie Porcine, Faculte' de me'decine ve'te'rinaire, Universite' de Montre'al, St-Hyacinthe, Quebec J2S 7C6, Canada,1 Research Team for Bacterial/Parasitic Diseases, National Institute of Animal Health, National Agriculture and Food Research Organization, Tsukuba, Ibaraki 305-0856, Japan,2

... A putative strong promoter (indicated by P) was predicted 228 bp upstream of the start codon for dltA using the software package Softberry BProm (http://www ...


Extremophiles
Volume 12, Number 3 / May 2008 pp. 415-429

Complete nucleotide sequence of pGS18, a 62.8-kb plasmid from Geobacillus stearothermophilus strain 18

Milda Stuknyte et al.,
(1) Department of Plant Physiology and Microbiology, Faculty of Natural Sciences, Vilnius University, Ciurlionio 21/27, 03101 Vilnius, Lithuania (2) Department of Food Science and Microbiology, Industrial Microbiology Section, Faculty of Agriculture, University of Milan, Via Celoria 2, 20133 Milan, Italy

... Promoter -10 and -35 position determination was accomplished using BPROM provided by SoftBerry (http://www.softberry.com/berry.phtml). ...


Applied and Environmental Microbiology
November 2008, p. 6739-6745, Vol. 74, No. 21 doi:10.1128/AEM.01021-08

Dynamic Localization of MreB in Vibrio parahaemolyticus and in the Ectopic Host Bacterium Escherichia coli

Shen-Wen Chiu, Shau-Yan Chen, and Hin-chung Wong
Department of Microbiology, Soochow University, Taipei, Taiwan 111, Republic of China

... The DNA sequences 500 bp upstream of mreB were analyzed using BPROM (http://www. softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) to ...


Journal of Bacteriology
May 2008, p. 3646-3657, Vol. 190, No. 10

Regulation of Gene Expression in a Mixed-Genus Community: Stabilized Arginine Biosynthesis in Streptococcus gordonii by Coaggregation with Actinomyces naeslundii

Nicholas S. Jakubovics,1 Steven R. Gill,2,4 Stacey E. Iobst,4 M. M. Vickerman,2,3 and Paul E. Kolenbrander
National Institute of Dental and Craniofacial Research, National Institutes of Health, Building 30, Room 310, Bethesda, Maryland 20892,1 Department of Oral Biology,2 Department of Periodontics and Endodontics, University at Buffalo School of Dentistry, Buffalo, New York,3 Institute for Genomic Research, 9712 Medical Center Drive, Rockville, Maryland 208504

... gordonii genome sequence were detected using the BProm and FindTerm modules of the fgenesB gene prediction program in Molquest software (Softberry Inc., Mount ...


Canadian Journal of Microbiology
Volume 54, Number 5, 1 May 2008 , pp. 341-351(11)

Characterization of putative membrane protein genes of the 'Candidatus Phytoplasma asteris', chrysanthemum yellows isolate

Galetto, Luciana et al.,
... Bacterial promoters and terminators were searched with BPROM and FindTerm softwares available on the SoftBerry server (www.softberry.com/berry.phtml). ...


Microbiological Research
Volume 163, Issue 1, 15 January 2008, Pages 39-50

The expression of the serine proteinase gene of Bacillus intermedius in Bacillus subtilis

Margarita Sharipova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia

... proteinase was inspected for the occurrence of the characteristic -35 and -10 boxes of SigA-type promoters (Helmann, 1995) by Softberry BPROM (Prediction ...


FEMS Microbiology Letters
Volume 281 Issue 2 Page 160-166, April 2008

The prpZ gene cluster encoding eukaryotic-type Ser/Thr protein kinases and phosphatases is repressed by oxidative stress and involved in Salmonella enterica serovar Typhi survival in human macrophages

Sebastien P. Faucher, Charles Viau, Pierre-Paul Gros, France Daigle, Herve Le Moual
1Department of Microbiology and Immunology, McGill University, Montreal, Quebec, Canada; and 2Department of Microbiology and Immunology, University of Montreal, Montreal, QC, Canada

... No such internal promoter sequences were identified using BPROM on the Softberry website (http://www.softberry.com/berry.phtml). ...


Journal of Bacteriology
June 2008, p. 3877-3885, Vol. 190, No. 11

Transcriptional Analysis and Functional Characterization of a Gene Pair Encoding Iron-Regulated Xenocin and Immunity Proteins of Xenorhabdus nematophila

Jitendra Singh and Nirupama Banerjee
School of Biotechnology, Jawaharlal Nehru University, New Delhi 110067, India,1 International Centre for Genetic Engineering and Biotechnology, New Delhi 110067, India2

... Identities of promoter sequences associated with the ORFs were determined by using the software BPROM (www.softberry.com) and www.fruitfly.org. ...


Biotechnology Letters
Volume 30, Number 3 / March, 2008 Pages 521-527

Identification of new internal promoters of the Xanthomonas oryzae pathovar oryzae gum gene cluster

Choong-Koo Lee, Byoung-Moo Lee and Jae-Yong Cho
(1) Division of Animal Science and Biotechnology, Sangji University, 660 Woosan-dong, Wonju-si, Gangwon-do, 220-702, Korea (2) Microbial Genetics Division, National Institute of Agricultural Biotechnology, 225 Seodun-dong, Suwon, 441-707, Korea

... and BPROM software (Softberry, Inc.). Transcrip- tional terminators were predicted with the TransTerm software (http://www.cbcb.umd.edu/software/Trans Term). ...


Journal of Molecular Catalysis B: Enzymatic
Volumes 52-53, June 2008, Pages 2-12

Genes responsible for hydantoin degradation of a halophilic Ochrobactrum sp. G21 and Delftia sp. I24 — New insight into relation of d-hydantoinases and dihydropyrimidinases

Durr et al.,
Department of Chemical Engineering, Chair of Technical Biology, University of Karlsruhe (TH), Germany

... BlastN and BlastP [21], ORF finder (at the National Centre for Biotechnology Information website), ClustalW [22], BPROM (available at www.softberry.com) and ...


Appl. Environ. Microbiol.
June 2008, p. 3644-3651, Vol. 74, No. 12 doi:10.1128/AEM.00429-08

Increased Fitness of Pseudomonas fluorescens Pf0-1 Leucine Auxotrophs in Soil

Wook Kim and Stuart B. Levy
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111, USA

... downsteam from the 3'end of the opposite leuA2 gene by 5'RACE (Fig 1B). BPROM (http://www.softberry.com) and NNPP (http://www ...


Antimicrob. Agents Chemother.
doi:10.1128/AAC.00393-08

Acquisition of a Plasmid Borne blaOXA-58 Gene with an Upstream IS1008 Insertion Conferring a High Level of Carbapenem Resistance to Acinetobacter baumannii

Te-Li Chen, Roy Chen-Chih Wu, Men-Fang Shaio, Chang-Phone Fung, and Wen-Long Cho
Division of Infectious Diseases, Department of Internal Medicine, Taipei Veterans General Hospital, Institute of Tropical Medicine, School of Medicine, National Yang-Ming University, Taipei, Division of Clinical Research, Department of Medical Research, Kuang Tien General Hospital, Institute of Clinical Nutrition, Hung Kuang University, Taichung, Taiwan

... motifs. Promoter sequences were identified using BPROM program 12 (www.softberry.com). 13 14 Reverse transcription-PCR (RT-PCR) 15 ...


FEMS Microbiology Ecology
2008 Aug;65(2):202-19. Epub 2008 Apr 9.

Physical organization and phylogenetic analysis of acdR as leucine-responsive regulator of the 1-aminocyclopropane-1-carboxylate deaminase gene acdS in phytobeneficial Azospirillum lipoferum 4B and other Proteobacteria

Claire Prigent-Combaret et al.,
1Universite' de Lyon, Lyon, F-69003, France; Universite' Lyon 1, Lyon, F-69003, France; CNRS, UMR 5557, Ecologie Microbienne, Villeurbanne, F-69622, France; IFR 41, Villeurbanne, F-69622, France

... of acdS in A. lipoferum 4B and other acdS + Proteobacteria was screened for putative promoters (using the program BPROM; at http://www.softberry.com/berry.phtml ...


Environmental Microbiology
Volume 10 Issue 5 Page 1101-1107, May 2008

Ecology of type II secretion in marine gammaproteobacteria

Flavia F. Evans, Suhelen Egan and Staffan Kjelleberg
School of Biotechnology and Biomolecular Sciences and Centre for Marine Bio-Innovation, University of New South Wales, Sydney, Australia

... 2). Just downstream of this gene and separated by an apparent promoter-less 66 base-pair nucleotide region (BPROM, Softberry Package), a unique copy of the ...


Microbiology
154 (2008), 1422-1435; DOI 10.1099/mic.0.2007/014365-0

Genes for two multicopper proteins required for Fe(III) oxide reduction in Geobacter sulfurreducens have different expression patterns both in the subsurface and on energy-harvesting electrodes

Dawn E. Holmes et. al.,
Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

... FGENESB, BPROM and FindTerm programs, available through SoftBerry (www.softberry. com), were used for operon and gene predictions. RESULTS. ...


Infection and Immunity,
September 2007, p. 4506-4513, Vol. 75, No. 9

Glutathione-Dependent Alcohol Dehydrogenase AdhC Is Required for Defense against Nitrosative Stress in Haemophilus influenzae

Stephen P. Kidd, Donald Jiang, Michael P. Jennings, and Alastair G. McEwan
Australian Bacterial Pathogenesis Program and Centre for Metals in Biology, School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Queensland 4072, Australia

... adhC-nmlR intergenic spacer regions of the NmlR subfamily from a number of bacteria were identified using BPROM software available from Softberry (Mount Kisco ...


Genetica
Volume 131, Number 3 / November 2007 p. 255-265

Isolation, gene structure, and comparative analysis of the S-layer gene sslA of Sporosarcina ureae ATCC 13881

Pavel M. Ryzhkov, Kai Ostermann and Gerhard Rodel
Institut fur Genetik, Technische Universitat Dresden, Helmholtzstr. 10, 01062 Dresden, Germany

... sequences and promoter regions were identified by means of BestPal and Bprom programs from ''SoftBerry'' software package (http://www.softberry.com). ...


Current Microbiology
Volume 55, Number 3 / September 2007 p. 185-192

A Novel Phytase appA from Citrobacter amalonaticus CGMCC 1696: Gene Cloning and Overexpression in Pichia pastoris

Huiying Luo et al.,
Microbial Engineering Department, Feed Research Institute, Chinese Academy of Agricultural Sciences, 100081 Beijing, China

... The promoter was predicted using the prediction of bacterial promoter program, BPROM (available at: http://www.softberry.com/berry.html). ...


Journal of Bacteriology,
May 2007, p. 3335-3347, Vol. 189, No. 9

Transcriptional Regulation of the CO2-Concentrating Mechanism in a Euryhaline, Coastal Marine Cyanobacterium, Synechococcus sp. Strain PCC 7002: Role of NdhR/CcmR

Fiona J. Woodger, Donald A. Bryant, and G. Dean Price
Molecular Plant Physiology Group, Research School of Biological Sciences, Australian National University, P.O. Box 475, Canberra ACT 0200, Australia

... Putative LysR binding sites are underlined, and putative -35 and -10 elements (as predicted by BPROM at www.softberry.com) are shown in boldface. ...


Journal of Bacteriology,
April 2007, p. 3051-3062, Vol. 189, No. 8

YcfR (BhsA) Influences Escherichia coli Biofilm Formation through Stress Response and Surface Hydrophobicity

Xue-Song Zhang, Rodolfo Garcia-Contreras, and Thomas K. Wood
Artie McFerrin Department of Chemical Engineering, Department of Biology, Zachry Department of Civil Engineering, Texas A & M University, College Station, Texas 77843-3122

... Further analysis of the ycfR promoter with BPROM, a bacterial promoter prediction program (SoftBerry, Mount Kisco, NY), showed the presence of a putative SoxS ...


Journal of Bacteriology,
May 2007, p. 3776-3783, Vol. 189, No. 10

XphA/XqhA, a Novel GspCD Subunit for Type II Secretion in Pseudomonas aeruginosa

Gerard P. F. Michel, Eric Durand, and Alain Filloux
Laboratoire d'Ingenierie des Systemes Macromoleculaires, Institut de Biologie Structurale et Microbiologie, Centre National de la Recherche Scientifique, 31 Chemin Joseph Aiguier, 13402 Marseille Cedex 20, France

... Moreover, a search for promoters using the BPROM software (www.softberry.com) indicated -10 and -35 boxes, respectively, 392 bp and 416 bp upstream of the ...


Microbiology
153 (2007), 3608-3622

Promoter-trap identification of wheat seed extract-induced genes in the plant-growth-promoting rhizobacterium Azospirillum brasilense Sp245

Joel F. Pothier et al.,
Universite de Lyon, Lyon, F-69003, France

... pl) (Ishikawa & Hotta, 1999 Down). BPROM was used for prediction of promoters (http://www.softberry.com). SignalP 3.0 was used to ...


Journal of Bacteriology,
January 2007, p. 491-500, Vol. 189, No. 2

Characterization of a higBA Toxin-Antitoxin Locus in Vibrio cholerae

Priya Prakash Budde, Brigid M. Davis, Jie Yuan, and Matthew K. Waldor
Department of Molecular Biology and Microbiology, Program in Immunology, Tufts University School of Medicine, Howard Hughes Medical Institute, Boston, Massachusetts 02111

... Bioinformatic analysis of V. cholerae higBA (BPROM; http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb) suggested that this might ...


Research in Microbiology
Volume 158, Issue 6, July-August 2007, Pages 529-536

The ompW (porin) gene mediates methyl viologen (paraquat) efflux in Salmonella enterica serovar Typhimurium

Fernando Gil et al.,
Laboratorio de Microbiologi'a Molecular, Facultad de Ciencias de la Salud, Universidad Andre's Bello, Santiago, Chile

... MV induces ompW expression. BPROM software (http://www.softberry.com/berry.phtml? topic=bprom) was used to analyze a 400 bp region upstream from the ompW gene. ...


Journal of Bacteriology,
April 2007, p. 3006-3016, Vol. 189, No. 8

Expression of the bviIR and cepIR Quorum-Sensing Systems of Burkholderia vietnamiensis

Rebecca J. Malott and Pamela A. Sokol
Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada T2N 4N1

... G4cepRGSV). Construction of luxCDABE transcriptional fusions. Promoter regions were predicted in silico using SoftBerry BPROM. Promoter ...


Journal of Bacteriology,
August 2007, p. 5916-5928, Vol. 189, No. 16

Ler and H-NS, Regulators Controlling Expression of the Long Polar Fimbriae of Escherichia coli O157:H7

Alfredo G. Torres et al.,
Department of Microbiology and Immunology, Department of Pathology and Sealy Center for Vaccine Development, University of Texas Medical Branch, Galveston, Texas 77555-1070

... The bacterial promoter recognition program BPROM (http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb) was used to predict the ...


Plasmid
Volume 57, Issue 1, January 2007, Pages 44-54

Complete nucleotide sequence of pBMB67, a 67-kb plasmid from Bacillus thuringiensis strain YBT-1520

Liu Chao et al.,
State Key Laboratory of Agricultural Microbiology and National Engineering Research Center of Microbe Pesticides, Huazhong Agricultural University, Wuhan 430070, China

... Promoter and terminator predictions were performed using BPROM and FindTerm, respectively (http://www.softberry.com/berry.phtml). ...


Microbiology
Volume 76, Number 5 / October 2007 p. 569-574

Heterologous expression of Bacillus intermedius gene of glutamyl endopeptidase in Bacillus subtilis strains defective in regulatory proteins

E. I. Shagimardanova et al.,
Kazan State University, ul. Kremlevskaya 18, Kazan, 420008, Russia

... potential -10 and -35 regions for the recognition by the sigma A factor of transcriptional RNA polymerase were identified using the Softberry BPROM server ...


Journal of Bacteriology,
July 2007, p. 5119-5129, Vol. 189, No. 14

Only One of Four Oligopeptide Transport Systems Mediates Nitrogen Nutrition in Staphylococcus aureus

Aurelia Hiron, Elise Borezee-Durant, Jean-Christophe Piard, and Vincent Juillard
Unite Bacteries Lactiques et pathogenes Opportunistes, Institut National de la Recherche Agronomique, Domaine de Vilvert, 78352 Jouy en Josas cedex, France

... Putative promoter sequences were identified using the BPROM prediction of bacterial promoter program (http://www.softberry.com). ...


Infection and Immunity,
September 2007, p. 4482-4489, Vol. 75, No. 9

Genetic Basis for the New Pneumococcal Serotype, 6C

In Ho Park, Saeyoung Park, Susan K. Hollingshead, and Moon H. Nahm
Departments of Pathology,1 Microbiology, University of Alabama at Birmingham, 845 19th Street South, BBRB 614, Birmingham, Alabama 35294

... and genes, promoters, and transcription terminators in the capsule gene locus were identified using fgenesB, BPROM, and FindTerm (Softberry Inc.), which are ...


Microbiology
153 (2007), 3478-3498; DOI 10.1099/mic.0.2007/008250-0

Molecular analysis of the distribution and phylogeny of dissimilatory adenosine-5'-phosphosulfate reductase-encoding genes (aprBA) among sulfur-oxidizing prokaryotes

Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany

... promoters, termination sites and gene arrangement in operons was performed using the web versions FGENESB, BPROM and BTERM of the Softberry program package ...


Microbiology
153 (2007), 2026-2044; DOI 10.1099/mic.0.2006/003152-0

Phylogeny of the alpha and beta subunits of the dissimilatory adenosine-5'-phosphosulfate (APS) reductase from sulfate-reducing prokaryotes – origin and evolution of the dissimilatory sulfate-reduction pathway

Birte Meyer and Jan Kueve
Max-Planck-Institute for Marine Microbiology, Celsiusstrasse 1, D-28359 Bremen, Germany

... promoters, termination sites and operons in genome data were performed using the web versions FGENESB, BPROM and BTERM of the Softberry program package ...


Research in Microbiology
Volume 158, Issue 2, March 2007, Pages 175-186

Isolation and characterization of a gene cluster involved in PAH degradation in Mycobacterium sp. strain SNP11: Expression in Mycobacterium smegmatis mc2155

Christophe Pagnout et al.,
Laboratoire d'Ecotoxicite, Sante Environnementale, CNRS UMR 7146, Universite Paul Verlaine, rue du General Delestraint, F-57070 Metz, France

... Prediction and BPROM software available at the Berkeley Drosophila Genome Project (http://www.fruitfly.org/seq_tools/promoter.html) and SoftBerry (http://www ...


Journal of Bacteriology,
January 2007, p. 491-500, Vol. 189, No. 2

Characterization of a higBA Toxin-Antitoxin Locus in Vibrio cholerae

Priya Prakash Budde ,1,2,, Brigid M. Davis,2,* Jie Yuan,3 and Matthew K. Waldor1,2,3
Department of Molecular Biology and Microbiology,2 Program in Immunology, Tufts University School of Medicine,3 Howard Hughes Medical Institute, Boston, Massachusetts 021111

... Bioinformatic analysis of V. cholerae higBA (BPROM; http://www.softberry.com/berry. phtml?topic=bprom&group=programs&subgroup=gfindb) suggested that this might ...


Environmental Microbiology
2007, 9 (3), 765 - 776. doi:10.1111/j.1462-2920.2006.01198.x

Molecular diversity of nitrite reductase genes (nirK) in nitrifying bacteria

J. Jason L. Cantera, Lisa Y. Stein
Department of Environmental Sciences, Geology 2207, University of California, Riverside, CA 92521, USA.

... gene sequences located upstream of translational start sites for nirK genes were analysed for sigma70 binding sites using BPROM (SoftBerry, Mount Kisco, NY). ...


Journal of Bacteriology,
June 2007, p. 4265-4274, Vol. 189, No. 11

Mycobacterial Bacilli Are Metabolically Active during Chronic Tuberculosis in Murine Lungs: Insights from Genome-Wide Transcriptional Profiling

Adel M. Talaat et al.,
Laboratory of Bacterial Genomics, Department of Pathobiological Sciences, University of Wisconsin—Madison, Madison, Wisconsin 53706

... Using a promoter recognition algorithm, BPROM (http://www.softberry.com/berry.phtml), we were able to predict a potential promoter binding site (TGGGTA-N[12 ...


Environmental Microbiology
Volume 9, Number 3, March 2007 , pp. 814-818(5)

The use of functional genomics for the identification of a gene cluster encoding for the biosynthesis of an antifungal tambjamine in the marine bacterium Pseudoalteromonas tunicata

Burke, Catherine; Thomas, Torsten; Egan, Suhelen; Kjelleberg, Staffan

... Upstream of the cluster a consensus region for a bacterial promoter was identified using the Softberry BPROM program (http://www.softberry.com). ...


Molecular Biology Reports
Volume 34, Number 2 / June, 2007 pp.79-87

The expression of Bacillus intermedius glutamyl endopeptidase gene in Bacillus subtilis recombinant strains

Sharipova et al.,
Department of Microbiology, Kazan State University, Kazan, Russia

... was inspected for the occurrence of the characteristic –35 and –10 boxes of SigA-type promoters (Helmann 1995) by using the Softberry BPROM (Prediction of ...


Journal of Bacteriology,
January 2007, p. 351-362, Vol. 189, No. 2

Global Gene Expression and Phenotypic Analysis of a Vibrio cholerae rpoH Deletion Mutant

Leyla Slamti, Jonathan Livny, and Matthew K. Waldor*
Department of Molecular Biology and Microbiology, Tufts University School of Medicine, and Howard Hughes Medical Institute, 136 Harrison Avenue, Boston, Massachusetts 02111

... Promoter predictions were performed by using Bprom on the Softberry website (http://www.softberry.com/berry.phtml). Microarray accession number. ...


Applied and Environmental Microbiology,
January 2007, p. 390-398, Vol. 73, No. 2

Involvement of Pseudomonas aeruginosa Rhodanese in Protection from Cyanide Toxicity

Rita Cipollone et al.,
Dipartimento di Biologia, Universita Roma Tre, Viale G. Marconi 446, 00146 Rome, Italy

... promoter elements was predicted by the Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter.html) and BPROM (Softberry Inc.) software ...


Archives of Microbiology
Volume 187, Number 1 / January, 2007 67-77

Multiple regulators of the Flavohaemoglobin (hmp) gene of Salmonella enterica serovar Typhimurium include RamA, a transcriptional regulator conferring the multidrug resistance phenotype

Elizabeth Hernandez-Urzua et al.,
Laboratorio de Microbiologia y Genetica Molecular, Departamento de Biologia Molecular y Biotecnologia, Instituto de Investigaciones Biomedicas, Universidad Nacional Autonoma de Mexico, P.O. Box 70-228, Coyoacan, Mexico City, 04510, Mexico

... 1). Interestingly, a very recent and independent in silico study using theBacterial PROMoter prediction program BPROM (http://www.softberry.com) arrived at the ...


Cellular Microbiology,
Volume 9, Number 4, April 2007 , pp. 1039-1049(11)

Bile salts induce expression of the afimbrial LDA adhesin of atypical enteropathogenic Escherichia coli

Torres, Alfredo G et al.,
Departments of Microbiology and Immunology, and 2: Pathology, University of Texas Medical Branch, Galveston, TX?77555-1070, USA.

... found within the lda locus using BPROM, which is a bacterial promoter recognition program with about 80% accuracy and specificity (http://www.softberry.com). ...


Enzyme and Microbial Technology
Volume 40, Issue 4, 5 March 2007, Pages 747-753

Genetic and biochemical characterization of an a-l-arabinofuranosidase isolated from a compost starter mixture

Kurt Wagschal et al.,
USDA Agricultural Research Service, Western Regional Research Center, 800 Buchanan Street, Albany, CA 94710, United States

... the sequences for bacterial promoters and rho-independent transcription termination sites was performed using BPROM and FindTerm, available at www.softberry.com ...


Canadian Journal of Microbiology,
Volume 53, Number 3, 1 March 2007 , pp. 417-426(10)

Comparison of transformation protocols in Streptococcus gordonii and evaluation of native promoter strength using a multiple-copy plasmid

Warren, Travis K.; Lund, S. A.; Jones, Kevin F.; Hruby, Dennis E.
... start (TIGR 2006). The internet program BPROM at www. softberry.com/berry. phtml identified two sequences, TTGACA and ATATATAAT,


Environmental Microbiology
Volume 8 Issue 8 Page 1460-1470, August 2006

Diversity of polyketide synthase genes from bacteria associated with the marine sponge Pseudoceratina clavata: culture-dependent and culture-independent approaches

Tae Kyung Kim and John A. Fuerst
School of Molecular and Microbial Sciences, University of Queensland, Brisbane, Qld 4072, Australia

... at ?79 (AGTGACACT) and ?96 (TTCACG) positions using a bacterial promoter prediction program BPROM (available at the web site http:/ / www.softberry.com ). ...


Extremophiles
Volume 10, Number 4 / August, 2006 301-310

Characterization of a b-glycosidase from the thermoacidophilic bacterium Alicyclobacillus acidocaldarius

Barbara Di Lauro 1, Mose Rossi 1, 2 and Marco Moracci 1
(1) Institute of Protein Biochemistry, Consiglio Nazionale delle Ricerche, Via P. Castellino 111, 80131 Naples, Italy
(2) Dipartimento di Biologia Strutturale e Funzionale, Universita di Napoli “Federico II”, Complesso Universitario di Monte S. Angelo, Via Cinthia 4, 80126 Naples, Italy

... 2a). The program BPROM for the prediction of bacterial pro- moters (http://www. softberry.com/berry.phtml) revealed only one possible cassette of A10 and A35 ...


Journal of Biochemistry
2006 140(3):429-438; doi:10.1093/jb/mvj168

Homologous Response Regulators KvgA, KvhA and KvhR Regulate the Synthesis of Capsular Polysaccharide in Klebsiella pneumoniae CG43 in a Coordinated Manner

Ching-Ting Lin, Teng-Yi Huang, Wan-Chun Liang and Hwei-Ling Peng*
Department of Biological Science and Technology, National Chiao Tung University, 75 Po-Ai Street, Hsin Chu 30050, Taiwan, Republic of China

... The BPROM program (http://www.softberry.com) used to analyze the sequences of the P kvgAS , P kvhAS , and P kvhR did not identify any cis-element, indicating ...


BMC Microbiology
2006, 6:104 doi:10.1186/1471-2180-6-104

Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome

Catherine E Chambers, Erika I Lutter, Michelle B Visser, Peggy PY Law and Pamela A Sokol*
Address: Department of Microbiology and Infectious Diseases, University of Calgary Health Sciences Center, Calgary, Alberta, Canada

..Potential promoter elements were identified using BPROM [44]. 44. Softberry (www.softberry.com). . ...


Molecular Microbiology
Volume 62 Issue 3 Page 794-810, November 2006

Thiosulphate oxidation in the phototrophic sulphur bacterium Allochromatium vinosum

Daniela Hensen, Detlef Sperling, Hans G. Truper, Daniel C. Brune, Christiane Dahl
1Institut fur Mikrobiologie & Biotechnologie, Rheinische Friedrich-Wilhelms-Universitat Bonn, Meckenheimer Allee 168, D-53115 Bonn, Germany.
2Department of Chemistry and Biochemistry, Arizona State University, PO Box 871604, Tempe, AZ 85287-1604, USA.

... Manager (SES central) software. Promoter prediction was performed using bprom at http:/ / www.softberry.com . Similarity searches were ...


Journal of Microbiological Methods
Volume 66, Issue 2, August 2006, Pages 276-285

Genomic flank-sequencing of plasposon insertion sites for rapid identification of functional genes

Johan H.J. Leveaua, Saskia Gerardsa, Kathrin Fritschea, Gerben Zondagb and Johannes A. van Veena
Netherlands Institute of Ecology (NIOO-KNAW), Department of Terrestrial Microbial Ecology, Boterhoeksestraat 48, 6666 GA Heteren, The Netherlands BaseClear, Leiden, The Netherlands

... DNA sequences were analyzed using Lasergene software (DNASTAR, Madison, WI). Promoter searches were performed using Softberry's BPROM (www.softberry.com). ...


Infection and Immunity
November 2006, p. 6171-6178, Vol. 74, No. 11

Hierarchy of Iron Uptake Systems: Yfu and Yiu Are Functional in Yersinia pestis

Olga Kirillina, Alexander G. Bobrov, Jacqueline D. Fetherston, and Robert D. Perry*
Department of Microbiology, Immunology, and Molecular Genetics, University of Kentucky, Lexington, Kentucky

... Sequence analysis. Nucleotide sequences were analyzed for promoters using the web-based program BPROM (www.softberry.com). Predictions ...


Applied and Environmental Microbiology,
November 2006, p. 6994-7002, Vol. 72, No. 11

Transcriptional Regulation of the pdt Gene Cluster of Pseudomonas stutzeri KC Involves an AraC/XylS Family Transcriptional Activator (PdtC) and the Cognate Siderophore Pyridine-2,6-Bis(Thiocarboxylic Acid)

Sergio E. Morales and Thomas A. Lewis*
Department of Microbiology and Molecular Genetics, University of Vermont, Burlington, Vermont 05405

... The DNA and protein sequence analysis software used were Sequencher (Gene Codes, Ann Arbor, MI), BPROM (Softberry, Inc., Mount Kisco, NY), GenomeMatScan (http ...


Journal of Bacteriology ,
July 2006, p. 5089-5100, Vol. 188, No. 14

Molecular Characterization of Pantoea stewartii subsp. stewartii HrpY, a Conserved Response Regulator of the Hrp Type III Secretion System, and its Interaction with the hrpS Promoter

Massimo Merighi,1, Doris R. Majerczak,1 Michael Zianni,2 Kimberly Tessanne,2 and David L. Coplin1*
Department of Plant Pathology and the Plant Molecular Biology and Biotechnology Program,1 Plant-Microbe Genomic Facility, The Ohio State University, Columbus, Ohio 432102

... Promoter and DNA binding site predictions were determined with BPROM (http://www. softberry.com/), PromScan (http://molbiol-tools.ca/mtoolwww-cgi/promscan.cgi ...


Appl Environ Microbiol. ,
2006 April; 72(4): 2539-2546

Cloning and Sequencing of the ompA Gene of Enterobacter sakazakii and Development of an ompA-Targeted PCR for Rapid Detection of Enterobacter sakazakii in Infant Formula

Manoj Kumar Mohan Nair and Kumar S. Venkitanarayanan*
Department of Animal Science, Unit 4040, University of Connecticut, Storrs, Connecticut 06269

.... in Table 2. The sequences generated were analyzed by Sequencher 4.1.4 (Gene Codes Corporation, Ann Arbor, Mich.), BPROM (http://www.softberry.com), SignalP ...


PNAS ,
August 22, 2006 vol. 103 no. 34 12897-12902

Deletion of TolC orthologs in Francisella tularensis identifies roles in multidrug resistance and virulence

Gil et al.,
Center for Infectious Diseases, Stony Brook University, Stony Brook, NY 11794-5120

... 42). The locations of promoters and operons were investigated by using the FGENESB and BPROM programs available from Softberry (Mt. Kisco, NY). ...


Molecular Microbiology,
Volume 59, Number 2, January 2006, pp. 541-550(10)

A small RNA inhibits translation of the histone-like protein Hc1 in Chlamydia trachomatis

Grieshaber, Nicole A.1; Grieshaber, Scott S.1; Fischer, Elizabeth R.2; Hackstadt, Ted
Host-Parasite Interactions Section, Laboratory of Intracellular Parasites, and 2: Microscopy Core Facility, NIAID, NIH, Rocky Mountain Laboratories, Hamilton, MT 59840, USA.

... promoter sequences and rho-independent terminators that could result in an ?120 bp product using the BPROM and FindTerm utilities (http://www.softberry.com). ...


Applied and Environmental Microbiology,
January 2006, p. 368-377, Vol. 72, No. 1

Cloning and Expression of a Xylitol-4-Dehydrogenase Gene from Pantoea ananatis

J. S. Aarnikunnas,1* A. Pihlajaniemi,2 A. Palva,1 M. Leisola,2 and A. Nyyssola2
Division of Microbiology and Epidemiology, Department of Basic Veterinary Sciences, Faculty of Veterinary Medicine, P.O. Box 66, FIN-00014 University of Helsinki, Finland,1 Laboratory of Bioprocess Engineering, Department of Chemical Technology, Helsinki University of Technology, P.O. Box 6100, FIN-02015 Espoo, Finland2

... uk/blast2/]). The BPROM program (SoftBerry Inc.) was used to localize putative promoter regions in the sequences. The protein sequences ...


Journal of Bacteriology,
January 2006, p. 789-793, Vol. 188, No. 2

Autorepression of RctB, an Initiator of Vibrio cholerae Chromosome II Replication

Elizabeth S. Egan, Stephane Duigou, and Matthew K. Waldor
Genetics Program and Department of Molecular Microbiology, Tufts University School of Medicine and Howard Hughes Medical Institute, 136 Harrison Ave., Boston, Massachusetts 02111

.. BPROM, a computer program designed to identify sigma 70-dependent promoters for bacterial genes (SoftBerry, Mount Kisco, NY), predicted -10 and -35 sites ...


FEBS Journal
Volume 272 Issue 24 Page 6324 - 6335. December 2005

Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath).

Odd A. Karlsen1 et al.,
1 Department of Molecular Biology, University of Bergen, Norway
2 Computational Biology Unit, Bergen Centre for Computational Science, Norway

... fruitfly.org/ seq_tools/ promoter.html ) and bprom available at http://www.softberry.com ... In Microbial Growth on C1 Compounds (Murrell JC &Kelley DP, eds), ...


Extremophiles
Issue: Volume 9, Number 2 Date: April 2005 Pages: 99 - 109 DOI: 10.1007/s00792-004-0425-0

The genome of BCJA1c: a bacteriophage active against the alkaliphilic bacterium, Bacillus clarkii

Andrew M. Kropinski1, Melissa Hayward1, M. Dorothy Agnew1 and Ken F. Jarrell1
(1) Department of Microbiology and Immunology, Queens University, Kingston, ON, K7L 3N6, Canada

... al. 2002). Promoters were predicted using Softberry's BPROM program at http://www.softberry. com/berry. phtml?topic=promoter. ...


Journal of Bacteriology,
February 2005, p. 1091-1104, Vol. 187, No. 3 0021-9193/05/$08.00+0 doi:10.1128/JB.187.3.1091-1104.2005

The Generalized Transducing Salmonella Bacteriophage ES18: Complete Genome Sequence and DNA Packaging Strategy

Sherwood R. Casjens et al.,
Department of Pathology, University of Utah Medical School, Salt Lake City, Utah,1 Department of Biological Sciences,4 Pittsburgh Bacteriophage Institute, University of Pittsburgh, Pittsburgh, Pennsylvania ,2 Institut fur Genetik und Mikrobiologie, Universitat Munchen, Munich, Germany3

... The DNA sequence analysis software used was DNA Strider (24), GeneMark (5), Staden programs (78), BLAST (2), BPROM (http://www.softberry.com/berry.phtml?topic ...


Infection and Immunity,
May 2005, p. 2899-2909, Vol. 73, No. 5

Characterization of the Major Secreted Zinc Metalloprotease- Dependent Glycerophospholipid:Cholesterol Acyltransferase, PlaC, of Legionella pneumophila

Sangeeta Banerji,1 Mayte Bewersdorff,1, Bjorn Hermes,1, Nicholas P. Cianciotto,2 and Antje Flieger1*
Robert Koch-Institut, Berlin, Germany,1 Department of Microbiology-Immunology, Northwestern University Medical School, Chicago, Illinois2

... legion.) (12). Nucleotide sequences were also analyzed for promoters using the web-based program BPROM (www.softberry.com). Sequence ...


Journal of Bacteriology,
April 2005, p. 2458-2468, Vol. 187, No. 7

The Type III-Dependent Hrp Pilus Is Required for Productive Interaction of Xanthomonas campestris pv. vesicatoria with Pepper Host Plants

Ernst Weber et al.,
Institute of Genetics,1 Biozentrum, Martin Luther University, Halle, Germany,4 General Microbiology, Faculty of Biosciences, University of Helsinki, Helsinki, Finland,2 Institut des Sciences Vegetales, CNRS, Gif-sur-Yvette, France3

... The promoter recognition program BPROM (Softberry, Inc., Mt. Kisco, NY) was used for prediction of bacterial sigma70 promoter motifs. RESULTS. ...


FEMS Microbiology Letters
2005, Volume 248 Issue 1, Pages 1 - 8

RelA alone appears essential for (p)ppGpp production when Neisseria gonorrhoeae encounters nutritional stress

Scott D. Fisher a , Andrew D. Reger a , Atalie Baum a , Stuart A. Hill* a
a Department of Biological Sciences, Northern Illinois University, DeKalb, IL 60115, USA

... Puta- tive promoters and gene expression regulatory motif sequences were determined using the BPROM analysis program housed at: http://www.softberry.com/berry. ...


FEMS Microbiol Lett.
2005 Jul 15;248(2):199-205

Characterization of IS1501 mutants of Leptospira interrogans serovar pomona

Zuerner RL, Trueba GA.
National Reference Center for Leptospirosis, Bacterial Diseases of Livestock Research Unit, National Animal Disease Center, USDA, ARS, P.O. Box 70, Ames, IA 50010, USA

... and the data analyzed using Clone Manager 7 and Primer Designer 5 (Scien- tific and Educational Software), BLAST [24], and BPROM (http://www.softberry.com/).


Journal of Bacteriology
June 2005, p. 4005-4014, Vol. 187, No. 12

Characterization of the Small Untranslated RNA RyhB and Its Regulon in Vibrio cholerae

Davis et al.,
Howard Hughes Medical Institute,1 Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, Massachusetts 021112

... MacVector (Accelrys). Promoter prediction was done with BPROM (Softberry, Inc., Mt. Kisco, NY). Microarray analyses. Paired cultures ...


Can J Microbiol.
2005 Oct;51(10):821-3

Characteristics of adjacent family 6 acetylxylan esterases from Fibrobacter succinogenes and the interaction with the Xyn10E xylanase in hydrolysis of acetylated xylan

Kam DK, Jun HS, Ha JK, Inglis GD, Forsberg CW.
Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON, Canada

... The putative -10 and -35 pro- moter sequences of axe6A and axe6B shown in Fig. 1 were predicted by using the program BPROM (http://www.softberry. ...


FEMS Microbiology Letters
2005, Volume 251 Issue 1, Pages 29 - 36

Transcriptional regulation of the S-layer protein type I secretion system in Caulobacter crescentus

Michael C. Toporowski a , John F. Nomellini a , Peter Awram a , Assaf Levi b , John Smit a, *
a University of British Columbia, Department of Microbiology and Immunology, Vancouver, B.C. Canada V6T 1Z3 b University of Basel, Division of Molecular Microbiology, Basel, Switzerland

... Fig. 1. In-silico predicted rsaD promoter orientation and binding sites: (a) prediction of the rsaD promoter using the Softberry BPROM program. ...


Journal of Bacteriology,
November 2004, p. 7411-7419, Vol. 186, No. 21

Use of In Vivo Expression Technology To Identify Genes Important in Growth and Survival of Pseudomonas fluorescens Pf0-1 in Soil: Discovery of Expressed Sequences with Novel Genetic Organization

Mark W. Silby and Stuart B. Levy*
Center for Adaptation Genetics and Drug Resistance, Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts

...Promoter searches were carried out by using SoftBerry software...
...An examination of the 1,486 bp of intergenic sequence upstream of the Pflu4867 gene with SoftBerry software suggests the presence of two predicted promoters, both in the correct orientation to drive expression of Pflu4867 and both within the region contained in the iiv6 fusion...
... Candidate promoters were detected by SoftBerry software upstream of the iiv1, iiv5, iiv12, iiv14, and iiv19 ORFs....


J Bacteriol.
2004 September; 186(17): 5945-5949. doi: 10.1128/JB.186.17.5945-5949.2004.

Identification of Operators and Promoters That Control SXT Conjugative Transfer

John W. Beaber and Matthew K. Waldor*
Department of Microbiology, Tufts University School of Medicine, and Howard Hughes Medical Institute, Boston, Massachusetts

...Computer algorithms and 5? random amplification of cDNA ends (RACE) were used to define the setR and s086 transcription start sites. Software for the identification of bacterial promoters (http://www.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb) identified putative ?10 and ?35 elements for both PL and PR (Fig. 2) (23, 24)...


Antimicrobial Agents and Chemotherapy
October 2004, p. 4042-4046, Vol. 48, No. 10

CARB-9, a Carbenicillinase Encoded in the VCR Region of Vibrio cholerae Non-O1, Non-O139 Belongs to a Family of Cassette-Encoded b-Lactamases

Petroni et al.,
Servicio Antimicrobianos, Dpto. Bacteriologia, Instituto Nacional de Enfermedades Infecciosas-ANLIS "Dr. Carlos G. Malbran," Buenos Aires, Argentina,1 Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada2

... 35 and -10) and the RBS reported previously are shown in boldface, and those identified in this work (the BPROM program, http://www.softberry.com/berry.phtml ...


JOURNAL OF BACTERIOLOGY,
Mar. 2004, p. 1818-1832 Vol. 186, No. 6

The pKO2 Linear Plasmid Prophage of Klebsiella oxytoca

Sherwood R. Casjens,1,2* Eddie B. Gilcrease,1 Wai Mun Huang,1 Kim L. Bunny,3
Marisa L. Pedulla,2,4 Michael E. Ford,2,4 Jennifer M. Houtz,2,4 Graham F. Hatfull,2,4 and Roger W. Hendrix2,4
Department of Pathology, University of Utah Medical School, Salt Lake City, Utah 841321; Pittsburgh Bacteriophage Institute2 and Department of Biological Sciences,4 University of Pittsburgh, Pittsburgh, Pennsylvania 15260; and Section of Microbiology, University of California at Davis, Davis, California 956163

...The DNA sequence analysis software packages used were DNA Strider (27), GeneMark (8), the Staden programs (94), BLAST (3), BPROM http://www.softberry.com/berry.phtml?topic_gfindb), and DNA Master (J. Lawrence [http://cobamide2.bio.pitt.edu/])....


BMC Microbiology
2004, 4:4

Analysis of the lambdoid prophage element e14 in the E. coli K-12 genome

Preeti Mehta1, Sherwood Casjens2 and Sankaran Krishnaswamy*1
Bioinformatics Centre, School of Biotechnology, Madurai Kamaraj University, Madurai-625021, India and 2University of Utah Medical School, Department of Pathology, 90 North 1900 East, Salt Lake City UT 84132-2501, USA

... Putative promoters predicted using BPROM available at the website http:// www.softberry.com. Scores are as given by BPROM. Promoters ...


PNAS
July 27, 2004 vol. 101 no. 30 11013-11018

Transfer of photosynthesis genes to and from Prochlorococcus viruses

Lindell et al.,
Departments of *Civil and Environmental Engineering and ¶Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; ‡Joint Program in Biological Oceanography, Woods Hole Oceanographic Institution and Massachusetts Institute of Technology, Cambridge, MA 02139; and §Department of Biology, San Diego State University, San Diego, CA 92182

... 10 and a tail score of <-5. Potential bacterial ? 70 promoters were identified in intergenic regions by using the program bprom (SoftBerry, Mount Kisco, NY ...


Plant Molecular Biology
53 (6): 865-876, December 2003

Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase

Allison E. McDonald, Sasan Amirsadeghi, Greg C. Vanlerberghe
Department of Life Sciences and Department of Botany, University of Toronto at Scarborough, 1265 Military Trail, Scarborough, Ontario, M1C 1A4 Canada

... The A. variabilis PTOX sequence was analyzed in the upstream region of the start codon with Softberry's BPROM software (http://www.softberry.com). ..


FPROM

Fish physiology and biochemistry
2016, 1-20. DOI 10.1007/s10695-016-0199-1

Identification and characterization of kiss2 and kissr2 homologs in Paralichthys olivaceus

Song, H. et al.,
1. Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, 266003, People’s Republic of China

... The transcription start sites (TSSs) were predicted using Softberry (http://?linux1.?softberry.? com/?berry.?phtml??topic=?fprom&?group=?programs&?subgroup=?promoter), and transcription factor binding sites were analyzed with the help of TFSEARCH (http://?www.?cbrc ...


General and comparative endocrinology
2015, 214, 114-125. doi:10.1016/j.ygcen.2014.06.010

Characterisation of kisspeptin system genes in an ovoviviparous teleost: Sebastes schlegeli

Song, H. et al.,
Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao 266003, PR China

... The tool of Promoter Scan (http://www-bimas.cit.nih.gov/molbio/proscan/), Softberry (http://linux1.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), and NNPP (http://www.fruitfly.org/seq_tools/promoter.html) were used to predict the transcription .


Scientific Reports
2015, 5, Article number: 14093 doi:10.1038/srep14093

Living without DAT: Loss and compensation of the dopamine transporter gene in sauropsids (birds and reptiles)

P. V. Lovell, B. Kasimi, J. Carleton, T. A. Velho & C. V. Mello
Department of Behavioral Neuroscience; Oregon Health & Science University; Portland, OR 97239-3098; USA Department of Biology; Portland State University; Portland, OR 97207-0751; USA

... In some cases we were able to refine, or computationally validate the location of the TSS by scanning each promoter region with algorithms available through Softberry (http://linux1.softberry. om/berry.phtml) that predict TSSs based on the position of TATA or non-TATA promoter sequences (FPROM41), or the location of CpG-rich islands (CpGFinder). ...


International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573

The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53

Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China

... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools: NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp. duke.edu/generegulation/McPromoterMMII/), and Softberry programs FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...


Scientia Horticulturae
Volume 154, 2 May 2013, Pages 96–101 DOI: 10.1016/j.scienta.2013.02.009

The intron from the 5?-UTR of the FBP11 gene in petunia displays promoter- and enhancer-like functions

Liao Liao 1, Guogui Ning 1, Caixian Liu, Wei Zhang, Manzhu Bao
Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan 430070, PR China

... 2.2. Sequence analysis. To predict the components of the FBP11 gene promoter and the first intron in the 5?-UTR, the sequence was analyzed using SoftBerry FPROM programs, available on the Softberry website (http://www.softberry.com) (Jens et al., 2008). ...


PloS one
September 12, 2013 DOI: 10.1371/journal.pone.0073920

Ets-2 Regulates Cell Apoptosis via the Akt Pathway, through the Regulation of Urothelial Cancer Associated 1, a Long Non-Coding RNA, in Bladder Cancer Cells

Wenjing Wu, Shuwan Zhang, Xu Li, Mei Xue, Sancheng Cao, Wei Chen
Clinical Laboratory, the First Affiliated Hospital, School of Medicine, Xi’an Jiaotong University, Xi’an, China School of Medicine, Xi’an Jiaotong University, Xi’an, China, Clinical Laboratory, Xi’an Children’s Hospital, Xi’an, China

... The promoter and TSS predict tools include the FPROM program from Softberry software (http://linux1.softberry.com/berry.phtml??topic=fprom&group=programs&subgroup=prom?oter) and PromoterInspector program from genomatix (http://www.genomatix.de/online_help/help ...


Breast Cancer Research and Treatment
Volume 137, Issue 2 , pp 383-396 DOI:10.1007/s10549-012-2353-5

Vimentin DNA methylation predicts survival in breast cancer

Ulirsch et al.,
4. The University of North Carolina at Chapel Hill School of Nursing, Lab 013, Carrington Hall, CB #7460, Chapel Hill, NC, 27599-7460, USA 2. Lineberger Comprehensive Cancer Center, University of North Carolina, 450 West Drive, Chapel Hill, 27599, USA

... We first custom designed the primers for an amplicon that included the core Vimentin promoter (Fig. 1), as predicted by http://linux1.softberry.com/berry.phtml?topic=fprom& group=programs&subgroup=promoter and http://www.cbs. ...


Hum. Mol. Genet.
(2013) doi: 10.1093/hmg/ddt116

Meta-Analysis of Genome-wide Association Studies in 5 cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error

Stambolian et al.,
1Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, USA 2Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health and National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, USA

... Promoter/enhancer prediction tools used included FPROM from Softberry (http://linux1.softberry. com/berry.phtml?topic=fprom&group=programs&subgroup=promoter), FirstEF from Cold Spring Harbor Laboratory (http://rulai.cshl.org/tools/FirstEF/), Promoter 2.0 ...


Matrix Biology
Volume 31, Issues 7–8, September–October 2012, Pages 412–420 DOI: 10.1016/j.matbio.2012.08.002

Quantification of type II procollagen splice forms using alternative transcript-qPCR (AT-qPCR)

McAlinden et al.,
a Department of Orthopaedic Surgery, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States b Department of Cell Biology and Physiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110, United States

... Analysis of the Col2a1 gene for alternative promoter sequences with FPROM (http://linux1.softberry. com/berry.phtml) revealed 12 potential alternative promoter sites, including a TATA box (TATAAAGA) within exon 2, which could also contribute to transcript diversity. ...


BMC Evolutionary Biology
2012, 12:125 http://www.biomedcentral.com/1471-2148/12/125

Molecular evolution of a-kinase anchoring protein (AKAP)-7: implications in comparative PKA compartmentalization

Keven R Johnson 1 , Jessie Nicodemus-Johnson 2, Graeme K Carnegie 3 and Robert S Danziger1,4,5
1 Department of Medicine, University of Illinois at Chicago, Chicago, IL, USA 4 Jesse Brown VA Medical Center, Chicago, IL, USA

... To determine AKAP7 splice variant exon positions and gene structures, the AKAP7 genes of human, rat, dog, opossum, zebrafish, lamprey, and ciona were analyzed using GENESCAN [58] and Promoter 2.0 Prediction Server [59] FPROM (Softberry, Inc., Mt Kisco, NY) programs ...


Stem Cells Trans Med March
2012 vol. 1 no. 3 188-199 doi: 10.5966/sctm.2011-0005

Human Muller Glia with Stem Cell Characteristics Differentiate into Retinal Ganglion Cell (RGC) Precursors In Vitro and Partially Restore RGC Function In Vivo Following Transplantation

Shweta Singhal et al.,
Divisions of aOcular Biology and Therapeutics and bVisual Neurosciences, NIHR BRC University College London Institute of Ophthalmology and Moorfields Eye Hospital, London, United Kingdom

.. species in this region were used to ascribe a 1.6-kb sequence upstream of the coding region as a putative promoter region for the gene (supplemental online Table 1). This sequence was then analyzed using the FPROM Human promoter prediction software (Softberry, Inc., Mt. ...


Gene Expression Patterns
Volume 11, Issues 1–2, January–February 2011, Pages 118–121 DOI: 10.1016/j.gep.2010.10.002,

Transgenic labeling of the zebrafish pronephric duct and tubules using a promoter from the enpep gene

Christoph Seiler a, Michael Pack a, b,
a Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA, USA b Cell and Developmental Biology, University of Pennsylvania School of Medicine, Philadelphia, PA, USA

... We used the softberry FPROM program (http://softberry.com) to identify possible transcription start sites. ... For promotor prediction we used softberry fprom (http://www.softberry.com/berry. phtml?topic = fprom&group = programs&subgroup = promoter). ...


Gene
Volume 492, Issue 1, 15 January 2012, Pages 148–159 DOI: 10.1016/j.gene.2011.10.034

Identification and functional characterization of the human EXT1 promoter region

Jennes et al.,
a Department of Medical Genetics, University of Antwerp, Belgium b Department of Medical Genetics and Skeletal Rare Diseases, Rizzoli Orthopedic Institute, Bologna, Italy

... In silico analysis of the 10 kb upstream region of the EXT1 start codon (region [-10,000_- 1]) (transcript NM_000127.2) was performed with several promoter prediction programs using different algorithms: BDGP (http://www.fruitfly.org/), FPROM (http://softberry.com/), Promoter ...


Archives of Virology
Volume 156, Issue 6 , pp 1097-1100 DOI: 10.1007/s00705-011-0971-6

Discovery of a genome of a distant relative of chicken anemia virus reveals a new member of the genus Gyrovirus

Rijsewijk et al.,
1. Virology Laboratory, Microbiology Department, Institute of Basic Health Sciences, Federal University of Rio Grande do Sul (UFRGS), Av. Sarmento Leite 500, Porto Alegre, Rio Grande do Sul (RS), CEP 90050-170, Brazil 2. Institute for Veterinary Research “Desiderio Finamor” (IPVDF), Estrada do Conde 6000, Eldorado do Sul, Rio Grande do Sul (RS), CEP 92990-000, Brazil

... Cold Spring Harbour Laboratory Press, New York 18. Schat KA (2009) Chicken anemia virus. Curr Top Microbiol Immunol 331:151–183 19. SoftBerry FPROM program. http://www.softberry. ru/berry.phtml? group=programs&subgroup=promoter&topic=fprom 20. ...


Archiv Tierzucht
54 (2011) 4, 430-438, ISSN 0003-9438

Polymorphic sites in the 5?-region of the porcine C8A gene

D? Vo Anh Khoa 1,2, Siriluck Ponsuksili 1 , Eduard Murani 1 and Klaus Wimmers 1
1 Research Unit »Molecular Biology« Leibniz Institute for Farm Animals Biology (FBN), Dummerstorf, Germany, 2 Department of Animal Sciences, College of Agriculture and Applied Biology, Cantho University, Cantho City, Vietnam

... In silico analysis software The Neural Network Promoter Prediction http://www.fruitfly.org/ seq_ tools/promoter.html and the FPROM software http://www.softberry.com were used to identify the transcription start site (TSS) and TATA-box, respectively. ...


BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51

Identification of a novel temperature sensitive promoter in cho cells

Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria 2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria

... Computational analysis of this region was performed using several freely available online prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/ berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...


Journal of Virology
December 2009, p. 12769-12778, Vol. 83, No. 24

The 5' Leader of the mRNA Encoding the Marek's Disease Virus Serotype 1 pp14 Protein Contains an Intronic Internal Ribosome Entry Site with Allosteric Properties

Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, United Kingdom,1 Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037

... Promoter prediction and validation. We used different web-based programs for promoter predictions. These included the FPROM program (Softberry, Inc., Mt. Kisco, NY) and the Neural Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...


J. Virol.
2009 doi:10.1128/JVI.01010-09

The 5' Leader of the mRNA encoding the MDV-1 pp14 protein contains an intronic IRES with allosteric properties

Tahiri-Alaoui et al.,
Institute for Animal Health, Division of Microbiology, Compton, Berkshire RG20 7NN, UK; Department of Neurobiology, The Scripps Research Institute and The Skaggs Institute for Chemical Biology, La Jolla, California 92037, USA

... Promoter prediction and validation. We have used different web-based programs for promoter predictions. 20 These included the FPROM program (http://www.softberry.ru/berry) and the Neural Network Promoter Prediction program (http://www.fruitfly.org/seq_tools/promoter). ...


Molecular Biotechnology
Volume 39, Number 2 / June 2008 pp. 135-139

Identification of CHO Endogenous Promoter Elements Based on a Genomic Library Approach

Jens Pontiller, Stefan Gross, Haruthai Thaisuchat, Friedemann Hesse and Wolfgang Ernst
... http://www. softberry.co m/berry.pht ml?topic=fprom&group =programs &subgroup =promoter http://www .softberry. ... http://www .softberry. ...


Entomological Research
2008 Volume 38 Issue 1, Pages 77 - 86 On page(s): 50-53

Differential expression profile of genes encoded in a genome segment of Cotesia plutellae bracovirus in a parasitized host, Plutella xylostella

Wael GAD, Jae Young CHOI, Yeon Ho JE and Yonggyun KIM
1 Department of Bioresource Sciences, Andong National University, Andong, Korea 2 School of Agricultural Biotechnology, Seoul National University, Seoul, Korea

... Promoter components were predicted using SoftBerry fprom (http://softberry.com/berry. phtml?topic=fpromgroup=helpsubgroup=promoter). Southern hybridization. ...


Bioinformatics and Biomedical Engineering, 2008. ICBBE 2008. The 2nd International Conference
Publication Date: 16-18 May 2008 On page(s): 50-53

Sequence Analysis in Vicinity of Type 2 Diabetes Related SNP rs7903146

Jiao Chuan-zhen et al.,
... C. Promoter predication and transcription binding sites identification The FPROM program for Human promoter prediction on http://www.softberry.com server was ...


BMC Genomics
2007, 8:374doi:10.1186/1471-2164-8-374

MetaProm: a neural network based meta-predictor for alternative human promoter prediction

Junwen Wang, Lyle H Ungar, Hung Tseng and Sridhar Hannenhalli
Center for Bioinformatics, University of Pennsylvania, Philadelphia, PA 19104, USA
Department of Genetics, University of Pennsylvania, Philadelphia, PA 19104, USA

... In this paper, we evaluate the performances of current major promoter prediction programs (i.e., PSPA, FirstEF, McPromoter, DragonGSF, DragonPF, and FProm) using 42,536 distinct human gene promoters on a genome-wide scale, and with emphasis on alternative promoters. ... FProm: Human Promoter Prediction. [http://www.softberry.com/berry.phtml?topic=fprom&group=programs&subgroup=promoter.] ...


Genome Biology
2006, 7(Suppl 1):S10

Automatic annotation of eukaryotic genes, pseudogenes and promoters

Victor Solovyev, Peter Kosarev, Igor Seledsov and Denis Vorobyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Softberry Inc., Radio Circle, Mount Kisco, NY10549, USA

... The Fprom promoter prediction program identifies 80% of TATA promoters sequences with one false positive prediction per 2,000 base-pairs (bp) and 50% of TATA-less promoters with one false positive prediction per 650 bp. ...


Genome Biology
2006, 7(Suppl 1):S3

Performance assessment of promoter predictions on ENCODE regions in the EGASP experimen

Bajic et al.,
South African National Bioinformatics Institute (SANBI), University of the Western Cape, Bellville 7535, South Africa

... threshold of +0.005. The program can be found at [45]. Fprom: Softberry Pol-II promoter recognition approach. The task of finding ...


CpGFinder

Molecular Ecology
(2016) 25, 1801–1811 doi: 10.1111/mec.13519

Evidence from pyrosequencing indicates that natural variation in animal personality is associated with DRD4 DNA methylation

Verhulst, E. C. et al.,
*Department of Animal Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Droevendaalsesteeg 10, 6708 PB, Wageningen, The Netherlands, †Department of Terrestrial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Droevendaalsesteeg 10, 6708 PB, Wageningen, The Netherlands

... A CGI motif was searched in the DRD4 genomic region (GenBank accession DQ006802) using CpGFinder (Softberry, USA) with the base pair numbering set to 1 on the transcription start site. ... 2016). This indirectly supports the interpretation that ...


Animal reproduction science
2015, 154, 95-104. doi:10.1016/j.anireprosci.2014.11.023

Sequence and regulation of the porcine FSHR gene promoter

Wu, W et al.,
Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China

... Possible CpG islands were searched for using CpGfinder on Softberry (http://linux1.softberry.com/berry.phtml), CpG Island Searcher (http://cpgislands.usc. edu/) and MethPrimer (http://www.urogene.org/methprimer/index1.html). ...


Applied microbiology and biotechnology
2015, 99(19), 8199-8215. DOI: 10.1007/s00253-015-6639-5

A novel salt-tolerant chitobiosidase discovered by genetic screening of a metagenomic library derived from chitin-amended agricultural soil

Cretoiu, M. S., Berini, F., Kielak, A. M., Marinelli, F., van Elsas, J. D.
1. Department of Microbial Ecology, CEES, University of Groningen, Groningen, The Netherlands 2. Department of Marine Microbiology, Royal Netherlands Institute for Sea Research, Yerseke, The Netherlands

... Bacterial promoters were predicted using BProm (SoftBerry, http://?linux1.?softberry.? com/?berry). ... 2010). Searches for G + C-rich islands were performed using CpGFinder (SoftBerry; http://?linux1.?softberry.?com/?berry). ...


Gene
2014, 544(2), 165-176. DOI: 10.1016/j.gene.2014.04.062

Identification and characterization of a Sox2 homolog in the Japanese flounder Paralichthys olivaceus

Gao J. et al.,
a College of Marine Life Science, Ocean University of China, Key Laboratory of Marine Genetics and Breeding, Ministry of Education, 5 Yushan Road, Qingdao 266003, China b College of Marine Life Science, Ocean University of China, Laboratory of Biochemistry and Biomaterials, 5 Yushan Road, Qingdao 266003, China

... The presence of a CpG-rich region within the upstream region was analyzed using the Softberry CpGFinder program (http://linux1.softberry.com/berry.phtml?topic= cpgfinder&group=programs&subgroup=promoter). 2.5. Bisulfite sequencing. ...


Cellular and molecular neurobiology
2014, 34(5), 715-725. DOI:10.1007/s10571-014-0053-x

Identification, Cloning, and Functional Analysis of the TATA-Less Mouse FNDC5 Promoter During Neural Differentiation

Seifi T. et al.,
1. Department of Biology, School of Sciences, University of Isfahan, Isfahan, Iran 5. Department of Biology, Payame Noor University, P.O. Box 19395-4697, Tehran, Iran 2. Department of Cellular Biotechnology at Cell Science Research Center, ACECR, Royan Institute for Biotechnology, 816513-1378, Isfahan, Iran

... www.genomatix.de) (Sobocki et al. 2007). CG content was predicted and calculated by CpG Island finder (http://linux1.softberry.com), CpG plot (http://www. ebi.ac.uk/Tools/emboss/cpgplot). Approximately, 2 9 104 bp upstream ...


Biochemical and Biophysical Research Communications
Volume 438, Issue 1, 16 August 2013, Pages 54–60 DOI:10.1016/j.bbrc.2013.07.023

Differential DNA methylation patterns in the CD86 gene controls its constitutive expression in keratinocytes

M.A. Romero-Tlalolini, P. Chavez Olmos, Efrain Garrido
Department of Genetics and Molecular Biology, CINVESTAV-IPN, Mexico City, Mexico

... human CD86 genomic region (GenBank ID: 942) including the coding sequence, the promoter and the upstream intergenic region was analyzed in silico using three different software programs: Methyl Primer Express Software v1.0 (Applied Biosystems), Softberry CpG Finder ...


Gene
Volume 529, Issue 2, 25 October 2013, Pages 238–244 DOI:10.1016/j.gene.2013.07.102

Core promoter analysis of porcine Six1 gene and its regulation of the promoter activity by CpG methylation

Wu et al.,
a Department of Animal Genetics, Breeding and Reproduction, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China b Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture, College of Animal Science, Huazhong Agricultural University, Wuhan, Hubei 430070, China

... sites. While, possible CpG islands were predicted using the program CpG finder on Softberry (http://www.softberry.com/berry.phtml) and MethPrimer (http://www. urogene.org/methprimer/index1.html). 2.3. Plasmids. To produce ...


Fish Physiology and Biochemistry
Volume 39, Issue 5 , pp 1153-1163 DOI:10.1007/s10695-013-9771-0

Identification of HIF-1a promoter and expression regulation of HIF-1a gene by LPS and hypoxia in zebrafish

Shasha Liu, Kecheng Zhu, Nan Chen, Weimin Wang, Huanling Wang
1. Key Lab of Freshwater Animal Breeding, Key Laboratory of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, College of Fishery, Huazhong Agricultural University, Wuhan, 430070, People’s Republic of China

... 72 °C for 8 min. The PCR product was cloned into pGEM-T Easy vector (Promega, Germany) and sequenced. The CpG island was predicted by CpG finder (http://linux1.softberry.com/berry.phtml). To identify putative cis-acting ...


Molecular Biology Reports
June 2012, Volume 39, Issue 6, pp 6449-6465 doi: 10.3389/fmicb.2012.00185

Molecular analysis of a sunflower gene encoding an homologous of the B subunit of a CAAT binding factor

Salvini et al.,
1. Scuola Normale Superiore, Piazza dei Cavalieri 7, 56126, Pisa, Italy 2. Dipartimento di Biologia delle Piante Agrarie, Sezione di Genetica, Universita di Pisa, Via Matteotti 1B, 56124, Pisa, Italy

... The sequence of the intergenic DNA fragment spanning from the start codon of the HaL1L coding region back to the stop codon of the upstream gene was examined with ''CpG- finder'' software available at the site http://www.softberry. com to look for CpG isles. ...


PLoS ONE
7(3): e32154. doi:10.1371/journal.pone.0032154

Isolation of a 97-kb Minimal Essential MHC B Locus from a New Reverse-4D BAC Library of the Golden Pheasant.

Ye Q, He K, Wu S-Y, Wan Q-H
The Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education and State Conservation Center for Gene Resources of Endangered Wildlife, College of Life Sciences, Zhejiang University, Hangzhou, China

... CpG islands were elicited with Softberry CpGfinder (http://linux1.softberry.com/all.html),...


Plasmid
Volume 66, Issue 1, October 2011, Pages 7–18 DOI: 10.1016/j.plasmid.2011.03.002

Nucleotide sequence of Pseudomonas aeruginosa conjugative plasmid pUM505 containing virulence and heavy-metal resistance genes

M.I. Ramirez-Diaz a, , 1, , A. Diaz-Magana a, V. Meza-Carmen b, L. Johnstone c, C. Cervantes a, C. Rensing d
a Instituto de Investigaciones Quimico-Biologicas, Universidad Michoacana, Morelia, Michoacan, Mexico b Facultad de Ciencias Medicas y Biologicas “Dr. Ignacio Chavez”, Universidad Michoacana, Morelia, Michoacan, Mexico

... Rho-independent bacterial terminators were searched using the program FindTerm (Softberry Inc.). ... Search for genomic islands was made using CpG finger program from Softberry programs (http://www.linux1.softberry.com/berry.phtml). ...


Asian-Aust. J. Anim. Sci.
Vol. 24, No. 4 : 463 - 470 April 2011

Single Nucleotide Polymorphisms of the GnRHR Gene Associated with Reproductive Traits of Japanese Flounder (Paralichthys olivaceus)

He et al.,
Fisheries College, Ocean University of China, Qingdao 266003, China

... 2001). In this study, the consensus GnRHR sequence was analyzed for the presence of a CpG Island using Soft berry CpG Finder (http://www.softberry.com/berry.phtml? topic=cpgfinder&gr oup=programs&subgroup=promoter). It ...


Molecular Biology Reports
Volume 38, Issue 4 , pp 2619-2632 DOI: 10.1007/s11033-010-0403-9

Molecular characterization, expression patterns and polymorphism analysis of porcine Six1 gene

W.Wu et al.,
1. Key Laboratory of Swine Genetics and Breeding, Ministry of Agriculture and Key Lab of Agriculture Animal Genetics, Breeding and Reproduction, Ministry of Education, Beijing, People’s Republic of China 2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... Proscan software, version 1.7 was used to predict the putative promoter and transcription factor binding sites (http:// www-bimas.cit.nih.gov/molbio/proscan/). Possible CpG islands were searched with the program CpG finder on Softberry (http://www.softberry.com/berry.phtml). ...


FEMS Microbiology Ecology
Volume 71, Issue 1, pages 23–33, January 2010

Phylogenetic and metagenomic analysis of Verrucomicrobia in former agricultural grassland soil

Kielak et al.,
1 Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), Heteren, The Netherlands 2 Arlington Department of Biology, University of Texas, Arlington, TX, USA

... Searches for GC islands were performed using CPGFINDER (SoftBerry, http://linux1.softberry. com). For identification of potential HGT regions, the method described by Tamames & Moya (2008) was applied to examine tetranu- cleotide frequencies. ... 


Applied and Environmental Microbiology
October 2010, p. 6769-6777, Vol. 76, No. 20 doi:10.1128/AEM.00343-10

Comparative Analysis of Acidobacterial Genomic Fragments from Terrestrial and Aquatic Metagenomic Libraries, with Emphasis on Acidobacteria Subdivision 6

Anna M. Kielak, 1 Johannes A. van Veen, 1,2 and George A. Kowalchuk 1,3*
Department of Microbial Ecology, Netherlands Institute of Ecology (NIOO-KNAW), P.O. Box 40, 6666 ZG Heteren, Netherlands,1 Institute of Biology Leiden University, P.O. Box 9516, 2300 RA Leiden, Netherland,2

...Annotation and sequence properties. Open reading frames (ORFs) were assigned using the GLIMMER (12) and FGENESB (http://linux1.softberry.com) software tools. ... Searches for GC islands were performed using CpGFinder (http://linux1.softberry.com). ... .


BMC Cancer
2008, 8:253 doi:10.1186/1471-2407-8-253

Promoter methylation inhibits BRD 7 expression in human nasopharyngeal carcinoma cells

H Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Changsha, Hunan, 410078, PR China

... CpGplot and Softberry CpGFinder, respectively. ... http://www.ebi.ac.uk/emboss/cpgplot) program CpGplot and Softberry CpGFinder program Page 6. 5 ...


Molecular and Cellular Neuroscience
Volume 37, Issue 3, March 2008, Pages 537-547

Identification and characterization of the promoter region of the Nav1.7 voltage-gated sodium channel gene (SCN9A)

Diss et al.,
aMedical Molecular Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK bMolecular Haematology and Cancer Biology Unit, Institute of Child Health, University College London, Guilford Street, London WC1N 1EH, UK

... This is not within a CpG island (EMBOSS CpG Plot, http://www.ebi.ac.uk/emboss/cpgplot/; Softberry-CpGFinder, http://www.softberry.com/berry.phtml topic ...


Gene
Volume 384, 15 December 2006, Pages 62-72

Isolation and molecular characterization of the porcine transforming growth factor beta type I receptor (TGFBR1) gene

Kefei Chen, Laurie A. Rund, Jonathan E. Beever and Lawrence B. Schooka
Department of Animal Sciences, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA
Institute for Genomic Biology, University of Illinois at Urbana–Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA

... com). Possible CpG islands were searched with the program CpGfinder on Softberry (http://www.softberry.com/berry.phtml). Protein ...


Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology
Volume 141, Issue 4, August 2005, Pages 406-411

Analysis of CpG methylation in the killifish CYP1A promoter

Alicia R. Timme-Laragy a, Joel N. Meyer a, Robert A. Waterland b and Richard T. Di Giulio
aNicholas School of the Environment and Earth Sciences/Integrated Toxicology Program, Box 90328, Duke University, Durham, NC, USA bDepartments of Pediatrics and Molecular and Human Genetics, Baylor College of Medicine, USDA Children's Nutrition Research Center, Houston, TX, USA

... The consensus CYP1A promoter sequence was analyzed for the presence of a CpG Island using Softberry CpGFinder (http://www.softberry.com/berry.phtml?topic ...


Gene
Volume 340, Issue 1, 29 September 2004, Pages 19-30

Isolation and molecular characterization of the porcine stearoyl-CoA desaturase gene

Jun Ren a, b, Christoph Knorr a, Lusheng Huang b and Bertram Brenig
a Institute of Veterinary Medicine, Georg-August-University of Go"ttingen, Groner Landstrasse 2, Go"ttingen 37073, Germany b Jiangxi Provincial Key Laboratory for Animal Biotechnology, Jiangxi Agricultural University, Nanchang 330045, PR China

... com). Possible CpG islands were searched with the program CpGfinder on Softberry (http://www.softberry.com/berry.phtml). Repetitive ...


NSITE

Biosci. Rep.
(2016) / 36 / art:e00293 / doi 10.1042/BSR20150290

Interrupted E2F1-miR-34c-SCF negative feedback loop by hyper-methylation promotes colorectal cancer cell proliferation

Yang S. et al.,
*Department of Histology and Embryology, School of Basic Medical Sciences, Capital Medical University, Beijing 100069, P.R. China †Beijing Key Laboratory of Cancer Invasion and Metastasis Research, Beijing 100069, P.R. China

... Prediction of transcription factors for miR-34c was conducted using TFSearch (http:// www.cbrc.jp/research/db/TFSEARCH.html), NSite (http:// linux1.softberry.com/) and Alggen (http://alggen.lsi.upc. edu/). CpG island was predicted by EMBOSS Cpgplot (http://www.ebi.ac.uk/Tools/seqstats/emboss_cpgplot/). ...


Journal of cellular physiology
2016 DOI: 10.1002/jcp.25391

Atp2c2 Is Transcribed From a Unique Transcriptional Start Site in Mouse Pancreatic Acinar Cells

Fenech, M. A. et al.,
1 Children''s Health Research Institute, London, Ontario, Canada 2 Department of Pediatrics, University of Western Ontario, London, Ontario, Canada

... In all cases, n = 3. Download figure to PowerPoint. The region upstream of the Atp2c2c TSS was examined for putative transcription factor binding motifs using the Alibaba-Gene Regulation Data Base and Nsite—softberry (http://www.softberry.com). ...


Journal of Thoracic Oncology
2016 DOI: http://dx.doi.org/10.1016/j.jtho.2016.05.010

ITPKA gene body methylation regulates gene expression and serves as an early diagnostic marker in lung and other cancers

Wang, Y. W. et al.,
Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, Dallas, TX, USA The Center for Systems Biology, Department of Molecular and Cell Biology, The University of Texas at Dallas, Richardson, TX, USA

... binding motifs present in both ITPKA promoter and CpG island-2 regions. Using the Softberry NSITE Program (http://www.softberry.com), we identified putative binding motifs for SP1 in the promoter (nts -89 to -140) as well as CpG island-2 (motif 1 nts ...


Bioinformatics
2015, btv404. doi: 10.1093/bioinformatics/btv404

Nsite, NsiteH and NsiteM computer tools for studying transcription regulatory elements

Shahmuradov, I. A., & Solovyev, V. V.
1Computer, Electrical and Mathematical Sciences and Engineering Division, KAUST, Thuwal 23955-6900, KSA, 2Bioinformatics laboratory, Institute of Botany, ANAS, Baku AZ1073, Azerbaijan and 3Bioinformatics Division, Softberry Inc., Mount Kisco, NY 10549, USA

... Availability and implementation: Pre-compiled executables built under commonly used operating systems are available for download by visiting http://www.molquest.kaust.edu. sa and http://www.softberry.com. Contact: solovictor{at}gmail.com. ...


Brain Pathology
2015 DOI: 10.1111/bpa.12294

Role of microRNAs Located on Chromosome Arm 10q in Malignant Gliomas

Wolter, M., Werner, T., Malzkorn, B., Reifenberger, G.
1 Department of Neuropathology, Heinrich Heine University, Dusseldorf, Germany 2 German Cancer Consortium (DKTK), Partner Site Essen/Dusseldorf, German Cancer Research Center (DKFZ), Heidelberg, Germany

... In the 5'genomic region of miR-146b-5p, we investigated methylation patterns in and around three putative SP1 transcription factor-binding sites predicted by the NSITE program (Version 2.2004, Softberry Inc., http://linux1.softberry.com/cgi-bin/programs/promoter/nsite.pl). ...


Physiology and Molecular Biology of Plants
2015, Volume 21, Issue 4 , pp 465-478 DOI: 10.1007/s12298-015-0325-z

Identification and expression analyses of MYB and WRKY transcription factor genes in Papaver somniferum L

Tayebeh Kakeshpour, Shadi Nayebi, Sajad Rashidi Monfared , Ahmad Moieni, Ghasem Karimzadeh
1. Plant Breeding and Biotechnology Department, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran

... 1999) and Soft Berry (NSITE) (Solovyev et al. ... As a result of TFBSs identification obtained using the TRANSFAC, PLACE and SoftBerry databases, multiple unique TFBSs of many known TFs in the promoter regions of these 10 co-expressed genes were found (Table 4). WRKY ...


Am J Respir Crit Care Med
2014 , 189, A2026. DOI:

Redox Regulation Of Ap-1 At Three Response Elements Is Required For Transforming Growth Factor-b Gene Expression

Ryan, A. J., Carter, A. B., & Khan, M. T.

... Four potential AP-1 recognition sites in the 3' region of the TGF-? promoter were identified with the Softberry NSITE: M1 (-407 -> -405), M2 (-369 -> -367), M3 (+160 -> +162), M4 (+256 -> +258) with respect to transcription start site. ...


Virus genes
2014, 1-9. DOI: 10.1007/s11262-014-1081-9

Molecular characteristics of the complete genome of a J-subgroup avian leukosis virus strain isolated from Eurasian teal in China

Zeng X et al.,
1. College of Wildlife Resources, Northeast Forestry University, Harbin, 150040, China 2. Division of Avian Infectious Diseases, National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute Chinese Academy of Agricultural Sciences, No. 427 Maduan St., Harbin, 150001, China

... Transcriptional regulatory elements in the U3 were analyzed with NSITE (Recognition of Regulatory motifs) which is an online service of Soft Berry (http://?linux1.?softberry.?com/?berry.? phtml). The sequences obtained in this study have been submitted to GenBank. ...


Small Ruminant Research.
Volume 120, Issue 1, July 2014, Pages 20–26 DOI: 10.1016/j.smallrumres.2014.03.014

Genetic diversity of GH1 and LEP genes in Argentine llama ( Lama glama) populations

Daverio, M. S., Lorenzo, Y., Rigalt, F., Vidal-Rioja, L., Di Rocco, F.
a Laboratorio de Genetica Molecular, Instituto Multidisciplinario de Biologia Celular (IMBICE), CCT-CONICET-La Plata, CICPBA, Calle 526 e/10 y 11, PO Box 403, La Plata 1900, Buenos Aires, Argentina b INTA-Estacion Experimental Agropecuaria Catamarca, Ruta Provincial N° 33km 4 (4705), Sumalao, Valle Viejo, Catamarca, Argentina

... impact of amino acid substitutions on protein function was performed by using SIFT software (http://sift.jcvi.org/) whereas the analysis of putative Transcription Factor Binding Sites (TFBS) within the GH1 promoter gene was done with the NSITE program at Softberry site (http ...


Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology
2014, 169, 16-24. DOI: 10.1016/j.cbpb.2013.12.002

Acute endocrine and nutritional co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, Oncorhynchus mykiss

Mennigen J. A. et al.,
INRA, UR 1067, Nutrition, Metabolisme, Aquaculture, Aquapole, F-64310 Saint-Pee-sur-Nivelle, France

... Target sequences including a 2000 bp upstream sequence were retrieved and transcription factor binding sites predicted using the NSITE software package Version 2.2004 (www.http://linux1.softberry.com/berry.phtml, Softberry Inc.). ...


PloS one
November 11, 2013DOI: 10.1371/journal.pone.0079307

Enhancing the Laccase Production and Laccase Gene Expression in the White-Rot Fungus Trametes velutina 5930 with Great Potential for Biotechnological Applications by Different Metal Ions and Aromatic Compounds

Yang et al.,
College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, China, Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs(http://www.softberry.ru/berry. phtml?topi?c=nsite&group=programs&subgroup=promoter). ...


Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI:10.1007/s11010-012-1522-5

Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene

Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China 2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml? topic=nsite and group = programs and subgroup = promoter), and Promoter Scan (http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...


Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019

Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress

Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium

... software. The cis-acting elements were determined with the use of TSSP, NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol- tools.ca/Promoters.htm). Measurements of ethylene production. The ...


PloS one
December 31, 2013DOI: 10.1371/journal.pone.0083392

UVA and UVB Irradiation Differentially Regulate microRNA Expression in Human Primary Keratinocytes

Kraemer et al.,
Institute of Radiation Biology, Helmholtz Center Munich, Neuherberg, Germany Department Molecular Cell Biology, Center of Dermatology, Elbekliniken Stade/Buxtehude, Buxtehude, Germany

... Primers used are given in Table S2. Prediction of potential regulatory elements using the NSITE program. Potential regulatory elements in the promoter region (1500 bp) of the miRNAs commonly regulated by UVA and UVB were identified using the NSITE program (Softberry,. ...


The Plant Cell
September 2013 vol. 25 no. 9 3389-3404 DOI:10.?1105/?tpc.?113.?114736

Arabidopsis KINETOCHORE NULL2 Is an Upstream Component for Centromeric Histone H3 Variant cenH3 Deposition at Centromeres[

Lermontova et al.,
aLeibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany bInterdisciplinary Center for Crop Plant Research, Martin Luther University Halle-Wittenberg, D\x{2013}06120 Halle (Saale), Germany

... To see whether KNL2 is similarly regulated, the KNL2 promoter region was studied in silico using the NSITE program (available through www.softberry.com/berry.phtml?topic=promoter). A potential E2F binding site (CCCGCCAAA) was found at ?148 bp upstream of ATG. ...


PloS pathogenes
August 29, 2013DOI: 10.1371/journal.ppat.1003571

Schistosoma mansoni Mucin Gene (SmPoMuc) Expression: Epigenetic Control to Shape Adaptation to a New Host

Perrin et al.,
Universite de Perpignan Via Domitia, Perpignan, France, CNRS, UMR 5244, Ecologie et Evolution des Interactions (2EI), Perpignan, France Center for Infection and Immunity of Lille, Inserm U1019, CNRS UMR 8204, Institut Pasteur de Lille, University Lille Nord de France, Lille, France

...We scanned the promoter sequences for putative regulator binding sites using the web based interface Program NSITE (Softberry Inc.) (http://linux1.softberry.com/berry.phtml??topic=nsite&group=programs&subgroup=prom?oter).þþþ


Scientific Reports
3, Article number: 2178 doi:10.1038/srep02178

Hox genes are involved in vascular wall-resident multipotent stem cell differentiation into smooth muscle cells

Diana Klein, Mohamed Benchellal, Veronika Kleff, Heinz Gunther Jakob & Suleyman Ergun
Institute of Cell Biology (Cancer Research), University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany Institute of Anatomy, University of Duisburg-Essen, University Hospital, 45122 Essen, North Rhine-Westphalia, Germany

...Chromosome 11: 117,070,037-117,075,503 forward strand) was analyzed for promoter prediction sites using the Promotor 2.0 prediction server (www.cbs.dtu.dk/services/Promoter/) and SoftBerry NSITE (http://linux1.softberry.com)...


Forest Pathology
6 NOV 2012 DOI: 10.1111/efp.12011 Early View (Online Version of Record published before inclusion in an issue)

Characterization and expression of daf-9 and daf-12 genes in the pinewood nematode, Bursaphelenchus xylophilus

D.-D. Wang 1,2, X.-Y. Cheng 3,*, Y.-S. Wang 2, H.-Y. Pan 1, B.-Y. Xie 2
1 College of Plant Science, Jilin university, Changchun, China 2 Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing, China

... nested PCR. The PCR products were purified, cloned and sequenced. The sequences were analysed using NSITE (http://linux1.softberry.com/berry.phtml?topic=nsite&group= programs&subgroup=promoter). 2.5 Gene expression ...


JCB
March 19, 2012 vol. 196 no. 6 689-698 DOI: 10.1083/jcb.201201077

MicroRNA-30c-2* limits expression of proadaptive factor XBP1 in the unfolded protein response

Andrew E. Byrd, Ileana V. Aragon, and Joseph W. Brewer
Department of Microbiology and Immunology, College of Medicine, University of South Alabama, Mobile, AL 36688

... Potential transcription factor binding sites upstream of the miR-30c-2* chromosomal location were identified using the NSITE program (Softberry) and the University of California, Santa Cruz Genome browser. Reporter and expression vectors. ...


Molecular Genetics and Metabolism
Volume 106, Issue 3, July 2012, Pages 281–286 DOI: 10.1016/j.ymgme.2012.04.013,

Algorithm for Pompe disease newborn screening: Results from the Taiwan screening program

Shu-Chuan Chiang a, Wuh-Liang Hwu a, b, Ni-Chung Lee a, b, Li-Wen Hsu a, Yin-Hsiu Chien a, b
a Department of Medical Genetics, National Taiwan University Hospital, Taipei, Taiwan b Department of Pediatrics, National Taiwan University Hospital and National Taiwan University School of Medicine, Taipei, Taiwan

... upon request). The promoter regions (? 500 bp) of the GAA and neutral ?-glucosidase C (GANC) genes were analyzed by the NSITE program (available at http://www. softberry.com/berry.phtml). 2.3. Statistical analysis. A single ...


PLoS ONE
7(10): e48097. doi:10.1371/journal.pone.0048097

How Peroxisomes Affect Aflatoxin Biosynthesis in Aspergillus Flavus

Reverberi et al.,
Dipartimento di Biologia Ambientale, Universita Sapienza, Roma, Italy Oklahoma State University, Oklahoma City, Oklahoma, United States of America

... present in the 2.0 Kb 5' Flanking sequence (upstream) of AFLA099000, retrieved from http://fungi.ensembl.org/Aspergillus_fla?vus/Info/Index, was performed with the genomic tools in the aspergillusflavus.org website and through the NSITE tool in the softberry.com website and ...


Molecular and Cellular Biochemistry
Volume 374, Issue 1-2 , pp 213-222 DOI: 10.1007/s11010-012-1522-5

Molecular characterization and identification of the E2/P4 response element in the porcine HOXA10 gene

Wu et al.,
1. Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction of Ministry of Education and Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China 2. College of Animal Science, Huazhong Agricultural University, Wuhan, 430070, Hubei, People’s Republic of China

... upenn.edu/cgi-bin/tess/tess), the NSITE program (http:// linux1.softberry.com/berry.phtml? topic=nsite and group = programs and subgroup = promoter), and Promoter Scan (http://www.bimas.cit.nih.gov/molbio/proscan). Ishikawa cell culture ...


African Journal of Biotechnology
Vol. 11 (31), pp. 7864-7874, 17 April, 2012 DOI: 10.5897/AJB11.1229

The characterization of cytoplasmic ribosomal protein genes in microsporidian Nosema bombycis Genome

Handeng Liu 1,2, Guoqing Pan 1*, Tian Li 1, Wei Huang 1 and Zeyang Zhou 1,3,
1Institute of Sericulture and Systems Biology, Southwest University, Chongqing 400716, P.R. China. 2Experimental Teaching Center, Chongqing Medical University, Chongqing 400016, P.R. China.

... from the initiation site of the predicted transcription start site (TSS, +1). The regions 500 bps upstream from the transcription initiation site were used for analyzing the potential binding sites for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...


Plant Science
Volumes 193–194, September 2012, Pages 39–47 http://dx.doi.org/10.1016/j.plantsci.2012.05.005

The regulation of the SARK promoter activity by hormones and environmental signals

Carla A. Delatorre a, b, 1, Yuval Cohen a, c, 1, Li Liu a, 1, Zvi Peleg a, 2,
a Department of Plant Sciences, University of California, Davis, CA 95616, USA b Department of Crop Science, Agronomy School, Federal University of Rio Grande do Sul (UFRGS), Porto Alegre, RS, 91501970, Brazil

... To identify cis-regulatory elements in the promoter, cis-element search programs at PLACE (http://www.dna.affrc.go.jp/PLACE/info.html, PlantCARE (http://bioinformatics.psb.ugent.be/ webtools/plantcare/html/), and NSITE (http://linux1.softberry.com/cgi-bin/programs/promoter ...


Sci. Signal.
18 January 2011 Vol. 4, Issue 156, p. ra2 [DOI: 10.1126/scisignal.2001211]

The Kinase SGK1 in the Endoderm and Mesoderm Promotes Ectodermal Survival by Down-Regulating Components of the Death-Inducing Signaling Complex. Sci. Signal. 4, ra2 (2011).

T. Endo, M. Kusakabe, K. Sunadome, T. Yamamoto, E. Nishida

... Cis-regulatory elements in the promoter regions were searched with TRANSFAC (41) and NSITE (http://linux1.softberry.com/berry.phtml). ChIP. ChIP was performed as described (42). Fifty embryos were injected with HA-xRelA mRNA at four-cell stage. ...


Virology Journal
2011, 8:158 http://www.virologyj.com/content/8/1/158

Sequence analysis for the complete proviral genome of subgroup J Avian Leukosis virus associated with hemangioma: a special 11 bp deletion was observed in U3 region of 3’UTR

Shi et al.,
1 College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, Sichuan, 625014, China

... DNASTAR package. Transcriptional regulatory elements in U3 were analyzed by the online service system of NSITE (Recog- nition of Regulatory motifs) of SoftBerry (http://linux1. softberry.com/berry.phtml). Phylogenetic analysis ...


Virology Journal
2011, 8:552 http://www.virologyj.com/content/8/1/552

Novel sequences of subgroup J avian leukosis viruses associated with hemangioma in Chinese layer hens

Pan et al.,
1 Division of Avian Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, PR China

... Bootstrap values were calculated using 500 or 1000 replicates of the alignment. Transcriptional regulatory elements in the U3 were ana- lyzed by NSITE (Recognition of Regulatory motifs), an online service of Soft Berry (http://linux1.softberry.com/ berry.phtml). ...


Genetics and Molecular Research
10 (3): 1777-1786 (2011) DOI: 10.4238/vol10-3gmr1466.

Molecular cloning, characterization and association analysis of the promoter region of the bovine CDK6 gene

Liu YF, Zan LS, Cui WT, Xin YP, Jiao Y, Li K.
College of Animal Science and Technology, Northwest Agriculture and Forestry University, Yangling Shaanxi, PR China.

... were analyzed using Cat- tle dbSNP (http://www.ncbi.nlm.nih.gov/snp/limits), Transcription Element Search System (http://www.cbil.upenn.edu/cgi-bin/tess/tess), Promoter Scan (http://www.bimas. cit.nih.gov/ molbio/proscan), and the NSITE program (Softberry, http://linux1 ...


Mol Cancer Res
April 2011 9; 497 doi: 10.1158/1541-7786.MCR-10-0556

Expression Regulation of the Metastasis-Promoting Protein InsP3-Kinase-A in Tumor Cells

Chang et al.,
1Institut fur Biochemie und Molekularbiologie I: Zellulare Signaltransduktion; 2Institut fur Tumorbiologie, Universitatsklinikum Hamburg-Eppendorf, Hamburg, Germany

... transcription factors was investigated. Therefore, transcription factor binding sites in ITPKA-1250 were analyzed by a Softberry NSITE motif search (core similarity 0.8, significance level 0.95) motif search. Potential binding sites ...


Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126–3137 DOI: 10.1016/j.biortech.2010.10.079

Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes

Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry. ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...


Journal of Hazardous Materials
Volume 192, Issue 2, 30 August 2011, Pages 855–873 DOI: 10.1016/j.jhazmat.2011.05.106,

Decolorization of different dyes by a newly isolated white-rot fungi strain Ganoderma sp.En3 and cloning and functional analysis of its laccase gene

Rui Zhuo et al.,
a Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry. ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...


Cellular and Molecular Life Sciences
Volume 68, Issue 24 , pp 4115-4132 DOI: 10.1007/s00018-011-0785-4

Functional diversity of melanopsins and their global expression in the teleost retina

Davies et al.,
1. Nuffield Laboratory of Ophthalmology, Nuffield Department of Clinical Neurosciences, Levels 5-6 West Wing, John Radcliffe Hospital, University of Oxford, Headley Way, Oxford, OX3 9DU, UK 2. Department of Cell and Developmental Biology, Centre for Cell and Molecular Dynamics, University College London, 21 University Street, London, WC1E 6DE, UK

... gene were performed by using the MatrixTM Version 1.0 database (with a cut- off filter to minimize false positives) (http://www.gene- regulation.com/cgi-bin/pub/programs/match/bin/match.cgi) and NSITE: Animal TFD from Ghosh database (http:// linux1.softberry.com/berry.phtml ...


Applied Microbiology and Biotechnology
2011, Volume 91, Issue 4 , pp 1107-1119 DOI: 10.1007/s00253-011-3355-7

PdCYP51B, a new putative sterol 14?-demethylase gene of Penicillium digitatum involved in resistance to imazalil and other fungicides inhibiting ergosterol synthesis

Xuepeng Sun, Jiye Wang, Dan Feng, Zhonghua Ma, Hongye Li
1. Institute of Biotechnology, Zhejiang University, Hangzhou, Zhejiang, 310029, China 2. Key Laboratory of Molecular Biology for Crop Pathogens and Insect Pests of Ministry of Agriculture, Zhejiang University, Hangzhou, Zhejiang, 310029, China

... The NSITE program (www.softberry.com) and the eukaryotic promoter predictor (Berkeley Drosophila Genome Project, http://www.fruitfly.org/seq_tools/promoter.html) were used to analyze the sequence of PdCYP51B gene. The protein ... softberry.com). ...


Scandinavian Journal of Rheumatology
May 2010, Vol. 39, No. 3 , Pages 254-258 (doi:10.3109/03009740903347983)

Association of TBX21 gene haplotypes in a Chinese population with systemic lupus erythematosus

You et al.,
1Department of Dermatology 2Department of Paediatrics 3Department of Infectious Diseases, Southwest Hospital, Third Military Medical University, Chongqing, P. R. China

... (A) Computer analysis of sequences covering -1993 bp, by using NSITE (http://linux1.softberry. com/berry.phtml?topic = nsite&group =programs&subgroup = promoter), indicated that the -1993T>C SNP is located on a putative binding site for the Sp1 transcription factor. ... 


Bioresource Technology
Volume 102, Issue 3, February 2011, Pages 3126-3137, doi:10.1016/j.biortech.2010.10.079

Cloning and functional analysis of a new laccase gene from Trametes sp. 48424 which had the high yield of laccase and strong ability for decolorizing different dyes

Fan et al.,
a College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan 430074, China b Key Laboratory of Oil Crops Biology of Ministry of Agriculture in China, Oil Crops Research Institute of Chinese Academy of Agricultural Sciences, Wuhan 430064, China

... The putative cis-acting elements in the promoter region of laccase gene were predicted and identified with SoftBerry-NSITE/Recognition of Regulatory motifs (http://www.softberry. ru/berry.phtml?topic=nsite&group=programs&subgroup=promoter). ...


The Journal of Physiological Sciences
Volume 59, Number 2 / March, 2009, pp. 81-86

Association of Ala589Ser polymorphism of WNK4 gene with essential hypertension in a high-risk Chinese population

Sun et al.,
(1) Department of Medical Genetics, China Medical University, Shenyang, 110001, China (2) Department of Cardiology, Shengjing Hospital, China Medical University, Shenyang, 110004, China

... 2). Using software including TRANSFAC 4.0 (avail- able at http://transfac.gbf.de/TRANSFAC/), TSSG/TSSH (available at http://www.cbs.dtu.dk/services/Promoter/) and NSITE (available at http://www.softberry.com/berry.phtml), a number of cis-acting elements, eg, AP1, SP1, GRE ...


Gene
Volume 435, Issues 1-2, 15 April 2009, Pages 63-71

Characterization of porcine MMP-2 and its association with immune traits

Honggang Huang et al.,
aKey Laboratory for Farm Animal Genetic Resources and Utilization of Ministry of Agriculture of China, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, PR China

... The 5?-?anking DNA sequences were analyzed using the Transcription Element Search System (http://www.cbil.upenn.edu/cgi-bin/tess/tess), the NSITE program (http://linux1.softberry.com/berry. phtml?topic=nsite and group=programs and subgroup=promoter), and the ...


Meat Science
Volume 82, Issue 2, June 2009, Pages 278-283

Identification of the new polymorphisms in the promoter region of the CAST gene in cattle

E. Juszczuk-Kubiak a, E, K. Flisikowski b, K. Wicin'ska a, J. Po?oszynowicza and S. Rosochacki a, c
aInstitute of Genetics and Animal Breeding, Polish Academy of Sciences, Jastrze;biec, 05-552 Wo'lka Kosowska, Poland bLehrstuhl fuer Tierzucht Technische Universitat in Muenchen, 85354 Hochfeldweg 1, Freising, Germany

... Sequences with 100% identity to TF-binding sites were searched in the NSITE program (Softberry, Inc., USA, http://www.softberry.com) and TESS software (Schug J & Overton, Ch.G.; http://www.cbil.upenn.edu/tess). 3. Results and discussion. ...


Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90

Characterization of the murine Dfna5 promoter and regulatory regions

Karen Vrijens a, Guy Van Camp a and Lut Van Laer a
aDepartment of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium

... Transcription factor (TF) binding sites were scored using three programs, MatInspector (www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www-bimas.cit.nih.gov/ molbio/proscan/). 2.2. 5?- and 3?-rapid amplification of cDNA ends (RACE). ...


BMC Molecular Biology
2008, 9:104 doi:10.1186/1471-2199-9-104

The artiodactyl APOBEC3 innate immune repertoire shows evidence for a multi-functional domain organization that existed in the ancestor of placental mammals

LaRue et al.,
Department of Biochemistry, Molecular Biology and Biophysics, Institute for Molecular Virology,BeckmanCenter for Genome Engineering,University of Minnesota,Minneapolis, Minnesota 55455,USA

... were identified and compared using the TransFac and Biobase databases through the softberry NSITE portal (www.softberry.com). The ...


Gene
Volume 432, Issues 1-2, 1 March 2009, Pages 82-90

Characterization of the murine Dfna5 promoter and regulatory regions

Karen Vrijens, Guy Van Camp and Lut Van Laer
Department of Medical Genetics, University of Antwerp, Campus Drie Eiken, Universiteitsplein 1, B-2610 Antwerp, Belgium

... Transcription factor (TF) binding sites were scored using three programs, MatInspector (www.genomatix.de), NSITE (http://softberry.com/) and ProScan (http://www ...


Eukaryotic Cell
June 2008, p. 988-1000, Vol. 7, No. 6 doi:10.1128/EC.00228-07

Modulation of Antioxidant Defense in Aspergillus parasiticus Is Involved in Aflatoxin Biosynthesis: a Role for the ApyapA Gene{triangledown}

Reverberi, M et al.,
... This analysis was performed using the NSITE tool in the Softberry software package, which allowed us to reveal all of the putative regulatory elements present ...


International Journal of Plant Sciences
169(6):701–707. 2008.

The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants

Sabina Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot 111, SI-1000 Ljubljana, Slovenia

... Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ... Signal Scan program and the REGSITE database with the NSITE program, several ...


DNA and Cell Biology
June 1, 2008, 27(6): 307-314. doi:10.1089/dna.2007.0692

Identification and Characterization of the Human Testes-Specific Protease 50 Gene Promoter

M. Wang et al.,
Institute of Genetics and Cytology, Northeast Normal University, ChangChun, China.

.. MatInspector(Carthariusetal.,2005) (http:==www.genomatix.de=cgi-bin=matinspector_prof), and NSITE (Solovyev and Shahmuradov, 2006) (http:==www .softberry.com). ..


Plant Pathology
57(1):92-102, February 2008.

A role for oxidative stress in the Citrus limon/Phoma tracheiphila interaction.

Reverberi, M et al.,
... NSite and cellular localization predictions were performed by the software PSITE (© Softberry, Inc. 2000-2005). Statistics TOP. ...


Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208

Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes

Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy

... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter, Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.), "TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...


J Appl Genet
48(4), 2007, pp. 371–374

Polymorphisms in intron 1 of the porcine POU1F1 gene

Cheng-Yi Song et al.,
College of Animal Science & Technology, Yangzhou University, Jiangsu, China; Division of Biological Sciences, University of Missouri-Columbia, Columbia, MO, USA

... the potential functional importance of the 313-bp indel, the insertion sequences were analysed in silico and by the use of NSITE pro- gram (Softberry, Inc, USA ...


Molecular Microbiology
(2007), 66 (2), 534–551

Transcriptional control of nmrA by the bZIP transcription factor MeaB reveals a new level of nitrogen regulation in Aspergillus nidulans

Koon Ho Wong, Michael J. Hynes, Richard B. Todd, Meryl A. Davis
Department of Genetics, The University of Melbourne, Melbourne, Vic. 3010, Australia

... Analysis using the NSITE algorithm (http://www.softberry.com) matched both element A and B sequences independently to the binding site of the mammalian bZIP ...


Epilepsy Research
Volume 75, Issue 2-3, Pages 145-153

Linkage and mutational analysis of CLCN2 in childhood absence epilepsy

K Everett et al.,

... using the prediction program ESEfinder version 2.0 (Cartegni et al., 2003) and the TransFac and Biobase GmbH databases via NSITE (http://www.softberry.com). ...


RNA
(2007), 13:1988-1999

Regulation of transcription of the RNA splicing factor hSlu7 by Elk-1 and Sp1 affects alternative splicing

Moti Alberstein et al.,
Department of Human Molecular Genetics and Biochemistry, Sackler Faculty of Medicine, Tel-Aviv University, Tel Aviv 69978, Israel

... programs: TRANSPLORER (http://www.developmentontheedge.com/transplorer.shtml); Genomatix (http://www.genomatix.de/); NSITE (http://www.softberry.com/berry.phtml ...


European Journal of Human Genetics
15, 463 - 472 (01 Apr 2007)

Linkage and association analysis of CACNG3 in childhood absence epilepsy

KV Everett et al.,

... identified variants was assessed by searching for predicted regulatory motifs contained within the TransFac and Biobase databases via the Softberry NSITE portal ...


Insect Science
Volume 14 Issue 1 Page 5-14, February 2007

Analysis of the structure and expression of the 30K protein genes in silkworm, Bombyx mori

QUAN SUN et al.,
The Key Laboratory of Sericulture of Agriculture Ministry, College of Sericulture and Biotechnology, Southwest University, Chongqing, China

... initiation site were used for analyzing the potential binding sites for the transcription regulatory motifs by NSITE program (http://www.softberry.com/ berry ...


Mammalian Genome
Volume 17, Number 8 / August, 2006 pp. 892-901

Identification of genetic variation and putative regulatory regions in bovine CARD15
Kristen H. Taylor, Jeremy F. Taylor, Stephen N. White and James E. Womack
Department of Veterinary Pathobiology, Texas A&M University, College Station, Texas, 77843-4467, USA

... These motifs were analyzed using NSITE (available through SoftBerry, http://www. softberry.com/berry.phtml?topic=pro- moter) to determine homology to previously ...


Human Genetics
Volume 117, Number 1 / June 2005 pp. 16-26

Functional promoter polymorphism in the TBX21 gene associated with aspirin-induced asthma
Mitsuteru Akahoshi et al.,
Laboratory for Genetics of Allergic Diseases, SNP Research Center, RIKEN Yokohama Institute, Institute of Physical and Chemical Research (RIKEN), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama Kanagawa, 230-0045, Japan

... shown). Computer analysis of sequences covering A1993 bp, by using NSITE, available at http://www.softberry.com/berry.phtml? topic ...


NSITE-PL

Plant Gene
2016, 5, 78-86. doi:10.1016/j.plgene.2016.01.001

Molecular cloning and transcriptional analysis of WRKY and solavetivone biosynthetic genes in the hairy roots of Hyoscyamus albus

Kawauchi, M., Arima, T. H., Kuroyanagi, M.
Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan

.. PLACE (http://www.dna.affrc.go.jp/PLACE/index.html) and NSITE-PL (http://www.softberry.com/berry.phtml?topic=nsitep&group=programs&subgroup ...


Plant Physiology
September 2013 vol. 163 no. 1 431-440 DOI:10.?1104/?pp.?113.?221713

Histone Deacetylase AtHDA7 Is Required for Female Gametophyte and Embryo Development in Arabidopsis

Cigliano et al.,
National Research Council of Italy, Institute of Plant Genetics, Research Division Portici, 80055 Portici, Italy (R.A.C., G.C., R.P., P.T., G.P., M.F.C., C.C.); and Gregor Mendel Institute of Molecular Plant Biology, Austrian Academy of Sciences, 1030 Vienna, Austria (R.G.)

... An area 1,000 bp upstream of the predicted start codon of HDA7 was analyzed with NSITE-PL (http://linux1.softberry.com) and Akiyama's TFSEARCHv1.3 (http://molsun1.cbrc.aist.go.jp/research/ db/TFSEARCH.html) with default setting to detect putative regulatory motifs. ...


Plant Growth Regulation
Volume 71, Issue 1 , pp 77-92 DOI:10.1007/s10725-013-9814-7

A novel GRAS protein gene MtSymSCL1 plays a role in regulating nodule number in Medicago truncatula

Goon-Bo Kim, Young-Woo Nam
Sta1. Department of Life Science, Sogang University, Seoul, 121-742, Koreate

... 2008 ). The 5? upstream flanking region of MtSymSCL1 was analyzed by using the PLACE database (Higo et al. 1999 ) or the RegSite database of plant regulatory elements (NSITE-PL program, http://www.softberry.com). Construction of reporter fusion and RNAi plasmids. ...


Journal of Plant Physiology
Volume 170, Issue 18, 15 December 2013, Pages 1585–1594 DOI:10.1016/j.jplph.2013.06.019

Short term signaling responses in roots of young soybean seedlings exposed to cadmium stress

Jagna Chmielowska-Bak a, Isabelle Lefevre b, Stanley Lutts b, Joanna Deckert a
a Department of Plant Ecophysiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University in Poznan, ul. Umultowska 89, 61-614 Poznan, Poland b Groupe de Recherche en Physiologie vegetale (GRPV), Earth and Life Institute(ELI-A), Universite catholique de Louvain, Croix du Sud 4-5, bte L7.07.13, 1348 Louvain-la-Neuve, Belgium

... software. The cis-acting elements were determined with the use of TSSP, NSITE-PL and NSITE software accessible on the Softberry platform (http://molbiol- tools.ca/Promoters.htm). Measurements of ethylene production. The ...


Plant, Cell & Environment
2013, 36: 1171–1191. doi: 10.1111/pce.12051

Two closely linked tomato HKT coding genes are positional candidates for the major tomato QTL involved in Na+/K+ homeostasis

ASINS et al.,
1Plant Protection and Biotechnology Center, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain 2Department of Biochemistry, Molecular and Cellular Biology of Plants, Estacion Experimental del Zaidin, Consejo Superior de Investigaciones Cientificas (CSIC), Granada, Spain 3Center for Plant Biotechnology and Genomics (UPM-INIA), Universidad Politecnica de Madrid, Madrid, Spain

... 1999) and PlantCARE (Lescot et al. 2002) and NSITE-PL (http://linux1.softberry.com) databases and tools. The presence of CpG islands was checked by the CpG Islands Searcher web tool using the program's default settings (Takai & Jones 2002). ...


Plant Molecular Biology
Volume 82, Issue 1-2 , pp 51-58 DOI:10.1007/s11103-013-0034-3

Sugarcane Loading Stem Gene promoters drive transgene expression preferentially in the stem

Richard L. Moyle, Robert G. Birch
1. Hines Plant Science Building, The University of Queensland, Brisbane, 4072, Australia

... ScLSG promoters, by searching PLACE (Higo et al. 1999), PlantCARE (Lescot et al. 2002), Athena (O'Connor et al. 2005) and NSITE-PL (www.softberry.com/berry. phtml) databases. ScLSG5 Apex IN3 IN4 IN5 IN6 IN7 IN8 IN9 ...


Journal of Integrative Plant Biology
Volume 54, Issue 6, pages 400–411, June 2012 DOI: 10.1111/j.1744-7909.2012.01126.x

Characterization of Two Putative Protein Phosphatase Genes and Their Involvement in Phosphorus Efficiency in Phaseolus vulgaris

Cui-Yue Liang 1,2, Zhi-Jian Chen 1, Zhu-Fang Yao 1, Jiang Tian 1,*, Hong Liao 1
1 State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, Root Biology Center, South China Agricultural University, Guangzhou 510642, China 2 Robert Holley Center for Agriculture and Health, United States Department of Agriculture, Agricultural Research Service, Cornell University, Ithaca, New York 14853, USA

... genomewalker DNA library derived from G19833 genomic DNA. Putative motifs regulated by environmental stresses were identified by using the software NSITE-PL (www.softberry.com) and PLACE (http://www.dna.affrc.go.jp/PLACE/signalscan) in silico. Among them, two 8-bp ...


Plant Cell Reports
Volume 31, Issue 2 , pp 271-279 DOI 10.1007/s00299-011-1161-4

Native polyubiquitin promoter of rice provides increased constitutive expression in stable transgenic rice plants

Jagannath Bhattacharyya et al.,
1. Advanced Laboratory for Plant Genetic Engineering, Indian Institute of Technology, Kharagpur, 721302, India

... 2002; http://www.bioinformatics.psls.ugent.be/webtools/ PlantCARE/html/); Athena (O'Connor et al. 2005; http://www.bioinformatics2.wsu.edu/Athena); NSITE-PL (Soft berry, http://www.softberry.com/berry.phtml). Results Generation of transgenic rice lines ..


African Journal of Biotechnology
Vol. 11(40), pp. 9534-9542, 17 May, 2012 DOI: 10.5897/AJB12.040

Isolation and characterization of a candidate gene for resistance to cereal cyst nematode from Aegilops variabilis in China

D. L. Xu et al.,
1 Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu, Sichuan, China. 2 Graduate University of the Chinese Academy of Sciences, Beijing, China.

... The ORFs of the sequences were identified by FGENESH (http://linux1.softberry.com/) and the amino acid sequence was obtained at the same time. ... The resulting sequences were analyzed using NSITE-PL to identify regulatory motifs (http://linux1.softberry.com/). RESULTS ...


The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x

A soybean b-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses.

Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China

... accession number FJ461673). In silico analysis of the promoter sequence was performed using the software programs tssp-tcm (Shahmuradov et al., 2005), nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...


Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24

Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar

Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.

... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb. ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry, http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ... 


Plant Cell Rep.
2009 May;28(5):851-60. Epub 2009 Mar 21.

43-bp A/T-rich element upstream of the kinesin gene AtKP1 promoter functions as a silencer in Arabidopsis

Lai C, Xiong J, Li X, Qin X.
College of Biological Sciences, China Agricultural University, Beijing, China

... 1999) and NSITE-PL (www.softberry.com) to ascertain whether the 180-bp sequence has sequence similarity to other regulatory elements. We found that multiple previously reported cis- elements were present in this region (Fig. ...


BMC Evolutionary Biology
2009, 9:271 doi:10.1186/1471-2148-9-271

The evolution of Brassica napus FLOWERING LOCUST paralogues in the context of inverted chromosomal duplication blocks

Jing Wang et al.,
1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, PR China and 2Rothamsted Research, Harpenden, Herts, AL5 2JQ, UK

... Sequence analysis The coding sequences and amino acids ofBnFT paralogues were predicted using the software "Softberry FGENESH" online service (http://linux1.softberry.com/berry.phtml). ... "Softberry NSITE-PL" online service (http://linux1.softberry.com/berry.phtml). ...


Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394

Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar

Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China

... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...


Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065

Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)

Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece 2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece

... elements was performed using the database available at: http://softberry.com. TSSs were determined using the TSSP program available at the site. NSITE-PL was ...


Forestry Studies in China
June 20, 2007, pp. 95-106

Isolation and analysis of a TIR-specific promoter from poplar

Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China

... out with the BLAST search program in NCBI Transcriptional start site of the obtained DNA sequence, was predicted with the online program TSSP in Softberry. ... ... Cis-acting regulatory elements located at the promoter region were predicted by using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...


Plant Physiology
144:1786-1796 (2007)

Exclusion of Na+ via Sodium ATPase (PpENA1) Ensures Normal Growth of Physcomitrella patens under Moderate Salt Stress

Christina Lunde, Damian P. Drew, Andrew K. Jacobs and Mark Tester
Plant Biochemistry Laboratory, Department of Plant Biology, Faculty of Life Sciences, University of Copenhagen, DK–1871 Frederiksberg C, Copenhagen, Denmark (C.L.,); and Australian Centre for Plant Functional Genomics, University of Adelaide, Waite Campus, Glen Osmond, South Australia 5064, Australia (D.P.D., A.K.J., M.T.)

... obtained from the eight templates were aligned using Contig Express (Vector NTI 8). The promoter sequence was analyzed using NSITE-PL (www.softberry.com) and ...


Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1769, Issue 2, February 2007, Pages 139-148

Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis

Nitima Suttipantaa, Sitakanta Pattanaika, Samir Gunjanc, Claire H. Xiea,John Littletonb, and Ling Yuana
Department of Plant and Soil Sciences, University of Kentucky, Lexington, KY 40546, USA

... 1). Sequence analysis using PLACE (www.dna.affrc.go.jp/PLACE) [14] and the NSITE-PL program (www.softberry.com) reveals that the G10H promoter contains several ...


In Silico Biology
Volume 7, Number 1 / 2007 pp. 7-19

In silico analysis of the Lateral Organ Junction (loj) gene and promoter of Arabidopsis thaliana

Dipnarayan Saha et al.,
National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi, India

...The software programs used were AtcisDB (http://arabidopsis.med.ohio-state.edu/AtcisDB/index.jsp) [Davuluri et al., 2003] PLACE (http://www.dna.affrc.go.jp/PLACE/) [Higo et al., 1999], PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [Lescot et al., 2002], and NSITE-PL (Softberry; http://www.softberry.com/berry.phtml). Similarly NSITE-PL of Softberry Inc. and PLACE database identified a large number of cis-elements, except few the majority of which may not be relevant for the function of this promoter. ...


Plant Molecular Biology
(2006) 60, 2, 259-275

Gene Structure and Expression Pattern Analysis of Three Monodehydroascorbate Reductase (Mdhar) Genes in Physcomitrella patens: Implications for the Evolution of the MDHAR Family in Plants*

Christina Lunde , Ute Baumann, Neil J. Shirley, Damian P. Drew and Geoffrey B. Fincher
Australian Centre for Plant Functional Genomics, School of Agriculture and Wine, University of Adelaide, Waite Campus, Glen Osmond, 5064, SA, Australia

... The promoter sequence was analysed using NSITE-PL (www.softberry.com), PLACE ...


The Plant Cell
Volume18 Number 10 October 2006 2443-2451

Loading of Arabidopsis Centromeric Histone CENH3 Occurs Mainly during G2 and Requires the Presence of the Histone Fold Domain

Inna Lermontova et al.,
Leibniz Institute of Plant Genetics and Crop Plant Research, D-06466 Gatersleben, Germany

... Computer analysis of the presumed promoter region of A. thaliana CENH3, using the NSITE program (available through SoftBerry, http://www.softberry.com/berry ...


NSITEM

Genes and Immunity
07 Aug 2008, doi: 10.1038/gene.2008.63,

Expression levels of FAS are regulated through an evolutionary conserved element in intron 2, which modulates cystic fibrosis disease severity

V Kumar et al.,
# 1Department of Pediatric Pneumology and Neonatology, Hannover Medical School, Hannover, Germany # 2Institute for Medical Biometry, Informatics and Epidemiology, University of Bonn, Bonn, Germany

... Webthermodyn. 17 The program NSITEM at www.softberry.com was used to search for conserved functional motifs within the CNS. Possible ...


BMC Genetics
2008, 9:50 doi:10.1186/1471-2156-9-50

Bovine CD14 gene characterization and relationship between polymorphisms and surface expression on monocytes and polymorphonuclear neutrophils

Eveline M Ibeagha-Awemu1 Jai-Wei Lee, Aloysius E Ibeagha1 and Xin Zhao
1Department of Animal Science, McGill University, Ste-Anne-de-Bellevue, Quebec H9X 3V9, Canada and 2Department of Tropical Agriculture and International Cooperation, National Pingtung University of Science and Technology, Neipu, Pingtung 912, Taiwan

... of the CD14 genes of different species (cattle, human, mouse, rat and pig) through a query in the NSITEM data base http:/ / linux1.softberry.com/ berry.phtml


Journal of Investigative Dermatology
2006 126, 325–335. doi:10.1038/sj.jid.5700065

Transcriptional Regulation and Characterization of the Promoter Region of the Human ABCC6 Gene

Qiujie Jiang1, Yasushi Matsuzaki1, Kehua Li and Jouni Uitto
# Department of Dermatology and Cutaneous Biology, Jefferson Medical College, Thomas Jefferson University, Philadelphia, Pennsylvania, USA # 2Department of Biochemistry and Molecular Biology, Jefferson Institute of Molecular Medicine, Thomas Jefferson University, Philadelphia, Pennsylvania, USA

... putative cis-acting elements using transcription factor databases (TFSEARCH, Kyoto University, version 1.3) and ConSite (nsiteM, Softberry, Inc., version 2.2004 ...


Plant Molecular Biology
Volume 58, Number 2 / May 2005 pp. 193-212

Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana

Rachel Clifton et al.,
Plant Molecular Biology Group, School of Biomedical and Chemical Sciences,, The University of Western Australia, 35 Stirling Highway, 6009 Crawley, Western Australia, Australia

... jsp). Pre- viously described motifs were identified using Softberry nsiteM (Shahmuradov et al., 2003), PlantCARE (Lescot et al., 2002), PLACE (Higo et al., 1999 ...


PATTERN

PloS one
2014, 9(1), e84692. DOI: 10.1371/journal.pone.0084692

Isolation and Characterization of Three Cassava Elongation Factor 1 Alpha (MeEF1A) Promoters

Suhandono, S., Apriyanto, A., Ihsani, N.
School of Life Sciences and Technology, Institut Teknologi Bandung, Bandung, Jawa Barat, Indonesia

... www.cbs.dtu.dk/services/NetGene2/) [51]. Conserved cis-acting regulatory was carried out using the PATTERN search from Softberry website (http://www.softberry. com/berry.phtml). PLACE [52] and PlantCARE [53] software ...


Nature and Science,
4(3), 2006

An In Silico Investigation into the Discovery of Novel Cis-acting Elements within the Intronic Regions of Human PAX7

Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center), New York City, New York 10021, USA

The names and functions of the programs used are: ...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) - This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) - TSSG is the most accurate mammalian cis element prediction program.


POLYAH

JAPS, Journal of Animal and Plant Sciences
2015, 25(1), 254-260.

Codon optimization of Serratia marcescens chiA and its expression in tobacco.

Pasha, M. A., Belgaumwala, A., Kumar, R., Krishnaraj, P. U., Kuruvinashetti, M. S.
Department of Biotechnology, University of Agricultural Sciences, Dharwad-580005, Karnataka, India

... degenerate codons manually. PolyAH and splice sites were predicted with the help of online tool Softberry (www.softberry.com), which predicts the potential splice sites present in the genomic DNA. The designed sequence ...


Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6

DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic

Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland 2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA

... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry), 3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...


Gene
Volume 529, Issue 2, 25 October 2013, Pages 228–237 DOI:10.1016/j.gene.2013.07.103

Splicing variants of the porcine betaine–homocysteine S-methyltransferase gene: Implications for mammalian metabolism

Radhika Ganu a, Timothy Garrow b, Markos Koutmos c, Laurie Rund d, Lawrence B. Schook a, d,
a Division of Nutritional Sciences, University of Illinois, Urbana, IL 61801, USA b Department of Food Science and Human Nutrition, University of Illinois, Urbana, IL 61801, USA

... The mRNA secondary structures and free energy values were predicted using the MFOLD software program (version 3.2; http://www.bioinfo.rpi.edu/applications/mfold)(Zuker, 2003). PolyAH software (http://www.softberry.ru/berry.phtml) was used to detect poly A signal sites. ...


Journal of Investigative Dermatology
(6 December 2012) | doi:10.1038/jid.2012.458

A Genome-Wide Association Study in Caucasian Women Points Out a Putative Role of the STXBP5L Gene in Facial Photoaging

Clerc et al.,

... exploration we tried to look for modifications in mRNA expression levels (Yang et al., 2010; Nica et al., 2011; Dixon et al., 2007; Zeller et al., 2010), splicing (NetGene2, http://www.cbs.dtu.dk/ services/NetGene2/), polyadenylation regions (polyAH, http://linux1.softberry.com/berry ...


PLoS ONE
7(5): e36151. doi:10.1371/journal.pone.0036151

3D Profile-Based Approach to Proteome-Wide Discovery of Novel Human Chemokines

Tomczak et al.,
Structural Bioinformatics, BIOTEC TU Dresden, Germany Max Planck Institute of Molecular Cell Biology and Genetics, Dresden, Germany

... Exon organization, chromosomal location and proximity to known chemokine genes, presence of a PolyA site (using Ensembl, Polyah.pl (softberry) and Polyadq ...


Biologia Plantarum
December 2012, Volume 56, Issue 4, pp 641-647 DOI 10.1007/s10535-012-0255-3

Identification and characterization of a novel gene encoding myb-box binding zinc finger protein in Gossypium arboreum

M. Zahur et al.,
1. Department of Biochemistry and Molecular Biology, University of Gujrat, Gujrat, 50700, Pakistan

... 1990). To find out the untranslated regions (UTRs), and Poly-A tail softberry server was used (http://www.softberry.com/berry.phtml). The conceptual translation of nucleotide sequence was made using the open reading frame finder program (ORF; ...


Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015

Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes

Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA

... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/ proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software (http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...


Gene
Volume 483, Issues 1–2, 1 September 2011, Pages 49–53 DOI: 10.1016/j.gene.2011.05.014

Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid

Pardeep Kumar Bhardwaj a, b, 1, Jagdeep Kaur b, Ranbir Chander Sobti b, Paramvir Singh Ahuja a, Sanjay Kumar a
a Biotechnology Division, Institute of Himalayan Bioresource Technology, Council of Scientific and Industrial Research, P.O. Box 6, Palampur-176061, Himachal Pradesh, India b Department of Biotechnology, Panjab University, Chandigarh-160014, India

... Secondary structure of deduced amino acids sequences was predicted by SOPMA (Self Optimized Prediction Method with Alignment; http://npsa-pbil.ibcp.fr/). The polyadenylation signal was identified using POLYAH server (http://linux1.softberry.com/berry.phtml). ...


J Acquir Immune Defic Syndr.
2011 March; 56(3): 279–284. DOI: 10.1097/QAI.0b013e318204982b

SCREENING LOW FREQUENCY SNPS FROM GENOME WIDE ASSOCIATION STUDY REVEALS A NEW RISK ALLELE FOR PROGRESSION TO AIDS

Le Clerc et al.,
1 Chaire de Bioinformatique, Conservatoire National des Arts et Metiers, Paris, France 2 Universite Paris 12, INSERM U955, Creteil, France

... we tried to identify putative modifications in mRNA expression as shown in Genevar 26 and Dixon 27 databases, in splicing (FastSNP 28 , http://fastsnp.ibms.sinica.edu.tw/pages/ input_CandidateGeneSearch.jsp/), in polyadenylation (polyAH, http://linux1.softberry.com/berry ...


African Journal of Biotechnology
Vol. 8 (24), pp. 7116-7124, 15 December, 2009

Cloning and characterization of peptidylprolyl isomerase B in the silkworm, Bombyx mori

Hengchuan Xia et al.,
1Institute of Life Sciences, Jiangsu University, 301 Xuefu Road, Zhenjiang 212013, P. R. China

... Corporation. Bioinformatic analysis The DNAstar software was used to locate the open reading frame (ORF) for B. mori PPIB. Poly-A signal was predicted by POLYAH (http://www.softberry.com/cgi-bin/programs/promoter/polyah.pl). In ...


Genetics
Vol. 176, 2541-2549, August 2007

The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus

Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China and Key Biotechnology Laboratory of State Ethnic Affairs Commission, College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China

... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH, respectively (http://www.softberry.com/berry.html). ...


PROMH

PLoS ONE
5(9): e12599. doi:10.1371/journal.pone.0012599

The CC-NB-LRR-Type Rdg2a Resistance Gene Confers Immunity to the Seed-Borne Barley Leaf Stripe Pathogen in the Absence of Hypersensitive Cell Death

Bulgarelli et al.,
1 Genomic Research Center, CRA-GPG, Fiorenzuola d'Arda, Italy, 2 Department of Plant Microbe Interactions, Max Planck Institute fur Zuchtungsforschung, Koln, Germany

... The PromH program for the prediction of plant promoters (http://www.softberry.ru/berry.phtml? group=programs&subgroup=promoter&topic=tssp , [47]) identified potential transcription factor binding sites, a TATA box, and a likely promoter within the MITE sequence (data not ...


Nucleic Acids Research,
2003, Vol. 31, No. 13 3540-3545

PromH: promoters identification using orthologous genomic sequences

V. V. Solovyev* and I. A. Shahmuradov1
Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA 1 Institute of Botany, Azerbaijan National Academy of Sciences, 370073 Baku, Azerbaijan
*To whom correspondence should be addressed. Tel: +1 914 242 3592; Fax: +1 914 242 3593; Email: victor@softberry.com
Present address: I. A. Shahmuradov, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK
Received February 15, 2003; Revised and Accepted March 21, 2003


PlantProm

Plant Biotechnology Reports
2016, 10(4), 241-255. doi:10.1007/s11816-016-0400-0

Functional analysis of a cryptic promoter from Arabidopsis thaliana reveals bidirectionality

Parvathy, S. T., Srinivasan, R.
ICAR-National Research Centre on Plant BiotechnologyIndian Agricultural Research Institute ICAR-Indian Institute of Oilseeds Research

... 2000; http://www.genomatix.de/), Gene2 Promoter (http://www.genomatix.de/), McPromoter (Ohler et al. 2001; http://tools.genome.duke.edu/generegulation/McPromoter/) and PlantProm DB of SoftBerry Inc. (Shahmuradov et al. 2002; http://www.softberry.com/). ...


Journal of Biotechnology
174 (2014) 49–56 DOI: 10.1016/j.jbiotec.2014.01.027

Strong seed-specific protein expression from the Vigna radiata storage protein 8SG promoter in transgenic Arabidopsis seeds

Chen M. X. et al.,
aCollege of Life Science and Technology, Jinan University, Guangzhou 510632, ChinabSchool of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, Chinaa

... HQ214071, Chen et al., 2013) and the 661-bp 5 -flanking sequence of 8SG? (GenBank accession No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry.com) was uti- lized to predict the transcription start site (TSS) and the TATA box. ...


Journal of biotechnology
2014, 174, 49-56. DOI: 10.1016/j.jbiotec.2014.01.027

Strong seed-specific protein expression from the Vigna radiata storage protein 8SG? promoter in transgenic Arabidopsis seeds.

Chen M. X. et al.,
a College of Life Science and Technology, Jinan University, Guangzhou 510632, China b School of Biological Sciences, The University of Hong Kong, Pokfulam, Hong Kong, China

... HQ214071, Chen et al., 2013) and the 661-bp 5?-flanking sequence of 8SG? (GenBank accession No. GU176353, Yang et al., 2011). Software PlantProm of Softberry (http://www.softberry. com) was utilized to predict the transcription start site (TSS) and the TATA box. ...


Functional & integrative genomics
2014, 14(1), 111-125. DOI: 10.1007/s10142-013-0354-z

The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance

Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China 2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China

... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1. softberry.com/berry.phtml). Promoter motifs were analyzed ...


Plant Molecular Biology Reporter
2014, 32(3), 664-678. DOI: 10.1007/s11105-013-0681-1

Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses

Zhu W. et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China 2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China

... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD) (http://linux1.softberry.com/ berry.phtml). The promoter ...


Plant Molecular Biology Reporter
2014, 32(1), 198-208. DOI: 10.1007/s11105-013-0641-9

Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa

Rodriguez-Valentin R. et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico 2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico

... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/ berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...


Journal of Molecular Biology Research
Vol 3, No 1 (2013) DOI:10.5539/jmbr.v3n1p23

Characterization of Structure, Divergence and Regulation Patterns of Plant Promoters

Liu et al.,

... less often than transcribed gene sequences. A total of 3922 plant promoters in the Plant Promoter Database (PlantProm DB; http://linux1.softberry.com/berry.phtml) have been collected to date. Knowledge of the basic structural ...


Functional & Integrative Genomics
December 2013 DOI:10.1007/s10142-013-0354-z

The dehydrin wzy2 promoter from wheat defines its contribution to stress tolerance

Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, China 2. College of Food & Bioengineering, Henan University of Science and Technology, Luoyang, 471003, China

... www.ncbi.nlm.nih.gov). The transcription start site of the 5? upstream DNA region of wzy2 was analyzed using the SoftBerry Plant Promoter database (http://linux1. softberry.com/berry.phtml). Promoter motifs were analyzed ...


Plant Molecular Biology Reporter
November 2013 DOI:10.1007/s11105-013-0681-1

Characterisation of an SKn-type Dehydrin Promoter from Wheat and Its Responsiveness to Various Abiotic and Biotic Stresses

Zhu et al.,
1. State Key Laboratory of Crop Stress Biology for Arid Areas/College of Life Science, Northwest A&F University, Yangling, Shaanxi, 712100, People’s Republic of China 2. College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, 471003, People’s Republic of China

... http://genscanw. biosino.org/). The transcription start site (TSS) of the 5? up- stream region of wzy1-2 was analysed using the SoftBerry Plant Promoter Database (PPD) (http://linux1.softberry.com/ berry.phtml). The promoter ...


Plant Molecular Biology Reporter
Volume 32, Issue 1 , pp 198-208 DOI:10.1007/s11105-013-0641-9

Group 6 Late Embryogenesis Abundant (LEA) Proteins in Monocotyledonous Plants: Genomic Organization and Transcript Accumulation Patterns in Response to Stress in Oryza sativa

Rodriguez-Valentin, et al.,
1. Departamento de Biologia Molecular de Plantas, Instituto de Biotecnologia, Universidad Nacional Autonoma de Mexico, Apdo. Postal 510-3, 62250, Cuernavaca, Mor., Mexico 2. Instituto Nacional de Salud Publica (INSP), Av. Universidad 655, 62100, Cuernavaca, Mor., Mexico

... cgi), and Plant Promoter Database (PlantPromDB-Softberry, Fig. ... Statistical analysis was carried by ANOVA and Tukey's post hoc test Plant Mol Biol Rep Page 7. http://linux1.softberry.com/ berry.phtml?topic=plantprom& group=data&subgroup=plantprom). ...


Australian Journal of Grape and Wine Research
19: 238–248. doi: 10.1111/ajgw.12023

Anthocyanin profile and gene expression in berry skin of two red Vitis vinifera grape cultivars that are sunlight dependent versus sunlight independent.

Zheng et al.,
1Beijing Key Laboratory of Grape Sciences and Enology, CAS Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing, China 2University of Chinese Academy of Sciences, Beijing, China 3Key Laboratory of Plant Germplasm Enhancement and Speciality Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China

... figure. There was no difference in the isolated promoter regions of VvMYBAb1 between Jingxiu and Jingyan (Figure 5). Via a homology search of the isolated promoter regions using the PlantProm (Plant Promoters database http://linux1.softberry.com/berry.phtml) and PlantDB ...


J. Exp. Bot.
(2012) 63 (8): 2985-3000. doi: 10.1093/jxb/ers009

The gene encoding Arabidopsis acyl-CoA-binding protein 3 is pathogen inducible and subject to circadian regulation

Shu-Xiao Zheng, Shi Xiao* and Mee-Len Chye†
School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China

... Results using SoftBerry PlantProm DB (http://www.softberry.com) (Shahmuradov et al., 2003) and PlantCare (http://sphinx.rug.ac.be:8080/PlantCARE/) (Rombauts et al., 1999) revealed that the putative transcription start site of ACBP3 maps 93 bp 5? to the translation initiation ...


Algorithms for Molecular Biology
2011, 6:19 http://www.almob.org/content/6/1/19

Prediction of plant promoters based on hexamers and random triplet pair analysis

A K M Azad1 , Saima Shahid2 , Nasimul Noman 3* and Hyunju Lee 1
1 Department of Information and Communications, Gwangju Institute of Science and Technology, South Korea 3 Department of Electrical Engineering & Info Systems, Graduate School of Engineering, University of Tokyo, Japan

... validated TSSs. This dataset was downloaded from the recent release (2009.02) of PlantProm database http://linux1.softberry.com/berry. phtml?topic=plantprom&group= data&subgroup=plant- prom on January 2nd, 2011. Additional ...


Genetics and Molecular Research
9 (4): 2349-2356 (2010)

Molecular and functional analysis of the poly-b- hydroxybutyrate biosynthesis operon of Pseudomonas sp BJ-1

S.W. Zhu, Z.Y. Fang, H.Y. Jiang and B.J. Cheng
School of Life Science, Anhui Agricultural University, Hefei, China

... Predicted operons, promoters, and terminators were identified with the tools at Softberry (http://www.softberry. com/berry.phtml). ... SW Zhu et al. Promoter analysis The promoter prediction used the promoter database and the Softberry Plant Regula- tory motifs database. ...


Plant Physiology and Biochemistry
Volume 48, Issue 12, December 2010, Pages 945-951, doi:10.1016/j.plaphy.2010.09.005

Characterization and expression of the maize b-carbonic anhydrase gene repeat regions

Ursula Tems, James N. Burnell
Department of Biochemistry and Molecular Biology, James Cook University, Townsville, Queensland 4811, Australia

... gov). Nucleotide sequence up to 1,500 bp in the 5 flanking sequence of the CA2 gene was analyzed using a transcription factor database (PlantProm DB at www.softberry.com) in conjunction with MacVectorTM software. 4.3. ...


BMC Plant Biol.
2009 Jul 17;9:93.

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.

Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.

... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih. gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...


Journal of Cereal Science
Volume 50, Issue 3, November 2009, Pages 324-331

Isolation and characterisation of a xylanase inhibitor Xip-II gene from durum wheat

Elliott et al.,
aInstitute of Food Research (IFR), Norwich Research Park, Colney, Norwich NR4 7UA, UK bUniversita degli Studi della Tuscia, Dipartimento di Agrobiologia e Agrochimica, via San Camillo de Lallis, 01100 Viterbo, Italy

... Analysis of the 3'UTR by PlantProm DB (Shahmuradov et al., 2003) (http://www.softberry. com) revealed the presence of a single putative polyadenylation sequence (AATAAAA), starting 55 bp downstream of the TGA termination codon (Fig. S1). ...


Nucleic Acids Research
2006 34(19):e126; doi:10.1093/nar/gkl522

Robust analysis of 5'-transcript ends (5'-RATE): a novel technique for transcriptome analysis and genome annotation

Malali Gowda, Haumeng Li, Joe Alessi1, Feng Chen1, Richard Pratt2 and Guo-Liang Wang*
Department of Plant Pathology, The Ohio State University Columbus, OH 43210, USA 1 US DOE Joint Genome Institute, Walnut Creek CA 94598, USA 2 Department of Horticulture and Crop Science, Ohio Agricultural Research and Development Center, The Ohio State University Wooster, OH 44691, USA

... such as the TATA box and other cis-acting elements were predicted using a PlantProm DB program (http://mendel.cs.rhul.ac.uk and http://www.softberry.com) (20). ...


Genetics:
Published Articles Ahead of Print, published on September 19, 2005 as 10.1534/genetics.105.044727

Molecular characterization of the major wheat domestication gene Q

Kristin J. Simons*, John P. Fellers‡, Harold N. Trick*, Zengcui Zhang§, Yin-Shan Tai, Bikram S. Gill*, and Justin D. Faris
*Department of Plant Pathology, Throckmorton Plant Sciences Center, Kansas State University, Manhattan, KS 66506

... searches of plant promoter databases PlantCARE (http://intra.psb.ugent.be:8080/ PlantCARE/index.html), PlantProm (http://www.softberry.com), ...


Annals of Botany
2005 96(4):669-681; doi:10.1093/aob/mci219

Detection and Preliminary Analysis of Motifs in Promoters of Anaerobically Induced Genes of Different Plant Species

BIJAYALAXMI MOHANTY1,*, S. P. T. KRISHNAN1, SANJAY SWARUP2 and VLADIMIR B. BAJIC1
1 Knowledge Extraction Laboratory, Institute for Infocomm Research, 21 Heng Mui Keng Terrace, Singapore 119613 and 2 Department of Biological Sciences, National University of Singapore, Singapore

... Promoter sequences Plant promoter sequences were extracted from SoftBerry's Plant Promoter Database (PPD) (Shahmuradov et al., 2003 Go ), the Eukaryotic ...


Surgery Today
Volume 34, Number 12 / December, 2004 pp. 981-986

Role of Hypermethylation on Carcinogenesis in the Pancreas

Tamotsu Kuroki 1 Yoshitsugu Tajima 1 and Takashi Kanematsu 1
(1) Department of Surgery, Nagasaki University, Graduate School of Biomedical Sciences, 1-7-1 Sakamoto, Nagasaki 852-8501, Japan

... of Bioinformatics and http://www.isrec.isb-sib.ch/ssa Swiss Institute for Experimental Cancer Research, Eukaryotic Promoter Database Softberry, Promoter and ...


Nucleic Acids Research
2003, Vol. 31, No. 1 114-117

PlantProm: a database of plant promoter sequences

Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA

... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based on discriminant analysis has been created by Softberry Inc. ...


RegSite

Plant Molecular Biology Reporter
2014, 32(2), 372-381. DOI: 10.1007/s11105-013-0657-1

Initiation of Flowering in Protea compacta x Protea neriifolia Hybrid ‘Carnival’Coincides with Expression of the FLOWERING LOCUS THomologue

Smart M., Roden L. C.
1. Department of Molecular and Cell Biology, University of Cape Town, Private Bag, Rondebosch, 7701, Cape Town, South Africa 2. Institute for Microbial Biotechnology and Metagenomics, Department of Biotechnology, University of the Western Cape, Bellville, 7535, Cape Town, South Africa

... In silico analyses of the 5? upstream region of ProFT were performed using the RegSite Plant database (SoftBerry, Inc., NY, USA), to predict the transcrip- tion start site (TSS) and promoter position, and the PlantCARE database (Lescot et al. 2002) and PLACEDB (Higo et al. ...


Plant Molecular Biology Reporter
Volume 30, Issue 1 , pp 131-138 DOI 10.1007/s11105-011-0319-0

Isolation and Partial Characterization of an R2R3MYB Transcription Factor from the Bamboo Species Fargesia fungosa

Juan Wang (1) Jing Wang (1) Huaibi Zhang (2) Yuming Yang (1) Kevin M. Davies (2)
1. Southwest Forestry University, Bailongsi 300, Kunming, Yunnan, China 2. New Zealand Institute for Plant & Food Research Limited, Private Bag, 11600, Palmerston North, New Zealand

... PLANTCARE (Lescot et al. 2002, with additional data from El-Shehawi et al. 2011) and RegSite Plant DB (www. softberry.com) databases. The proximal 1 kb region contained several notable sequence motifs (Fig. 2 and Table 1 ...


Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x

Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)

Xia YANG 1, Hong CUI 2, Zu-Li YUAN 2, Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China 2 Henan Agricultural University, Zhengzhou 450002, China

... To predict the promoter regions and the transcription start sites, genomic regions upstream of the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ... 


SCIENCE CHINA Life Sciences
Volume 53, Number 11, 1315-1321, DOI: 10.1007/s11427-010-4079-0

Expression pattern and core region analysis of AtMPK3 promoter in response to environmental stresses

Fei Gao, Qi Su, YunLiu Fan and Lei Wang

... There are several plant-specific promoter databases with information on cis-acting elements, which control the initia- tion of transcription by binding corresponding nuclear fac- tors. These databases include PlantCARE [23], RegSite (http://softberry. ...


Methods Mol Biol.
2010;674:57-83

Identification of promoter regions and regulatory sites

Solovyev VV, Shahmuradov IA, Salamov AA.
Department of Computer Science, Royal Holloway, London, UK.

... Over 7,900 sequences of transcrip- tional elements have been described in TRANSFAC database (21, 22). The other collections of functional motifs are TRRD (23), PlantCARE (24), PLACE (25), RegSite (http://softberry. com ... 


Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821

Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines

Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China

... was based on program of ScanWM-PL and accession numbers of regula- tion factors were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...


Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072

The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants

S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia

... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ...


Molecular Plant Pathology
Volume 8 Issue 3 Page 307-319, May 2007

Molecular and cytological responses of Medicago truncatula to Erysiphe pisi

DAWN FOSTER-HARTNETT et al.,
Department of Plant Pathology, University of Minnesota, 495 Borlaug Hall, St Paul, MN 55108, USA

... groups of promoters using (1) > 20 published motifs associated with plant defence, (2) 803 regulatory motifs present in the Softberry RegSite PlantDB database ...


Cell Res.
2006 Aug;16(8):731-9.

Tissue differential expression of lycopene beta-cyclase gene in papaya.

Skelton RL, Yu Q, Srinivasan R, Manshardt R, Moore PH, Ming R.
1Hawaii Agriculture Research Center, Aiea, HI 96701, USA.

... upstream sequence. Two possible sites of the cpLCY-B promoter were predicted using RegSite Plant DB (www.softberry.com). The first ...


ScanWM-PL

PLOS ONE
July 30, 2013DOI: 10.1371/journal.pone.0069124

The LuWD40-1 Gene Encoding WD Repeat Protein Regulates Growth and Pollen Viability in Flax (Linum Usitatissimum L.)

Santosh Kumar, Mark C. Jordan, Raju Datla, Sylvie Cloutier
Department of Plant Science, University of Manitoba, Winnipeg, Manitoba, Canada, Cereal Research Centre, Agriculture and Agri-Food Canada, Winnipeg, Manitoba, Canada

... Promoter analysis was performed with PLAnt Cis-acting regulatory DNA Elements (PLACE) [42], PLANT Promoter Analysis Navigator (PlantPAN) and Weight Matrix patterns of PLant regulatory sequences (ScanWM-PL) available on the Softberry web portal (http://linux1.softberry ...


Journal of Integrative Plant Biology
Volume 54, Issue 1, pages 15–32, January 2012 DOI: 10.1111/j.1744-7909.2011.01084.x

Characterization of the Tomato Prosystemin Promoter: Organ-specific Expression, Hormone Specificity and Methyl Jasmonate Responsiveness by Deletion Analysis in Transgenic Tobacco Plants

Hamlet Aviles-Arnaut, John Paul Delano-Frier
Center of Research and Advanced Studies (Cinvestav) at Irapuato: Unit for Plant Biotechnology and Genetic Engineering, Irapuato, Gto., Mexico, PO Box 36821 Mexico

... (www.dna.affrc.go.jp/PLACE/), PlantCARE (http://bioinformatics.SlPSb.ugent.be/wetools/ plantcare/html/), the RegSite Plant Database (www.softberry.com) and the Genomatix ... compared against known cis-regulatory elements with the ScanWM-P software (www.softberry.com). ...


Plant Cell Rep.
2010 May;29(5):449-60. Epub 2010 Feb 24

Functional identification and regulation of the PtDrl02 gene promoter from triploid white poplar

Zheng et al.,
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, People's Republic of China.

... dna.affrc.go.jp/PLACE/signalscan.html) (Higo et al. 1999), PlantCARE (http://bioinformatics.psb. ugent.be/webtools/plantcare/html/) (Lescot et al. 2002), NSITE-PL and ScanWM-P (Softberry, http://linux1.softberry.com/berry.phtml), as described by Zheng et al. (2007) previously ... 


Molecular Genetics and Genomics
Volume 282, Number 4 / October, 2009 pp. 381-394

Functional analysis of 5' untranslated region of a TIR-NBS-encoding gene from triploid white poplar

Huiquan Zheng, Shanzhi Lin, Qian Zhang, Yang Lei and Zhiyi Zhang
National Engineering Laboratory for Tree Breeding, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, 100083 Beijing, People’s Republic of China

... 2002), NSITE-PL and ScanWM-P (Softberry, http:// linux1.softberry.com/berry.phtml) as well as UTRScan (http://www.ba.itb.cnr.it/BIG/UTRScan/) (Pesole and Liuni 1999), were employed to predict the cis-elements located in either the promoter region or 5 UTR of the gene. ...


Proteomics
2008 Volume 8 Issue 22, Pages 4808 - 4821

Proteomic profiling of rice embryos from a hybrid rice cultivar and its parental lines

Wang et al.,
CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, China

... was based on program of ScanWM-PL and accession numbers of regula- tion factors were from RegSite Database developed by Soft- berry (http://www.softberry.com). ...


ScanWM-P

Forestry Studies in China
June 20, 2007, pp. 95-106

Isolation and analysis of a TIR-specific promoter from poplar

Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China

... out with the BLAST search program in NCBI Transcriptional start site of the obtained DNA sequence, was predicted with the online program TSSP in Softberry. ... ... Cis-acting regulatory elements located at the promoter region were predicted by using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...


TSSP

Organ Cult
(2016) 126: 469. doi:10.1007/s11240-016-1015-4

Characterization of a trichome-specific promoter of the aldehyde dehydrogenase 1 (ALDH1) gene in Artemisia annua

Liu, M. et al.,
Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D CenterShanghai Jiao Tong University Department of Chemistry and Biomedical SciencesLinnaeus University

... The cis-acting elements and ATG start codon are in box. We used the TSSP software (http://?linux1.?softberry.?com/?berry.?phtml??topic=?tssp&?group=?programs&? subgroup=?promoter) to search more information about this promoter. ...


Biotechnology and Applied Biochemistry.
2016 DOI: 10.1002/bab.1520

Molecular cloning and characterization of the promoter of aldehyde dehydrogenase gene from Artemisia annua

Wang, H. et al.,
Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), SWU-TAAHC Medicinal Plant Joint R&D Centre, School of Life Sciences, Southwest University, Chongqing, China School of Chemistry and Chemical Engineering, Chongqing University of Science and Technology, Chongqing, China

... element of the ALDH1 promoter was analyzed by the TSSP software (http:// http://linux1.softberry. com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) [24], the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and the PLACE ...


Genes & Genomics
2016, 38(4), 377-387. DOI: 10.1007/s13258-015-0378-y

Genomic identification of microRNA promoters and their cis-acting elements in Populus

Chen, M., Wei, M., Dong, Z., Bao, H., Wang, Y.
1. National Engineering Laboratory for Tree Breeding, Beijing Forestry University, Beijing, 100083, People’s Republic of China 2. Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, People’s Republic of China

... Prediction and characterization of TSSs, TATA box- like sequences With the obtained sequences, TSSs and TATA box-like sequences were predicted using the plant promoter identifi- cation program, TSSP (http://linux1.softberry.com/berry. ...


Plant Physiology
2016 Vol. 162, No. 2 (June 2013), pp. 885-896 http://www.jstor.org/stable/41943270

The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear

Wang Z. et al.,

... name proPcMYBlO (JX403962). It contained a core promoter at position -60 bp and an enhancer promoter at position -675 bp (as analyzed by TSSP software on softberry; http:/ /linuxl. softberry.com/berry.phtml). Be- sides the ...


Molecular Genetics and Genomics
2016, Volume 291, Issue 2 , pp 935-941 DOI 10.1007/s00438-015-1159-7

Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch): insights from in silico analysis of nuclear and organellar genomes

Ranade, S. S., Garcia-Gil, M. R., Rossello, J. A.
1. Department of Forest Genetics and Plant Physiology, Umea Plant Science Centre, Swedish University of Agricultural Sciences, 901 83, Umea, Sweden 2. Jardi Botanic, Universidad de Valencia, c/Quart 80, 46008, Valencia, Spain

... Upstream regions were also screened for the pres- ence of promoters, TATA boxes and enhancers using the TSSP/Prediction of Plant Promoters (TSSP: Transcription Start Sites in Plants, SoftBerry: http://www.softberry.com, Shahmuradov et al. 2003) web interface. Results ...


Applied biochemistry and biotechnology
2015, Volume 176, Issue 3 , pp 835-849 DOI: 10.1007/s12010-015-1614-2

Identification and Characterization of High Temperature Stress Responsive Novel miRNAs in French Bean (Phaseolus vulgaris)

Jyothi, M. N., Rai, D. V.
1. Post Graduate Department of Biochemistry, Maharani’s Science College for Women, Palace Road, Bangalore, 560001, India 2. Centre for Bioinformatics, Faculty of Biological Engineering, Shobhit University, Meerut, India

... Upstream sequences of 1 kb were retrieved at the beginning of the pre-miRNA for the prediction of transcription start site (TSS) for all the types of miRNA (genic and intergenic). The TSS and TATA-box predictions were made using TSSP web tool (http://linux1.softberry.com) [29]. ...


Gene
Volume 574, Issue 2, 15 December 2015, Pages 210–216 doi:10.1016/j.gene.2015.08.007

Identification of microRNAs and their targets in Finger millet by high throughput sequencing

S. Usha et al.,
a Post Graduate Department of Biochemistry, Maharani's Science College for Women, Bangalore 560001, India b Department of Biochemistry, Indian Institute of Science, Bangalore 560012 India

... The miRNAs were assumed as independent transcription units to have uniformity. The TSS and TATA-box predictions were made using TSSP web tool (http://linux1.softberry. com/berry.phtml?topic=tssp&group=programs&subgroup=promoter). ...


Molecular Genetics and Genomics
2015, 290(5), 1819-1831 DOI: 10.1007/s00438-015-1043-5

Identification and characterization of paternal-preferentially expressed gene NF-YC8 in maize endosperm

Mei, X. et al.,
1. Maize Research Institute, Key Laboratory of Biotechnology and Crop Quality Improvement, Ministry of Agriculture, Southwest University, Chongqing, China

... The promoter region of NF-YC8 was predicted by softberry (http://?linux1.?softberry.?com/? berry.?phtml??topic=?tssp&?group=?programs&?subgroup=?promoter), and CpG islands were predicted by the EMBOSS Cpgplot program (http://?www.?ebi.?ac.?uk/?Tools ...


Journal of Zhejiang University SCIENCE B
2014, 15(2), 125-132. DOI:10.1631/jzus.B1300179

Analysis of promoters of microRNAs from a Glycine max degradome library

Han, Y. Q. et al.,
1. College of Life Science and Technology, Heilongjiang Bayi Agricultural University, Daqing, 163319, China 2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... Promoters were predicted by the plant promoter identification pro- gram TSSP (http://www.softberry.com), which is designed for predicting plant Pol II promoters (Shahmuradov et al., 2005). The predictions were obtained at the default TSSP settings. ...


Biochemical and biophysical research communications
2014, 444(4), 676-681. DOI: 10.1016/j.bbrc.2014.01.171

MicroRNA mediates DNA methylation of target genes

Hu, W., Wang, T., Xu, J., Li, H.
a College of Life Sciences, Zhejiang University, Hangzhou, Zhejiang 310058, China b Zhejiang-California International Nanosystems Institute, Zhejiang University, Hangzhou, Zhejiang 310058, China

... 0). 2.2. DNA methylation pattern of MIRs. 1 or 2 kb upstream and downstream sequences of pre-miRNA were retrieved from rice genome. Promoters of MIRs were predicted by TSSP (http://linux1.softberry.com/berry.phtml). Then ...


Euphytica
2014, 196(3), 365-374. DOI: 10.1007/s10681-013-1038-4

Variation in GmAOS1 promoter is associated with soybean defense against insect attack

Wang H. et al.,
1. Soybean Research Institute, Nanjing Agricultural University, National Center for Soybean Improvement, Ministry of Agriculture, National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing, 210095, Jiangsu, China

... 1997 ). SoftBerry-TSSP (http://?linux1.?softberry.?com/?berry.?phtml) was used to predict the position of promoter (Shahmuradov et al. 2003 ) and PlantCARE was used to predict the cis-regulating elements for GmAOS1 (Lescot et al. 2002 ). ...


Biologia Plantarum
2014, 58(2), 247-255. DOI: 10.1007/s10535-014-0393-x

Structural and expression analyses of three PmCBFs from Prunus mume

Guo C. et al.,
1. Key Laboratory of Horticultural Plant Biology, Ministry of Education, College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, 430070, P.R. China

... The promoter region of PmCBFb was identified by the prediction of plant promoters (TSSP) analysis in softberry database (http:// linux1.softberry. com/berry.phtml). The cis-element analysis was performed by signal scan searching in the PLACE ...


Plant Molecular Biology Reporter
2014, 32(1), 82-91. DOI: 10.1007/s11105-013-0603-2

Jiang, W., Lu, X., Qiu, B., Zhang, F., Shen, Q., Lv, Z., ... & Tang, K. (2014). Molecular cloning and characterization of a trichome-specific promoter of artemisinic aldehyde ?11 (13) reductase (DBR2) in Artemisia annua.

Jiang W. et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China 2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China

... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...


Open Journal of Genetics
Vol.4 No.3(2014), Article ID:47053,12 pages DOI:10.4236/ojgen.2014.43020

Microsatellites and the Polyploid Guarana Plant: Diversity under a Sea of Alleles

da Silva Angelo P. C. et al.,
1Embrapa Western Amazon, Manaus, Brazil 2CNPq Fellowship at Embrapa Western Amazon, Manaus, Brazil

...On the other hand, the same TA repeat block displays a predicted potential to function as a TATA box (Softberry-TSSP) and to promote the transcription of smRNAs located downstream. ... ...Finally, there is at least one predicted pre-miRNA (Softberry-findmirna) in the MFT 3’-UTR, which could generate 21 or 24 nucleotides long mature miRNAs with the sequence 5’-ugccaggcguaauauauauau(aua)-3’ (Figure 4(b)). ...


Gene
2014, 545(1), 45-55. Volume DOI: 10.1016/j.gene.2014.05.008

Characterization of the promoter and 5?-UTR intron of oleic acid desaturase (FAD2) gene in Brassica napus

Xiao G. et al.,
a Key Laboratory of Oil Crop Biology of Ministry of Agriculture, Oil Crops Research Institute, Chinese Academy of Agricultural Sciences, Wuhan, Hubei 430062, China b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, PR China

... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml) and Berkeley Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter. html) web servers; the known cis-acting elements were analyzed through a web ...


Scientia Horticulturae
2014, 175, 16-26. DOI: 10.1016/j.scienta.2014.05.032

Comparison of anthocyanin components, expression of anthocyanin biosynthetic structural genes, and TfF3? H1 sequences between Tulipa fosteriana‘Albert heijn’and its reddish sport

Yuan, Y., Ma, X., Tang, D., Shi, Y.
School of Agriculture & Biology, Shanghai Jiao Tong University, Shanghai 200240, China

... The putative transcriptional start site (TSS) and cis-elements in the 5?flanking region of TfF3?H1AH were predicted by the Softberry database (http://linux1.softberry.com/berry.phtml? topic=tsssp&group=programs&subgroup=promoter) and the PLACE database (http://www.dna ...


Planta
Volume 237, Issue 4 , pp 1149-1161 DOI:10.1007/s00425-012-1833-5

Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum)

Vitthal T. Barvkar et al.,
1. Biochemical Sciences Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Plant Biotechnology Institute, NRC, 110 Gymnasium Place, Saskatoon, SK, S7N 0W9, Canada

... This sequence was used for prediction of transcription start sites (TSS) using the TSSP (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) program from the softberry package (Solovyev and Salamov 1997 ). ...


Genetica
Volume 141, Issue 4-6 , pp 255-267 DOI: 10.1007/s10709-013-9725-6

DcSto: carrot Stowaway-like elements are abundant, diverse, and polymorphic

Alicja Macko-Podgorni, Anna Nowicka, Ewa Grzebelus, Philipp W. Simon, Dariusz Grzebelus
1. Department of Genetics, Plant Breeding and Seed Science, University of Agriculture in Krakow, Al. 29 Listopada 54, 31-425, Krakow, Poland 2. USDA-ARS Vegetable Crops Research Unit, Department of Horticulture, University of Wisconsin-Madison, 1575 Linden Drive, Madison, WI, 53706, USA

... 2011 ). Consensus sequences of DcSto1 to DcSto9 were used to predict secondary structures in RNAfold (Hofacker 2003 ), to search for putative promoter regions using TSSP (Softberry), 3?-end cleavage and polyadenylation sites using POLYAH (Softberry), regulatory DNA ...


Tree Genetics & Genomes
October 2013, Volume 9, Issue 5, pp 1369-1381 DOI:10.1007/s11295-013-0640-x

Nucleotide sequence analysis of two lignin genes in Acacia auriculiformis ? Acacia mangium hybrid for enhancement of wood pulp quality

A. Sukganah, C. Y. Choong, J. Russell, D. Neale, R. Wickneswari
1. School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor Darul Ehsan, Malaysia 2. The James Hutton Institute, Invergowrie, Dundee, DD2 5DA, Scotland, UK

... The promoter regions were analysed using Softberry-TSSP (http://linux1.softberry.com/ berry.phtml) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/ html) programmes to predict the core ele- ments in the promoters. ...


Plant Molecular Biology Reporter
May 2013 DOI: 10.1007/s11105-013-0603-2

Molecular Cloning and Characterization of a Trichome-Specific Promoter of Artemisinic Aldehyde ?11(13) Reductase (DBR2) in Artemisia annua

Jiang et al.,
1. Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China 2. Plant Biotechnology Research Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China

... 2012a). The transcription start site (TSS) and the elements of the cloned promoter were analyzed by the TSSP software (http:// linux1.softberry.com/berry.phtml), the PlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), ...


Protoplasma
Volume 250, Issue 2 , pp 565-576 DOI:10.1007/s00709-012-0442-2

Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum

Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Further the upstream flanking region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml? Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...


Protoplasma
Volume 250, Issue 1 , pp 333-345 DOI:10.1007/s00709-012-0417-3

Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera

Himanshu Tak, Minal Mhatre
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml? topic0tssp&group0 programs&subgroup0promoter) database. ...


Plant Cell, Tissue and Organ Culture (PCTOC)
Volume 114, Issue 3 , pp 373-383 DOI:10.1007/s11240-013-0332-0

Petal-specific activity of the promoter of an anthocyanidin synthase gene of tobacco (Nicotiana tabacum L.)

Lim et al.,
1. National Academy of Agricultural Science, Rural Development Administration, Suwon, 441-707, Republic of Korea 2. Department of Genetic Engineering and Graduate School of Biotechnology, Kyung Hee University, Yongin, 446-701, Republic of Korea

... The 5?-upstream region was analyzed using the PLACE (http://www.dna.affrc.go.jp/PLACE/ signalscan.html), PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/), and Softberry (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup ...


Functional & Integrative Genomics
Volume 13, Issue 2 , pp 167-177 DOI:10.1007/s10142-013-0310-y

A root-specific wall-associated kinase gene, HvWAK1, regulates root growth and is highly divergent in barley and other cereals

Ravneet Kaur, Kashmir Singh, Jaswinder Singh
1. Plant Science Department, McGill University, 21 111 Rue lakeshore, Ste Anne de Bellevue, QC, H9X 3V9, Canada

... 1999) and TSSP program (prediction of plant promoters, RegSite Plant DB, Softberry Inc.). ... 1). Various motifs and transcriptional factor binding sites were predicted using both the programs against the Softberry Regsite-Plant and PLACE databases. ...


Plant Physiology
June 2013 vol. 162 no. 2 885-896 DOI:10.?1104/?pp.?113.?214700

The Methylation of the PcMYB10 Promoter Is Associated with Green-Skinned Sport in Max Red Bartlett Pear

Wang et al.,
Laboratory of Fruit Cell and Molecular Breeding, College of Agronomy and Bio-tech, China Agricultural University, Beijing 100193, China (Z.W., D.M., TZ.L.) Research Institute of Pomology, Chinese Academy of Agricultural Sciences, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.) Shenyang Agricultural University, Shenyang 110866, China (A.W., TL.L.); and Key Laboratory of Biology and Genetic Improvement of Horticultural Crops (Germplasm Resources Utilization), Ministry of Agriculture, Xingcheng, Liaoning 125100, China (Z.W., S.J., P.C.)

... name proPcMYB10 (JX403962). It contained a core promoter at position ?60 bp and an enhancer promoter at position ?675 bp (as analyzed by TSSP software on softberry; http://linux1.softberry.com/berry.phtml). Besides the ...


Gene
Volume 531, Issue 1, 15 November 2013, Pages 15–22 DOI:10.1016/j.gene.2013.08.060

Identification of abiotic stress miRNA transcription factor binding motifs (TFBMs) in rice

Rama Devi et al.,
a Crop Improvement section, Directorate of Rice Research, Rajendranagar, Hyderabad 500030, India b Department of Statistics, Acharya N. G. Ranga Agricultural University, Rajendranagar, Hyderabad 500030, India

... org/gb2/gbrowse/maize_v2/). The TSS and TATA-box predictions were made using TSSP web tool (http://linux1.softberry.com/berry.phtml? topic = tssp& group = programs&subgroup = promoter). Putative promoter sequences ...


Journal of Integrative Agriculture
Volume 12, Issue 6, June 2013, Pages 962–970 DOI:10.1016/S2095-3119(13)60473-6

Molecular Cloning and Characterization of a Novel Gene Involved in Fatty Acid Synthesis in Brassica napus L

XIAO et al.,
a The Oil Crops Research Institute/National Oil Crops Improvement Center, Changsha 410128, P.R. China b Pre-State Key Laboratory for Germplasm Innovation and Resource Utilization of Crops, Changsha 410128, P.R. China

... pI and MW were predicted using the DNAMAN program. Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry. com/berry.phtml) and Berkeley Neural Network Promoter Prediction (http://www.fruitfly.org/seq_tools/promoter. ...


J. Agric. Food Chem.
2013, 61 (18), pp 4396–4405 DOI: 10.1021/jf400776m

Differential Expression of Genes Encoding Acid Invertases in Multiple Shoots of Bamboo in Response to Various Phytohormones and Environmental Factors

Shu-Chien Liao †, Choun-Sea Lin ‡, Ai-Yu Wang *†, and Hsien-Yi Sung *†
† Department of Biochemical Science and Technology, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei 106, Taiwan ‡ Agricultural Biotechnology Research Center, Academia Sinica, No. 128, Sec. 2, Academia Road, Nankang, Taipei 115, Taiwan

... Sequence Analysis The potential transcription initiation site and the putative regulatory cis-elements and conserved motifs were analyzed using the online TSSP program (http://linux1.softberry.com/berry.phtml?topic=tssp&group=programs&subgroup=promoter) and ...


PloS one
August 08, 2013DOI: 10.1371/journal.pone.0071435

Characterization and Evolution of Conserved MicroRNA through Duplication Events in Date Palm (Phoenix dactylifera)

Xiao et al.,
Hainan Key Laboratory of Tropical Oil Crops Biology/Coconuts Research Institute, Chinese Academy of Tropical Agricultural Sciences, Wenchang, Hainan, China School of Agriculture and Food Sciences and Centre for Integrative Legume Research, The University of Queensland, Brisbane, Australia

... Similarities between duplicated pre-miRNA sequences were analyzed by Blast2. Promoters (TATA box) and enhancers of miRNA genes were predicted from regions 1 kb upstream of pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...


J. Exp. Bot.
(2013) 64 (11): 3299-3312. doi: 10.1093/jxb/ert183

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

Wen et al.,
The Applied Plant Genomics Laboratory of Crop Genomics and Bioinformatics Center, and National Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095 Jiangsu, China

... Positive clones were sequenced at Takara Bio, Inc., Dalian, China. Basic sequence analysis was conducted with Macvector 10.0 (Accelrys, Oxford, USA). The transcription start site (TSS) was predicted with the plant promoter prediction program TSSP (http://www.softberry.com). ...


Plant Molecular Biology Reporter
Volume 31, Issue 5 , pp 1089-1099 DOI:10.1007/s11105-013-0578-z

LtuCAD1 Is a Cinnamyl Alcohol Dehydrogenase Ortholog Involved in Lignin Biosynthesis in Liriodendron tulipifera L., a Basal Angiosperm Timber Species

Xu et al.,
1. Department of Genetics and Biochemistry, Clemson University, 130 McGinty Court, Robert F. Poole Agricultural Center, Room 153, Clemson, SC, 29634, USA 2. Bioenergy Systems Research Institute, University of Georgia, Athens, GA, 30602, USA

... The TSSP/Prediction of Plant Promoters (Solovyev and Shahmuradov 2003) (http:// softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) was used to predict the potential Plant Mol Biol Rep Page 4. transcription start site. ...


Plant Molecular Biology Reporter
October 2013 DOI:10.1007/s11105-013-0656-2

Characterization of the Promoter of Artemisia annua Amorpha-4,11-diene Synthase (ADS) Gene Using Homologous and Heterologous Expression as well as Deletion Analysis

Zhu et al.,
1. Key Laboratory of Urban Agriculture (South), Ministry of Agriculture, Plant Biotechnology Research Center, School of Agriculture and Biology, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, Shanghai Jiao Tong University, Shanghai, 200240, People’s Republic of China 2. Laboratory of Plant Biotechnology, College of Life and Environment Sciences, Shanghai Normal University, Shanghai, 200234, People’s Republic of China

... As TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup= promoter) predicted, three promoter/enhancer(s) are located at 2868 LDF-, 1247 LDF-, and 774 LDF-, respectively; the 2868 LDF- site is then considered as the transcription start site (+1 ...


Plant Pathology
doi: 10.1111/ppa.12155

Construction of a cassava PR protein-interacting network during Xanthomonas axonopodis pv. manihotis infection.

Roman et al.,
Manihot-Biotec Group, Department of Biology, Universidad Nacional de Colombia, Bogota D.C, Colombia

... For analysis of the promoter regions, 2 kp of upstream sequence of the HEV, CHI, SiR genes, 18 HEV interactors, five CHI interactors and a SiR interactor, were used in the tssp program (http://linux1.softberry.com/berry.phtml). Results. ...


Planta
Volume 237, Issue 6 , pp 1495-1508 DOI:10.1007/s00425-013-1860-x

Polymorphism of TaSAP1-A1 and its association with agronomic traits in wheat

Chang et al.,
1. National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... A putative transcription start site (TSS) was identified at ?1,030 bp using the TSSP software available at site http://www.softberry.com (Fig. 1b). Fig. 1 a Isolation of the sequence surrounding TaSAP1 using primer pair Sap2F and Sap2R. ...


PloS one
November 22, 2013DOI: 10.1371/journal.pone.0080643

Studies on the Expression of Sesquiterpene Synthases Using Promoter-b-Glucuronidase Fusions in Transgenic Artemisia annua L

Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
Department of Chemistry and Biomedicine, Linnaeus University, Kalmar, Sweden

... The transcription start site (TSS) (labeled +1) of the cloned promoters was predicted using the TSSP software (http://linux1.soft-berry.com/berry.phtml) as summarized in Table 2. Using the PLACE (http://www.dna.affrc.go.jp/PLACE/) and PlantCARE (http://bioinformatics.psb.ugent ...


New Phytologist
198: 1191–1202. doi: 10.1111/nph.12207

AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea

Lu et al.,
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, China

... To examine the expression pattern of AaORA in detail, we cloned an 1193-bp promoter sequence (JQ797714) of AaORA by genomic walking. The transcription start site (TSS) of the cloned promoter was predicted using TSSP software (http://linux1.softberry.com/berry.phtml). ...


Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI:10.1007/s11033-012-2169-8

Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree

Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India

... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter) program pre- dicted promoter position has been numbered ?1 and the upstream sequences have been numbered from -1 whereas the downstream nucleotides have been ...


Journal of Genetics,
Vol. 91, No. 3, December 2012

Genomewide analysis of intronic microRNAs in rice and Arabidopsis

G. D. YANG, et al.,
State Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an, Shandong 271018, People’s Republic of China

... The upstream sequences were anal- ysed by two popular promoter prediction tools for plant genes: TSSP (http://linux1.softberry.com/) and Promoter Scan (http://www- bimas.cit.nih.gov/molbio/proscan/) with the default parameters. ...


J. Exp. Bot.
(2012) 63 (17): 6267-6281. doi: 10.1093/jxb/ers278

GbTCP, a cotton TCP transcription factor, confers fibre elongation and root hair development by a complex regulating system

Juan Hao et al.,
National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan, Hubei 430070, PR China

... Gene-specific primers were designed for genome walking (Supplementary Table S1), and promoter prediction software TSSP (http://linux1.softberry.com/berry.phtml?topic=tssp&group= programs&subgroup=promoter) was used to predict the GbTCP transcription initiation site. ...


Functional & Integrative Genomics
November 2012, Volume 12, Issue 4, pp 649-658 DOI: 10.1007/s10142-012-0282-3

Novel miRNAs in the control of arsenite levels in rice

Qingpo Liu
1. College of Agriculture and Food Science, Zhejiang A & F University, Lin’an, Hangzhou, 311300, People’s Republic of China

... al. (2007). If the pre-miRNAs were located in intronic or exonic regions, the upstream sequences of the host genes were adopted. The software TSSP (http://linux1.softberry. com/berry.phtml? topic0tssp&group0programs&subgroup0promoter ...


Molecular Biotechnology
10.1007/s12033-012-9583-y

Efficient Regeneration Potential is Closely Related to Auxin Exposure Time and Catalase Metabolism During the Somatic Embryogenesis of Immature Embryos in Triticum aestivum L

She et al.,
1. Key Laboratory of Crop Genetics and Breeding, Ministry of Agriculture, National Key Facility of Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China 2. National Key Facility of Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Zhong Guan Cun South St, Haidian District, Beijing, 100081, China

... ugent.be/webtools/plantcare/html/, Lescot et al. [36]). TSSP software was used to predict TATA-box and transcriptional start site (TSS) (http://linux1.softberry.com/berry.phtml? topic= tssp&group=programs&subgroup=promoter). Results ...


BMC Plant Biology
2012, 12:155 doi:10.1186/1471-2229-12-155

Intraspecific sequence comparisons reveal similar rates of non-collinear gene insertion in the B and D genomes of bread wheat

Bartos et al.,
1 Centre of the Region Hana for Biotechnological and Agricultural Research, Institute of Experimental Botany, Sokolovska 6, Olomouc, CZ-77200, Czech Republic 2 Institute of Molecular Genetics, Videnska 1083, Praha, CZ-14220, Czech Republic

... We extracted 1 kb sequence upstream to start codon for each coding sequence found at 3DS- and 3B-specific loci. We predicted polymerase II promoters, transcription start sites and TATA-box positions using TSSP [31] at http://linux1.softberry.com/berry.phtml webcite. ...


Plant Molecular Biology
Volume 81, Issue 1-2 , pp 119-138 DOI: 10.1007/s11103-012-9986-y

Trichome-specific expression of the amorpha-4,11-diene 12-hydroxylase (cyp71av1) gene, encoding a key enzyme of artemisinin biosynthesis in Artemisia annua, as reported by a promoter-GUS fusion

Hongzhen Wang, Junli Han, Selvaraju Kanagarajan, Anneli Lundgren, Peter E. Brodelius
1. School of Natural Sciences, Linnaeus University, 39182, Kalmar, Sweden

... At present, we cannot conclude if the four cyp71av1 genes encode proteins of different length. Attempts to predict the transcription start site (TSS) of the cyp71av1 promoters using the TSSP software (http://linux1.softberry.com/berry.phtml) failed. ...


Molecular Biology Reports
Volume 40, Issue 2 , pp 1265-1274 DOI: 10.1007/s11033-012-2169-8

Cinnamate 4-Hydroxylase (C4H) genes from Leucaena leucocephala: a pulp yielding leguminous tree

Santosh Kumar, Sumita Omer, Krunal Patel, Bashir M. Khan
1. Plant Tissue Culture Division, CSIR-National Chemical Laboratory, Pune, 411008, India 2. Division of Plant Biology, Centenary Campus, Bose Institute, Kolkata, 700054, India

... TSSP (http://linux1.softberry.com/berry.phtml?topic= tssp&group=programs&subgroup=promoter) program pre- dicted promoter position has been numbered ?1 and the upstream sequences have been numbered from -1 whereas the downstream nucleotides have been ...


PLoS ONE
7(9): e46021. doi:10.1371/journal.pone.0046021

A Candidate-Gene Association Study for Berry Colour and Anthocyanin Content in Vitis vinifera L.

Cardoso S, Lau W, Eiras Dias J, Fevereiro P, Maniatis N
1 Laboratory of Plant Cell Biotechnology, Instituto de Tecnologia Quimica e Biologica, Oeiras, Portugal, 2 Department of Genetics, Evolution and Environment, University College London, London, United Kingdom,

... promoter region. According to the TSSP promoter prediction program for plant genes available on SoftBerry network server (http://www.softberry.com), s90 is located only 4 bp upstream of the transcription start site (TSS). Two ...


Protoplasma
May 2012 DOI 10.1007/s00709-012-0417-3

Cloning and molecular characterization of a putative bZIP transcription factor VvbZIP23 from Vitis vinifera

Himanshu Tak hsjtak@barc.gov.in (1) Minal Mhatre minalmhatre@yahoo.com (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture & Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Furthermore, the upstream flank- ing region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http:// linux1.softberry.com/berry.phtml? topic0tssp&group0 programs&subgroup0promoter) database. ...


Biologia Plantarum
Volume 56, Issue 4 , pp 699-704 DOI 10.1007/s10535-012-0132-0

Salt- and osmotic stress-induced choline monooxygenase expression in Kochia scoparia is ABA-independent

E. B. Kalinina (1) B. K. Keith (1) A. J. Kern (2) W. E. Dyer (1)
1. Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman, MT, 59717, USA 2. Department of Biology, Northland College, Ashland, WI, 54806, USA

... was conducted by Geneway Company (Hayward, CA, USA) using lambda forward and reverse primers (Promega) and sequence-specific primers designed using Primer3 software (Table 1). Canonical promoter sequences were identified using the Softberry TSSP package ...


Protoplasma
August 2012 DOI 10.1007/s00709-012-0442-2

Molecular characterization of VvSDIR1 from Vitis vinifera and its functional analysis by heterologous expression in Nicotiana tabacum

Himanshu Tak (1) Minal Mhatre (1)
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Further the upstream flanking region was used for identification of RNA pol II binding site and transcription start site using Softberry TSSP (http://linux1.softberry.com/berry.phtml? Molecular characterization of VvSDIR1 from Vitis vinifera Page 4. ...


BMC Plant Biology
2012, 12:166 doi:10.1186/1471-2229-12-166

The study of two barley Type I-like MADS-box genes as potential targets of epigenetic regulation during seed development

Aliki Kapazoglou et al.,
1 Institute of Agrobiotechnology (INA), CERTH, Thermi-Thessaloniki GR- 57001, Greece 2 Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki GR-54124, Greece

... The prediction of the putative cis acting elements was accomplished using the TSSP /Prediction of PLANT Promoters algorithm (Using RegSite Plant DB, Softberry Inc.) in the SoftBerry database (http://linux1.softberry.com/cgi-bin/programs/promoter/tssp.pl) and PlantCARE ...


Plant Molecular Biology Reporter
June 2012, Volume 30, Issue 3, pp 556-565 DOI 10.1007/s11105-011-0364-8

The Role of a Gibberellin 20-Oxidase Gene in Fruit Development in Pepper (Capsicum annuum)

Aphrodite Tsaballa (1) Konstantinos Pasentsis (2) Athanasios S. Tsaftaris (1) (2)
1. Department of Genetics and Plant Breeding, School of Agriculture, Aristotle University of Thessaloniki, Thessaloniki, 541 24, Greece 2. Institute of Agrobiotechnology (INA), CERTH, 6th km Charilaou-Thermis Road, Thermi, 570 01, Greece

... quenced several times with diverse primer sets. The analysis of the 5? upstream sequences was done using the TSSP/ Prediction of PLANT Promoters application at Softberry (http://linux1.softberry.com/berry.phtml). Based ...


African Journal of Biotechnology
Vol.10 . (55), pp. 11477-11482, 21 September, 2011 DOI:

Characterization of upstream sequences from the 8S globulin gene of Vigna radiata

Yue-Ning Yang et al.,
Department of Biotechnology, Jinan University, Guangzhou 510632, China.

... PLACE (http://www.dna.affrc.go.jp/database/) was used for transcription elements prediction; while transcription start site and TATA box were predicted with software TSSP (prediction of start of transcription sequences) of Softberry (http://www.softberry.com). ...


PLoS ONE
(2011), 6(12): e28073. doi:10.1371/journal.pone.0028073

Evolution of MicroRNA Genes in Oryza sativa and Arabidopsis thaliana: An Update of the Inverted Duplication Model.

Zhang Y, Jiang W-k, Gao L-z
Plant Germplasm and Genomics Center, Kunming Institute of Botany, The Chinese Academy of Sciences, Kunming, China, Graduate School, Chinese Academy of Science, Beijing, China

... Promoters (TATA box) and enhancers of miRNA genes were identified from upstream 1 kb regions of pre-miRNAs by using the software TSSP (http://linux1.softberry.com/berry.phtml). ...


Plant Cell Rep.
2011 Apr;30(4):539-49. doi: 10.1007/s00299-010-0964-z.

Isolation and characterization of a rice glutathione S-transferase gene promoter regulated by herbicides and hormones

Hu et al.,
Key Laboratory of Biorheological Science and Technology, Ministry of Education, College of Bioengineering, Chongqing University, 400044 Chongqing, People's Republic of China

... Promoter prediction was performed on the SoftBerry TSSP (http://linux1.softberry.com/berry.phtml) and Berkeley Neural Network Promoter Prediction (http:// www.fruitfly.org/seq_tools/promoter. html) web servers. Construction of OsGSTL2 promoter::GUS fusions ...


Agricultural Sciences in China
Volume 10, Issue 9, September 2011, Pages 1336–1345

In silico Detection of Novel MicroRNAs Genes in Soybean Genome

Yong-xin LIU a, *, , , Wei CHANG a, *, Ying-peng HAN a, Quan ZOU b, Mao-zu GUO c, Wen-bin LI a
a Key Laboratory of Soybean Biology, Chinese Ministry of Education/Soybean Research Institute, Northeast Agricultural University, Harbin 150030, P.R.China b School of Information Science and Technology, Xiamen University, Xiamen 361005, P.R.China

. al. 2005). TSSP of Softberry was adopted for supplemental predictions (http://www. Softberry.com, Solovyev and Shahmuradov 2003). The distribution of novel miRNAs was analyzed by Mapchart 2.1 (Voorrips 2002). Furthermore ...


Theoretical and Applied Genetics
Volume 122, Issue 1 , pp 211-223 DOI: 10.1007/s00122-010-1437-z

Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.)

Zhenqi Su, Chenyang Hao, Lanfen Wang, Yuchen Dong, Xueyong Zhang
1. Key Laboratory of Crop Germplasm Resources and Utilization, Ministry of Agriculture, Chinese Academy of Agricultural Sciences, Beijing, 100081, China 2. The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing, 100081, China

... The promoter elements were identified using the TSSP program (http://www.softberry. com). ... The core elements of the promoter were predicted with the TSSP program (http:// www.softberry.com), and the TATA box was identified at ...


Plant Cell Reports
Volume 30, Issue 12 , pp 2187-2194 DOI: 10.1007/s00299-011-1124-9

Characterization of a chalcone synthase (CHS) flower-specific promoter from Lilium orential ‘Sorbonne’

Liu et al.,
1. College of Forestry, Northwest A&F University, Yangling, 712100, Shaanxi, People’s Republic of China 3. Key Laboratory of Horticulture Plant Germplasm Utilization in Northwest China of Ministry of Agriculture, Yangling, 712100, Shaanxi, People’s Republic of China

... DQ471951). The putative transcription start site (TSS), predicted by the Softberry database (http://linux1. softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter), is located at 46 bp upstream of the ATG translation start codon. ...


Journal of Integrative Plant Biology
53: 814–823. doi: 10.1111/j.1744-7909.2011.01070.x

Induced Pib Expression and Resistance to Magnaporthe grisea are Compromised by Cytosine Demethylation at Critical Promoter Regions in Rice.

Li et al.,
1 Key Laboratory of Molecular Epigenetics of MOE and The Institute of Genetics & Cytology, Northeast Normal University, Changchun 130024, China 2 Department of Agronomy, Jilin Agricultural University, Changchun 130118, China

... By a computational program Softberry-TSSP (http://www.softberry.com), two TATA boxes at positions 1 995 nt and 3 496 nt respectively, and two putative enhancers at positions 1 350 nt and 3 630 nt respectively, were identified (Figure 2, upper panel), further verifying its identity ...


The Plant Journal
66: 541–552. (2011) doi: 10.1111/j.1365-313X.2011.04511.x

A soybean b-expansin gene GmEXPB2 intrinsically involved in root system architecture responses to abiotic stresses.

Guo et al.,
Root Biology Centre, South China Agricultural University, Guangzhou 510642, China

... accession number FJ461673). In silico analysis of the promoter sequence was performed using the software programs tssp-tcm (Shahmuradov et al., 2005), nsite-pl (http://www.softberry.com) and place (Higo et al., 1999). The TATA ...


American Journal of Plant Sciences
Volume 2 Issue 4 Pages: 619-628 2011 DOI: 10.4236/ajps.2011.24073

Trichome-Specific Expression of Amorpha-4,11-Diene Synthase, a Key Enzyme of Artemisinin Biosynthesis in Artemisia annua L., as Reported by a Promoter-GUS Fusion

H Wang, L Olofsson, A Lundgren
Linnaeus University, Faculty of Science and Engineering, School of Natural Sciences

... The transcription start site (TSS) of the cloned promoter was predicted using the TSSP software (http://linux1. softberry.com/berry.phtml). A putative TSS of ADS (la- beled +1 in Figure 1) was predicted 51 bp upstream of the translation initiation ATG-codon. ...


Mol. Plant
(2011) 4 (2): 300-309. doi: 10.1093/mp/ssq076

Characterization of Xanthomonas oryzae-Responsive cis-Acting Element in the Promoter of Rice Race-Specific Susceptibility Gene Xa13

Ting Yuan, Xianghua Li, Jinghua Xiao and Shiping Wang 1
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... Promoter Sequence Analysis. The TATA boxes of promoters P Xa13 and P xa13 were predicted using the computer programs TSSP provided at the Softberry website (www.softberry.com) and PROSCAN (http://bimas.dcrt.nih.gov/molbio/proscan). Statistical Analysis. ...


Molecular Biology Reports
2011, Volume 38, Issue 6 , pp 4023-4035 DOI: 10.1007/s11033-010-0521-4

Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells

Upendra K. Singh Shekhawat, Thumballi R. Ganapathi, Lingam Srinivas
1. Plant Cell Culture Technology Section, Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Trombay, Mumbai, 400 085, India

... Also, a 76 nucleotide long 50 UTR has been pre- dicted based on the sequence of 50 end of the EST DN239172 and the analysis of 50 proximal sequence (obtained using TAIL-PCR) by TSSP program hosted at www.softberry.ru. ...


Journal of Plant Physiology
Volume 167, Issue 12, 15 August 2010, Pages 1003-1008 doi:10.1016/j.jplph.2010.01.021

Expression of the 26S proteasome subunit RPN10 is upregulated by salt stress in Dunaliella viridis

Xiaobin Sun a, 1, Xiangzong Meng b, 1, Zhengkai Xu a, b and Rentao Song a
a Shanghai Key Laboratory of Bio-energy Crops, School of Life Sciences, Shanghai University, 99 Shangda Road, Shanghai 200444, China b Institute of Plant Physiology & Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China

... gov/BLAST/). Gene prediction was carried out using SoftBerry TSSP (http://www. softberry.com/berry.phtml?topic=ann2) and GENSCAN (http://genes.mit.edu/ GENSCAN.html) (Burge and Karlin, 1997). Sequence alignments ... 


Journal of Systematics and Evolution
Volume 48, Issue 4, pages 249–256, July 2010 doi: 10.1111/j.1759-6831.2010.00086.x

Significance of consensus CYC-binding sites found in the promoters of both ChCYC and ChRAD genes in Chirita heterotricha (Gesneriaceae)

Xia YANG 1, Hong CUI 2, Zu-Li YUAN 2, Yin-Zheng WANG 1
1.State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China 2 Henan Agricultural University, Zhengzhou 450002, China

... To predict the promoter regions and the transcription start sites, genomic regions upstream of the ChCYC1 and ChRAD genes were submitted to an online TSSP (Plants Pol II promoter region and start of transcription) tool (using RegSite Plant DB (Softberry Inc.); http://linux1 ... 


Plant Physiology
153:1239-1249 (2010) First published online May 3, 2010; 10.1104/pp.110.157123

Identification and Application of a Rice Senescence-Associated Promoter

Liu et al.,
National Key Laboratory of Crop Genetic Improvement and National Centre of Plant Gene Research, Huazhong Agricultural University, Wuhan 430070, People's Republic of China (L.L., Y.Z., X.L., Y.L.); Department of Plant Sciences, University of California, Davis, California 95616 (L.L., M.W.S.)

... sativa sp. japonica). The promoter region of this gene was predicted using the software TSSP, provided at the Softberry Web site (http://linux1.softberry.com/berry.phtml?topic% 810%867=case_study_plants). The regulatory elements ... 


Gene
Volume 459, Issues 1-2, 1 July 2010, Pages 24-31 doi:10.1016/j.gene.2010.03.009

Molecular characterization and methylation study of matrix gla protein in articular cartilage from pig with osteochondrosis

Helga Sauerwein, Karl Schellander
a Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Germany b Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai, Thailand

... was performed by the CEQ8000 sequencer system (Beckman Coulter). A sequence of transcription start site (TSS) was predicted using TSSP (http://www.softberry.ru). The published sequences (NC_010447) of the 5?-flanking ... 


Genome
Volume 53, Number 7, 1 July 2010 , pp. 533-544(12)

Comparison of gene order of GIGANTEA loci in yellow-poplar, monocots, and eudicots

Liang Haiying; et al.,

... 2006). Exon–intron splice sites, start codons, and transcription start sites were predicted by NetPlantGene (Hebsgaard et al. 1996), NetStart 1.0 (Ped- ersen and Nielsen 1997), and the TSSP engine developed by SoftBerry (Solovyev and Shahmuradov 2003), respec- tively. ... 


Plant Science
Volume 179, Issue 4, October 2010, Pages 390-398 doi:10.1016/j.plantsci.2010.06.018

Comparison of gene order in the chromosome region containing a TERMINAL FLOWER 1 homolog in apricot and peach reveals microsynteny across angiosperms

Haiying Liang et al.,
a Department of Genetics and Biochemistry, Clemson University, Clemson, SC 29634, United States b Department of Horticulture, University of Georgia, Athens, GA 30602, United States

... Exon/intron splicing sites were determined by aligning with a full-length coding sequence obtained from the peach cultivar Springprince . Transcription start sites were predicted by TSSP engine developed by SoftBerry [39]. ... 


Planta
2010 Apr;231(5):1211-27. Epub 2010 Mar 6 DOI: 10.1007/s00425-010-1127-8

Identification and organization of chloroplastic and cytosolic L-myo-inositol 1-phosphate synthase coding gene(s) in Oryza sativa: comparison with the wild halophytic rice, Porteresia coarctata

Ray et al.,
Plant Molecular and Cellular Genetics, Bose Institute (Centenary Campus), Kolkata, India

... 1999) and PlantCARE (http://bioinformatics.psb.ugent.be/webt- ools/plantcare/html/). Predictions of eukaryotic promoter and transcription initiation sites were performed using the TSSP/Prediction of PLANT Promoters (Using RegSite Plant DB, Softberry Inc.). ... 


J. Exp. Bot.
2010 61 (11): 2991-3002. doi: 10.1093/jxb/erq124

Cold acclimation and low temperature resistance in cotton: Gossypium hirsutum phospholipase Da isoforms are differentially regulated by temperature and light

Kargiotidou A, Kappas I, Tsaftaris A, Galanopoulou D, Farmaki T.
1Institute of Agrobiotechnology, Centre for Research and Technology, 6th km Charilaou - Thermi Rd. 570 01, Thessaloniki, Greece 2Department of Genetics and Plant Breeding, Aristotle University of Thessaloniki, Thessaloniki 54006, Greece

... Promoter prediction of GrPLD and GaPLD The TSSP (promoter prediction program for plant genes), http://linux1.softberry.com/berry.phtml (Shahmuradov et al., 2005) was used. A promoter was predicted for GrPLD and GaPLD . ... 


Methods Mol Biol.
2010;592:149-61

MicroRNA promoter analysis

Megraw M, Hatzigeorgiou AG
Department of Genetics, Center for Bioinformatics, School of Medicine, University of Pennsylvania, Philadelphia, PA, USA

... events. 3. The first cited source provides a web-based interface that accepts regions of sequence for promoter prediction (http:// softberry.com/berry.phtml?topic = tssp&group = programs& subgroup = promoter). The second


The Plant Cell
22:349-363 (2010) 10.1105/tpc.108.064816

The Arabidopsis thaliana STYLISH1 Protein Acts as a Transcriptional Activator Regulating Auxin Biosynthesis

Eklund et al.,
a Department of Plant Biology and Forest Genetics, Uppsala BioCenter Swedish University of Agricultural Sciences, 750 07 Uppsala, Sweden b Research Institute of Genome-Based Biofactory, National Institute of Advanced Industrial Science and Technology, Tsukuba, Ibaraki 305-8562, Japan

... The yeast one-hybrid analysis showed the ability of STY1 to bind a 207-bp region directly upstream of a predicted TATA box (YUC4-1; TSSP at http://www.softberry.com/berry.phtml) but not to DNA from the more proximal promoter region or the presumptive 5' untranslated ...


Planta
Volume 230, Number 5 / October, 2009, pp. Volume 230, Number 5 / October, 2009

Genome-wide survey of rice microRNAs and microRNA–target pairs in the root of a novel auxin-resistant mutant

Meng et al.,
(1) State Key Laboratory of Plant Physiology and Biochemistry, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China (2) Department of Bioinformatics, College of Life Sciences, Zhejiang University, 310058 Hangzhou, People’s Republic of China

... Both the transcription start site (TSS) and the TATA-box in miRNA promoters were searched by using TSSP (http://www. softberry.com/berry.phtml?topic=tssp&group= programs& subgroup=promoter) (Shahmuradov et al. 2003). ...


Plant Production Science
Vol. 12 (2009) , No. 3 341-344

Genetic Transformation of a High Molecular Weight Glutenin (Glu-1Dx5) to Rice cv. Fatmawati

Yoshiharu Wada 2), Nono Carsono 1), Anas 1), Ly Tong 2) and Tomohiko Yoshida 2)
1) Faculty of Agriculture, Padjadjaran University 2) Faculty of Agriculture, Utsunomiya University

... To confirm the existence of the promoter in the full-length of 8.2 kb Glu- 1Dx5, we examined the DNA sequence with TSSP- Prediction of Plant Promoter Software (Softberry Inc.), and found at least 4 promoters or enhancers on the basis of TATA box prediction, suggesting that ...


BMC Plant Biol.
2009 Jul 17;9:93.

Identification of three wheat globulin genes by screening a Triticum aestivum BAC genomic library with cDNA from a diabetes-associated globulin.

Loit E, Melnyk CW, MacFarlane AJ, Scott FW, Altosaar I.
Department of Biochemistry, Microbiology and Immunology, Faculty of Medicine, University of Ottawa, Ottawa, Canada.

... sequence of Glo-3A were analyzed to identify a potential promoter using TSSP, a plant promoter recognition program (www.softberry.com) and PlantProm database [24]. A ... (http://www.ncbi.nih. gov/gorf/gorf.html) and FGENESH 3.0 alpha (www.softberry.com) ...


BMC Plant Biology
2009, 9:126 doi:10.1186/1471-2229-9-126

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Francois Fauteux, Martina V Stromvik
1 Department of Plant Science, McGill University, Ste-Anne-de-Bellevue, Canada 2 McGill Centre for Bioinformatics, McGill University, Montre'al, Canada

... literature [20, 35, 60-77]. The transcription start sites were predicted in 13 promoters for which transcriptional start data was unavailable in GenBank or literature, using the TSSP software from Softberry Inc. (http://www.softberry.ru). One representative ...


Plant Tissue Cult. & Biotech.
18(2): 123-130, 2008 (December)

Identification of Drosophila Promoter Using Positional Differential Matrix and Support Vector Machine from Sequence Data

Azizul Haque et al.,
Institute of Information Technology, University of Dhaka, Dhaka-1000, Bangladesh

... Program used (%) NNPP threshold (0.8) SoftBerry (TSSP) ProScan Vers. 1.7 Dragon Pro?moter Finder Vers. 1.4 Promoter 2.0 Pred. Server ... The proposed method exhibits better accuracy compared to other two methods NNPP (Reese et al. 1996) and SoftBerry(TSSP). ...


Plant Biotechnology
25, 000–000 (2008)

Genome-wide comparative analysis of Oryza sativa (japonica) and Arabidopsis thaliana 5 -UTR sequences for translational regulatory signals

M. Shashikanth, A. R. Krishna, G. Ramya, Geeta Devi, K. Ulaganathan
Center for Plant Molecular Biology, Osmania University, Hyderabad-500007, A. P., India

... 5 -UTR-genomic sequences longer than 150 base pairs were submitted to the promoter finding tool, TSSP (Softberry), available online at http://www.softberry.com ...


Journal of Experimental Botany
2008 59(8):2043-2056; doi:10.1093/jxb/ern065

Low temperature and light regulate delta 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton (Gossypium hirsutum)

Anastasia Kargiotidou, Dimitra Deli, Dia Galanopoulou, Athanasios Tsaftaris, and Theodora Farmaki
1Institute of Agrobiotechnology, Center for Research and Technology, 6th Km Charilaou, Thermi Road, 570 01 Thermi, Thessaloniki, Greece 2Department of Genetics and Plant Breeding, AUTH, Thessaloniki 54006, Greece

... elements was performed using the database available at: http://softberry.com. TSSs were determined using the TSSP program available at the site. NSITE-PL was ...


New Phytologist
2008 Volume 179 Issue 3, Pages 722 - 737

Comparative analysis of orthologous cellulose synthase promoters from Arabidopsis, Populus and Eucalyptus: evidence of conserved regulatory elements in angiosperms

Nicole Marie Creux, Martin Ranik, David Kenneth Berger and Alexander Andrew Myburg
1 Department of Genetics , 2 Department of Plant Science, Forestry and Agricultural Biotechnology Institute (FABI), University of Pretoria, Pretoria, 0002, South Africa

... The transcriptional start site (TSS) prediction program, TSSP (Shahmuradov et al., 2005, available at http://www.softberry.com), is trained on plant promoters ...


BMC Bioinformatics
2008, 9:414 doi:10.1186/1471-2105-9-414

Pol II promoter prediction using characteristic 4-mer motifs: a machine learning approach

Firoz Anwar et al.,
Department of Computer Science and Engineering, East West University, Bangladesh, 2Department of Genetic Engineering and Biotechnology, University of Dhaka, Bang

... Other prominent promoter prediction tools use either a statistical approach or Neural Network such as SoftBerry (TSSP). However, ...


Int. J Plant Sci.
169(6):701–707. 2008. DOI: 10.1086/588072

The Temporal and Spatial Expression of PR-5 Linusitin-Like Gene in Healthy and Ethylene-Treated Flax Plants

S Anzlovar et al.,
Department of Biology, Biotechnical Faculty, University of Ljubljana, Vec(na pot 111, SI-1000 Ljubljana, Slovenia; †Department of Biochemistry and Molecular Biology, Joz(ef Stefan Institute, SI-1000 Ljubljana, Slovenia; and ‡National Institute of Biology, SI-1000 Ljubljana, Slovenia

... The prediction of the promoter was performed using TSSP/Prediction of PLANT Promoters (using the RegSite plant database, Softberry, http://www.softberry.com). ...


Gene
Volume 409, Issues 1-2, 15 February 2008, Pages 1-10

Molecular evolution of the MLO gene family in Oryza sativa and their functional divergence

Qingpo Liua and Huiqin Zhu
School of Agriculture and Food Science, Zhejiang Forestry University, Hangzhou, Lin'an 311300, PR China bDepartment of Agronomy, Zhejiang University, Hangzhou 310029, PR China cDepartment of Agronomy, Qinghai University, Xining 810003, PR China

... Further, we have identified promoters for OsMLOs using the plant promoter prediction program TSSP that was developed by Softberry Inc. ...


TAG Theoretical and Applied Genetics
Volume 116, Number 2 / January, 2008 Pages 179-192

Does sequence polymorphism of FLC paralogues underlie flowering time QTL in Brassica oleracea?

H. Razi, E. C. Howell, H. J. Newbury and M. J. Kearsey
(1) School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK (2) Department of Crop Production and Plant Breeding, College of Agriculture, Shiraz University, Shiraz, 71441-65186, Iran

... Higo et al. 1999), the TSSP (Softberry, http://www.soft- berry.com) and the TSSP-TCM (Shahmuradov et al. 2005). Results The B. oleracea ...


Plant, Cell & Environment
Volume 31 Issue 1 Page 86-96, January 2008

Identification of novel pathogen-responsive cis-elements and their binding proteins in the promoter of OsWRKY13, a gene regulating rice disease resistance

MENG CAI et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... The promoter region of OsWRKY13 was predicted with the computer programs TSSP provided at the Softberry website (http://www.softberry.com), and PROSCAN (http ...


Genetics
Vol. 176, 2541-2549, August 2007

The in Silico Map-Based Cloning of Pi36, a Rice Coiled-Coil–Nucleotide-Binding Site–Leucine-Rich Repeat Gene That Confers Race-Specific Resistance to the Blast Fungus

Xinqiong Liu, Fei Lin, Ling Wang and Qinghua Pan
Laboratory of Plant Resistance and Genetics, College of Resources and Environmental Sciences, South China Agricultural University, Guangzhou, 510642, China and Key Biotechnology Laboratory of State Ethnic Affairs Commission, College of Life Science, South-Central University for Nationalities, Wuhan, 430074, China

... The promoter and polyadenylation regions were analyzed using TSSP and POLYAH, respectively (http://www.softberry.com/berry.html). ...


PLoS Comput Biol
2007, 3(3): e37 doi:10.1371/journal.pcbi.0030037

Characterization and Identification of MicroRNA Core Promoters in Four Model Species

Zhou X, Ruan J, Wang G, Zhang W
Department of Computer Science and Engineering, Washington University in Saint Louis, Saint Louis, Missouri, United States of America, Department of Genetics, Washington University in Saint Louis, Saint Louis, Missouri, United States of America

... In comparison, TSSP (SoftBerry, http: / /www.softberry.com), which is one of the best promoter prediction methods for plants, only identified 39 (60 ...


Plant Biotechnology Journal
5 (5), 664–674

A rice promoter containing both novel positive and negative cis-elements for regulation of green tissue-specific gene expression in transgenic plants

Meng Cai, Jun Wei, Xianghua Li, Caiguo Xu, Shiping Wang
National Key Laboratory of Crop Genetic Improvement, National Centre of Plant Gene Research (Wuhan), Huazhong Agricultural University, Wuhan 430070, China

... The promoter region of D54O was predicted using the computer programs TSSP, provided at the Softberry website (http://www.softberry.com), and PROSCAN (http ...


Forestry Studies in China
June 20, 2007, pp. 95-106

Isolation and analysis of a TIR-specific promoter from poplar

Zheng Hui-quan et al.,
Key Laboratory for Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, Beijing Forestry University, Beijing, 100083, P. R. China

... out with the BLAST search program in NCBI Transcriptional start site of the obtained DNA sequence, was predicted with the online program TSSP in Softberry. ... ... Cis-acting regulatory elements located at the promoter region were predicted by using the online program PLACE, PlantCARE, NSITE-PL and ScanWM-P (Softberry). ...


Journal of Zhejiang University - Science B
August 27, 2007 pp. 661-665

Cloning, sequencing and expression analysis of the NAR promoter activated during hyphal stage of Magnaporthe grisea

Lu Jian-ping Contact Information, Duan Zhi-bing , Liu Tong-bao and Lin Fu-cheng
Department of Biology, School of Life Sciences, Zhejiang University, Hangzhou, 310058, China
Biotechnology Institute, Zhejiang University, Hangzhou, 310029, China

... fruitfly.org/seq_tools/promoter.html, version 2.2), TSSP (http://www.softberry.com/ berry.phtml, pre- diction of plant promoters), and TFSCAN (http:// bioweb ...


Genome
Volume 49, Number 3, 1 March 2006, pp. 209-218(10)

Molecular structure and organization of the wheat genomic manganese superoxide dismutase gene

Baek, Kwang-Hyun; Skinner, Daniel Z.; Ling, Peng; Chen, Xianming

... 2002; Takai and Jones 2003) for CpG island prediction; TSSP (http://www. softberry.com/berry.phtml?topic=tssp&group=programs& subgroup=promoter) for plant ...


The Plant Cell
18:2929-2945 (2006)

The Balance between the MIR164A and CUC2 Genes Controls Leaf Margin Serration in Arabidopsis

Krisztina Nikovicsa et al.,
Laboratoire de Biologie Cellulaire, Institut Jean Pierre Bourgin, Institut National de la Recherche Agronomique, 78026 Versailles Cedex, France

...Analysis of the pri-miRNAs We performed 3' and 5' RACE for each gene with the GeneRacer cDNA amplification kit (Invitrogen). We used two or three rounds of nested PCR to amplify the 3' and 5' ends of the three pri-miR164s. The miR164A-15, miR164A-17, and miR164A-18 primers were used for the 3' end of pri-miR164A, and miR164A-16 and miR164A-7 were used for the 5' end. The miR164B-13, miR164B-15, and miR164B-16 primers were used for the 3' end of pri-miR164B, and miR164B-5 and miR164B-14 were used for the 5' end. We used miR164A-15 and miR164C-1 for the 3' end of pri-miR164A and miR164C-3 and miR164C-5 for the 5' end. Following gel electrophoresis, RACE reaction products were inserted into the pGEM-T Easy vector (Promega), and the two strands were sequenced. Two to four independent 5' clones and 5 to 10 independent 3' clones were analyzed for each gene. Promoter and transcription start sites were predicted by the TSSP program ( http://www.softberry.com/berry.phtml?topic=tsspandgroup=programsandsubgroup=promoter). The pri-miRNA secondary structure was determined with the Mfold program (Mathews et al., 1999; Zuker, 2003) ( http://www.bioinfo.rpi.edu/applications/mfold/old/rna/)....


Genetica
(2006), 128, 395-407

Isolation and characterization of a novel semi-lethal Arabidopsis thaliana mutant of gene for pentatricopeptide (PPR) repeat-containing protein

Tomas Kocabek, Jana Repkova, Marketa Dudova, Klara Hoyerova and Lukas Vrba
Institute of Plant Molecular Biology, Biological Centre of the Academy of Sciences of the Czech Republic, Branisovska 31, CZ-370 05 Ceske Budejovice, Czech Republic

Applied TSSP software... TSSP-TCM software suitable for plant pro-. moters searching (Shahmuradov et al. ...


Plant Science
Volume 168, Issue 6, June 2005, Pages 1571-1579

Functional analysis of GUS expression patterns and T-DNA integration characteristics in rice enhancer trap lines

Peng et al.,
Biotechnology Research Institute, The Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

... promoter systems, rice genomic sequences located upstream the GAL4/VP16-UAS apparatus were used for promoter prediction analysis (TSSP, http://www.softberry.com


Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Volume 1731, Issue 3, 20 December 2005, Pages 202-208

T-DNA tagging and characterization of a cryptic root-specific promoter in Arabidopsis

C. Sivanandan, T.P. Sujatha, Anand Mohan Prasad, R. Resminath, Dhiraj R. Thakare, S.R. Bhat and Srinivasan
National Research Center on Plant Biotechnology, Indian Agricultural Research Institute, New Delhi 110012, India

... using a web-based program, Plant Cis-Acting Regulatory Elements (Plant CARE) [21] and TSSP/Prediction of PLANT Promoters (Using RegSite Plant DB, Softberry Inc ...


BMC Bioinformatics
2005 6:114 doi:10.1186/1471-2105-6-114

CAGER: classification analysis of gene expression regulation using multiple information sources

Jianhua Ruan and Weixiong Zhang
1Department of Computer Science and Engineering, Washington University, St. Louis, MO 63130, USA and Department of Genetics, Washington University School of Medicine, St. Louis, MO 63110, USA

... For Arabidopsis ORFs, the upstream sequences were used as inputs to a promoter prediction program, TSSP [63], to predict transcription start sites (TSSs). ...


Bioinformatics
2005 21(14):3074-3081

Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana

Weixiong Zhang et al.,
Department of Computer Science and Engineering, Washington University in Saint Louis Saint Louis, MO 63130, USA

... sites (TSSs). To predict TSSs, we combined an A.thaliana cDNA database and a software, TSSP (SoftBerry, http://www.softberry.com). As ...


Acta Biochimica Polonica
Vol. 52 No. 1/2005 117-128

Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits

Frantz Liszewska, Dali Gaganidze and Agnieszka Sirko
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warszawa, Poland

... ments production. Location of the potential plant promoter was computed by the TSSP program [http://www. softberry.com]. Phylo- genies ...


Nucleic Acids Research
2005, Vol. 33, No. 3 1069–1076

Plant promoter prediction with confidence estimation

I. A. Shahmuradov(1), V. V. Solovyev(1,2,*) and A. J. Gammerman(1)
(1)Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK and (2)Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA

Accurate prediction of promoters is fundamental to understanding gene expression patterns, where confidence estimation is one of the main requirements. Using recently developed transductive confidence machine (TCM) techniques, we developed a new program TSSP-TCM for the prediction of plant promoters that also provides confidence of the prediction.


The Plant Journal
(2004) 37 (4), 517-527

Xa26, a gene conferring resistance to Xanthomonas oryzae pv. oryzae in rice, encodes an LRR receptor kinase-like protein

X Sun et al.,
National Key Laboratory of Crop Genetic Improvement, National Center of Crop Molecular Breeding, Huazhong Agricultural University, Wuhan 430070, China

.... Promoter regions of the Xa26 family members were analyzed with the promoter prediction programs tssp (http://www.softberry.com/berry.phtml), nnpp (http://www ...


Plant Physiology
136:3023-3033 (2004)

Utility of Different Gene Enrichment Approaches Toward Identifying and Sequencing the Maize Gene Space

Nathan Michael Springer, Xiequn Xu and W. Brad Barbazuk
Center for Plant and Microbial Genomics, Department of Plant Biology, University of Minnesota, St. Paul, Minnesota 55108 (N.M.S.); and Donald Danforth Plant Sciences Center, St. Louis, Missouri 63132 (X.X., W.B.B.)

...upstream sequence, 10 of the 33 genes had at least 1 kb of upstream sequence, and the longest extension was 2.2 kb. This sequence is likely to contain 5# UTRs and promoters. We attempted to determine how often a putative PolII promoter recognition sequences could be found using the Softberry TSSP package (Mount Kisco, NY; http://www.softberry.com; Shahmuradov et al., 2003), which uses characteristics of known factor binding sites to predict potential transcription start sites in plant DNA sequence. Putative promoters were predicted in 13 of the 26 upstream sequences assayed, and putative TATA boxes were identified in 9 (70%) of...


Nucleic Acids Research
2003, Vol. 31, No. 1 114-117

PlantProm: a database of plant promoter sequences

Ilham A. Shahmuradov, Alex J. Gammerman, John M. Hancock, Peter M. Bramley1 and Victor V. Solovyev
Department of Computer Science, Royal Holloway, University of London, Egham, Surrey, TW20 0EX, UK 1 School of Biological Sciences, Royal Holloway, University of London, UK 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount Kisco, NY 10549, USA

... 2 Softberry Inc., 116 Radio Circle, Suite 400, Mount ... One such program (TSSP) based on discriminant analysis has been created by Softberry Inc. ...


TSSG

Journal of Biochemical Technology,
Vol 4, No 1 (2012)

Analysis of diabetic retinopathy biomarker VEGF gene by computational approaches

Jayashree Sadasivam, N Ramesh, K Vijayalakshmi, Vinni Viridi, Shiva prasad

... Gene promoters TSSG www.softberry.com/berry.tssp& group=programs&subgroup=pro moter Proteins Data PDB www.rcsb.org Tandem repeats TRF finder http://tandem.bu.edu/trf/trf.sub mit.options.html Docking Clusproprotei n-protein dock. Cluspro.bu.edu Page 3. ...


Nature Communications
4, Article number: 2739 doi:10.1038/ncomms3739

Genome-wide association study implicates NDST3 in schizophrenia and bipolar disorder

Lencz et al.,
Division of Research, Department of Psychiatry, The Zucker Hillside Hospital Division of the North Shore—Long Island Jewish Health System, Glen Oaks, New York 11004, USA Center for Psychiatric Neuroscience, The Feinstein Institute for Medical Research, Manhasset, New York 11030, USA

... TATA boxes were predicted by TSSG (Softberry Inc) and the predicted TATA box locations were depicted with vertical arrows (red on plus strand and blue on minus strand of chromosome 4). In cross-species genomic sequence alignment, high sequence similarity was depicted ...


Gene
Volume 527, Issue 2, 25 September 2013, Pages 606–615 DOI:10.1016/j.gene.2013.05.078

Novel polymorphisms in UTR and coding region of inducible heat shock protein 70.1 gene in tropically adapted Indian zebu cattle (Bos indicus) and riverine buffalo (Bubalus bubalis)

M. Sodhi, M. Mukesh, A. Kishore, B.P. Mishra 1, R.S. Kataria, B.K. Joshi
National Bureau of Animal Genetic resources, Karnal 132001, India

... Microsatellite repeats were identified using Gramene software (http://www.gramene.org/db/markers/ ssrtool).The promoter region was predicted using Proscan software (http://www-bimas.cit.nih. gov/molbio/proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ...


J Biol Chem.
2012 Dec 19. [Epub ahead of print] DOI: 10.1074/jbc.M112.419168

MiR-125b Functions as a Key Mediator for Snail-Induced Stem Cell Propagation and Chemoresistance

Zixing Liu et al.,
1 University of South Alabama, United States; 2 Central South University, China;

... Western blotting. Luciferase Reporter Assay — The miR-125b promoter pGL3 basic luciferase vector was constructed according to the literature and TSSG prediction (http://linux1.softberry.com/berry.phtml? topic=products). pGL3 ...


Plant Biology,
14: 714–724. doi: 10.1111/j.1438-8677.2011.00556.x

Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula

Bucsenez, M., Ruping, B., Behrens, S., Twyman, R. M., Noll, G. A. and Prufer, D.
1 Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Aachen, Germany 2 Institut fur Biologie und Biotechnologie der Pflanzen, Westfalische Wilhelms-Universitat Munster, Munster, Germany

... MATERIAL AND METHODS In silico identification of the transcriptional start site and TATA box The putative transcriptional start site and TATA box of the MtSEO-F1 promoter were predicted using the Transcriptional Start Site Prediction (TSSP) tool from Softberry (http:// www ...


Mol Biol Rep.
2011 Aug;38(6):4153-7. doi: 10.1007/s11033-010-0535-y. Epub 2010 Nov 24.

Identification of the transcriptional promoters in the proximal regions of human microRNA genes

Long et al.,
Key Laboratory of Neurogenetics and Channelopathies of Guangdong Province and the Ministry of Education of China, Institute of Neuroscience and the Second Affiliated Hospital of Guangzhou Medical University, 250 Chang-gang-dong Road, Guangzhou, 510260, China

... It is shown that TSSG (http://www.softberry.ru/berry.phtml, Softberry) is a good promoter prediction program with few false positive pre- dictions comparing to other promoter finding programs [17, 20]. Therefore, we used this program to predict the promoter regions and TSSs. ...


Gene
Volume 473, Issue 2, 1 March 2011, Pages 133–138 DOI: 10.1016/j.gene.2010.11.015

Molecular characterization and analysis of the porcine betaine homocysteine methyltransferase and betaine homocysteine methyltransferase-2 genes

Radhika S. Ganu a, Timothy A. Garrow b, Monika Sodhi c, Laurie A. Rund c, Lawrence B. Schook a, c
a Division of Nutritional Sciences, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA b Department of Food Science and Human Nutrition, University of Illinois at Urbana Champaign, 1201 W. Gregory Dr., Urbana, IL 61801, USA

... The promoter region was predicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/ proscan/) and TSSG software (http://www.softberry.ru/berry.phtml). ... PolyAH software (http://www.softberry.ru/berry.phtml) was used to detect 3? UTR poly A signal sites. ...


BMC Biotechnology
2011, 11:51 doi:10.1186/1472-6750-11-51

Identification of a novel temperature sensitive promoter in cho cells

Haruthai Thaisuchat 1†, Martina Baumann 1†, Jens Pontiller 2, Friedemann Hesse 2 and Wolfgang Ernst 1,3
1 Department of Biotechnology, University of Natural Resources and Life Sciences Vienna, Muthgasse 11, 1190 Vienna, Austria 2 Austrian Center of Biopharmaceutical Technology, Muthgasse 18, 1190 Vienna, Austria

... Computational analysis of this region was performed using several freely available online prediction tools for eukaryotic Pol-II promoters (FPROM and TSSG at: http://linux1.softberry.com/ berry.phtml webcite, and a neural network based prediction program at: http://www.fruitfly ...


Hum Genet.
2010 Jan 12. [Epub ahead of print]

PD1 as a common candidate susceptibility gene of subacute sclerosing panencephalitis

Ishizaki et al.,
Department of Pediatrics, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka, 812-8582, Japan

... 2004). The values from three separate assays were compared between constructs. The putative promoter region of PD1 gene was predi- cated using the TSSG (http://www.softberry. com/berry. phtml?topic=tssg&group=programs&subgroup=promoter). ... 


Glycobiology
Advance Access published November 22, 2010

Conservation of the ST6Gal I gene and its expression in the mammary gland

Jovana Maksimovic, Julie A. Sharp, Kevin R. Nicholas, Benjamin G. Cocks, Keith Savin
Centre for Reproduction and Development, Monash Institute of Medical Research, Clayton 3168 Australia Biosciences Research Division, Department of Primary Industries, Bundoora 3083 Australia Institute for Technology Research and Innovation, Deakin University, Geelong 3214 Australia

... TRANSCOMPEL (Kel-Margoulis, OV, Kel, AE, et al. 2002) database, as well as mononucleotide position weight matrices for individual TFBS collected in TRANSFAC. Transcription start sites were predicted using TSSG (Softberry). Page 24. 24 Acknowledgments ...


Acta Biochim Biophys Sin (Shanghai).
2009 Apr;41(4):309-15.

Identification and characterization of the minimal promoter of Mipu1: the role of GC boxes in the regulation of basal transcription

Lv B et al.,
Department of Pathophysiology, Xiangya School of Medicine, Central South University, Changsha 410078, China.

... rat/). The Mipu1 gene transcription start site was predicted using Dragon GC + Promoter Finder (http://sdmc.lit.org.sg/promoter/CGrich1_0/CGRICH.htm) and TSSG (http://www.softberry.com/berry.phtml?topic=promoter). Promoterscan ...


European Journal of Cell Biology
Volume 88, Issue 12, December 2009, Pages 731-742

Molecular mechanisms underlying the pro-inflammatory synergistic effect of tumor necrosis factor ? and interferon ? in human microvascular endothelium

Lombardi et al.,
aDepartment of Clinical Physiopathology, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, Viale Pieraccini 6, I-50139 Florence, Italy bDepartment of Internal Medicine, DENOthe Center of Excellence for Research, Transfer and High Education, University of Florence, I-50139 Florence, Italy

... A 5-kb region upstream from the TNFa-RII and the IFNg-R open reading frames was analyzed using the promoter identification programs promoter predictions (http://www.fruitfly.org/seq_tools/ promoter) and TSSG (http://softberry.com/berry.phtml?topic=tssg&group ...


Endocrinology
2009 Vol. 150, No. 4 1870-1878

Hypothalamic Expression of Eap1 Is Not Directly Controlled by Ovarian Steroids

Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa and Sergio R. Ojeda
Division of Neuroscience (V.M., S.R.O.), Oregon National Primate Research Center, Beaverton, Oregon 97006; and Department of Physiology and Pharmacology (C.M., R.A.S., D.M.D.), Oregon Health and Science University, Portland, Oregon 97239

... The position of a TSS was predicted using several search tools including Promoter 2.0 Prediction server (http://www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder version 1.5 (http://research.i2r.a-star.edu.sg/promoter/promoter1_5/DPF.htm), and Softberry TSSG (http ...


Endocrinology
2008, doi:10.1210/en.2008-0779

Hypothalamic expression of Eap1 is not directly controlled by ovarian steroids

Valerie Matagne, Claudio Mastronardi, Robert A. Shapiro, Daniel M. Dorsa, and Sergio R. Ojeda
Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon, USA; and Department of Physiology & Pharmacology, Oregon Health & Science University, Portland, Oregon, USA

... www.cbs.dtu.dk/services/Promoter/), Dragon Promoter Finder v1.5 (http://research. i2r.a- star.edu.sg/promoter/promoter1_5/DPF.htm) and Softberry TSSG (http://www ...


Endocrinology
2008, Vol. 149, No. 9 4256-4266

Seladin-1 Is a Fundamental Mediator of the Neuroprotective Effects of Estrogen in Human Neuroblast Long-Term Cell Cultures

Luciani et al.,
Endocrine Unit, Department of Clinical Physiopathology, Center for Research, Transfer and High Education on Chronic, Inflammatory, Degenerative and Neoplastic Disorders for the Development of Novel Therapies (P.L., C.D., F.R., S.B., I.C., F.D., M.M., G.D., M.S., A.P.), Department of Anatomy, Histology, and Forensic Medicine (G.B.V.), University of Florence, 50139 Florence, Italy

... A 6-kb region upstream seladin-1 open reading frame was analyzed using eukaryotic promoter identification programs (http://www.softberry.com/berry.phtml?topic=tssg&group=programs&subgroup=promoter ...


Animal Genetics
39(5):531-543, October 2008.

Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST

Meyers, S. N.; Beever, J. E.

... Putative promoter sequences and transcriptional start sites (TSSs) were predicted using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...


Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95

Cloning and functional analysis of the promoter region of the human Disc large gene

Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina

... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...


Cancer Research
68, 8976-8985, November 1, 2008. doi: 10.1158/0008-5472.CAN-08-0769

Roles for MicroRNAs, miR-93 and miR-130b, and Tumor Protein 53–Induced Nuclear Protein 1 Tumor Suppressor in Cell Growth Dysregulation by Human T-Cell Lymphotrophic Virus 1

Yeung et al.,
Molecular Virology Section, Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, NIH, Bethesda, Maryland; 2 Laboratory of Virus Immunology, Institute for Virus Research, Kyoto University, Shogoin Kawahara-cho, Sakyo-ku, Kyoto, Japan;

... luciferase (f-luc) reporter gene. The putative promoter of miR-130b was predicted by TSSG promoter prediction program. 6 PCR primers (sense ...


Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208

Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes

Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy

... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter, Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.), "TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...


BMC Genomics
2007, 8:203 doi:10.1186/1471-2164-8-203

In silico comparative genomic analysis of GABAA receptor transcriptional regulation

Christopher J Joyce1§
1Faculty of Biological Sciences, The University of Leeds, Leeds, UK

Table 1 - Gene Regulation Prediction Software utilised ...TSSG TSS Prediction www.softberry.com ...


Nature and Science,
4(3), 2006

An In Silico Investigation into the Discovery of Novel Cis-acting Elements within the Intronic Regions of Human PAX7

Maika G. Mitchell 1, Melanie Ziman 1
1 School of Exercise, Biomedical and Health Science, Edith Cowan University, Perth, Western Australia 6027,
2 Sloan Kettering Institute (Memorial Sloan Kettering Cancer Center), New York City, New York 10021, USA

The names and functions of the programs used are: ...3) DNA Pattern Search - Softberry: (http://www.softberry.com/) - This program searches for significant patterns in the set of sequences....
...6) TSSG - Recognition of human PolII promoter regions and transcription start sites from Softberry: (http://www.softberry.com/) - TSSG is the most accurate mammalian cis element prediction program.


DNA and Cell Biology
Jun 2006, Vol. 25, No. 6 : 346 -358

Cloning and Characterization of the BRD7 Gene Promoter

Liu et al.,
Cancer Research Institute, Xiang-Ya School of Medicine, Central South University, Hunan, People's Republic of China

... The transcriptional initiation site was identified using the TSSG program (http://www.softberry.com/berry.phtml?topic promoter) and Dragon GC Promoter Finder ...


Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223

GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis

ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.

... Consistent with this result, sequence analysis using TSSG and TSSW softwares ( http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ...


TSSW

International Journal of Fisheries and Aquatic Studies
2016; 4(3): 378-383

Isolation, characterization and activity analysis of selected promoters of mud crab, Scylla serrata

Mani, M. K., Neeli-Venkata, R., Kondadhasula, R., & Majumdar, K. C.
Post-Harvest Technology, Central Institute of Fisheries Education, Mumbai, India; Department Of Signal Processing, Tampere University Of Technology, Finland

.. Histone3 -R GGCGCTAGCTAGCTTCCTTCTT 2.3 Promoter nucleotide sequences analysis The sequences thus obtained were analysed for potential transcription factor binding sites specific for promoters using TSSW (http://linux1.softberry.com/berry.phtml) and ...


International journal of molecular sciences
2014, 15(2), 2573-2584. DOI: 10.3390/ijms15022573

The Proteasome Activator PA28?, a Negative Regulator of p53, Is Transcriptionally Up-Regulated by p53

Wan Z. X. et al.,
Key Laboratory of Protein Chemistry and Developmental Biology of Ministry of Education, College of Life Science, Hunan Normal University, Changsha 410081, China

... The transcription start site of the human PA28? gene was predicted by online bioinformatics tools: NNPP [21] (http://www.fruitfly.org/seq_tools/promoter.html), McPromoter [22] (http://tools.igsp. duke.edu/generegulation/McPromoterMMII/), and Softberry programs FPROM [19]/TSSW [20] (http://linux1.softberry.com/berry.phtml). ...


J. Virol. June
2012 vol. 86 no. 12 6688-6700 DOI: 10.1128/JVI.07037-11

Feline Tetherin Is Characterized by a Short N-Terminal Region and Is Counteracted by the Feline Immunodeficiency Virus Envelope Glycoprotein

Celestino et al.,
aDepartment of Molecular Medicine, University of Padua, Padua, Italy bRetrovirus Center and Virology Section, Department of Experimental Pathology, University of Pisa, Pisa, Italy

... The transcription initiation start site and the different cis-acting elements present in the putative cBST2 promoter region were predicted by using the following programs: the TSSW prediction program (Softberry), TFsitescan (MIRAGE [Molecular Informatics Resource for the ...


PLoS ONE
(2011), 6(10): e26944. doi:10.1371/journal.pone.0026944

A Common Genetic Variant (97906C>A) of DAB2IP/AIP1 Is Associated with an Increased Risk and Early Onset of Lung Cancer in Chinese Males.

Yang et al.,
The Institute for Chemical Carcinogenesis, The State Key Lab of Respiratory Disease, Guangzhou Medical University, Guangzhou, People's Republic of China Department of Pathology, Yale University School of Medicine, New Haven, Connecticut, United States of America

...We used the TSSW program (http://www.softberry.ru/berry.phtml) to predict promoter region and found that the 4000 bp 5?-upstream region of DAB2IP gene are potential promoter region. ...


Molecular and Cellular Biology
January 2009, p. 570-581, Vol. 29, No. 2 doi:10.1128/MCB.01275-08

CUX1 and E2F1 Regulate Coordinated Expression of the Mitotic Complex Genes Ect2, MgcRacGAP, and MKLP1 in S Phase

Seguin et al.,

... sequences immediately upstream of the transcription start sites were analyzed with the Genomatix suite (www.genomatix.de) and TSSW software (www.softberry.com ...


Animal Genetics
39(5):531-543, October 2008.

Investigating the genetic basis of pork tenderness: genomic analysis of porcine CAST

Meyers, S. N.; Beever, J. E.

... Putative promoter sequences and transcriptional start sites (TSSs) were predicted using TSSG, TSSW (both available at http://linux1.softberry.com/berry.phtml ...


Gene
Volume 424, Issues 1-2, 15 November 2008, Pages 87-95

Cloning and functional analysis of the promoter region of the human Disc large gene

Ana Laura Cavatorta, Adriana A. Giri, Lawrence Banks and Daniela Gardio
aInternational Centre for Genetic Engineering and Biotechnology, Padriciano 99, 34012 Trieste, Italy bArea Virologi'a, Facultad de Ciencias Bioqui'micas y Farmace'uticas, Instituto de Biologi'a Molecular y Celular de Rosario-CONICET, Universidad Nacional de Rosario, Rosario, Argentina

... Genomatix Software GmbH Munchen, Germany); TFSEARCH (Computational Biology Research Center, Tokyo, Japan); SIGNAL SCAN Databases; Softberry TSSW and TSSG ...


BMC Bioinformatics.
2008; 9: 113.

Human Pol II promoter recognition based on primary sequences and free energy of dinucleotides

Jian-Yi Yang, Yu Zhou, Zu-Guo Yu, Vo Anh, and Li-Qian Zhou
1School of Mathematics and Computational Science, Xiangtan University, Hunan 411105, China 2School of Mathematical Sciences, Queensland University of Technology, GPO Box 2434, Brisbane, Q 4001, Australia

... of promoter prediction tools, which are available on-line, namely Neural Network Promoter Prediction (NNPP version 2.2) [27], Soft Berry (TSSW) [28], Dragon ...


Mol. Cell. Biol.
doi:10.1128/MCB.01275-08

CUX1 and E2F1 regulate coordinated expression of the mitotic complex genes Ect2, MgcRacGAP and MKLP1 in S-phase

Seguin et al.,
INSERM U749, Faculte' de Pharmacie Paris XI, 92296 Cha^tenay-Malabry, France; and Molecular Oncology Group, McGill University, Montreal, Quebec, H3A 1A1, Canada

... with the genomatix suite (www.genomatix.de) and TSSW softwares (www.softberry.com). These analyses did not identify consensus TATA boxes in these 3 promoters. ...


Gene
Volume 406, Issues 1-2, 30 December 2007, Pages 199-208

Organisation of the Hb 1 genes of the Antarctic skate Bathyraja eatonii: New insights into the evolution of globin genes

Katia Marino, Loredana Boschetto, a, Donatella de Pascale and Ennio Cocca
Institute of Protein Biochemistry, C.N.R., Via P. Castellino 111, I-80131 Naples, Italy

... Markov Chain Promoter Finder McPromoter MM:II" (http://genes.mit.edu/McPromoter, Ohler et al., 1999); "NSITE Version 2.2004" (Softberry Inc.), "TSSG" and "TSSW ... 1999–2005, www.softberry.com); ...


Lung Cancer
2007 Volume 57, Issue 2, Pages 143-151

Polymorphisms of cytosolic serine hydroxymethyltransferase and risk of lung cancer: A case–control analysis

L. Wang, J. Lu, J. An, Q. Shi, M. Spitz, Q. Wei
Department of Epidemiology, The University of Texas M.D. Anderson Cancer Center, Houston, TX 77230-1439, United States.

.. fcgi%3Fdb=Snp), of which two SNPs were found to be located in the SHMT1 promoter region as predicted by the online software TSSW (http://www.softberry.com/berry ...


Human Molecular Gene
2005 14(11):1465-1474; doi:10.1093/hmg/ddi156

Identification and characterization of a novel gene Saf transcribed from the opposite strand of Fas

Ming-De Yan et al.,
1Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan, ROC

... 1). After analysis with program TSSW (http://www.softberry.com), one promoter was predicted upstream of the transcription start site. ...


Genomics
Volume 86, Issue 4, October 2005, Pages 489-494

L3mbtl, the mouse orthologue of the imprinted L3MBTL, displays a complex pattern of alternative splicing and escapes genomic imprintingstar, open

Li et al.,
aDepartment of Haematology, Cambridge Institute for Medical Research, University of Cambridge, Hills Road, Cambridge CB2 2XY, UK bDepartment of Anatomy, University of Cambridge, Downing Street, Cambridge CB2 3DY, UK

... which were predicted by promoter prediction programs including PROSCAN 1.7 (http://bimas.cit.nih.gov/molbio/proscan/) and TSSW (http://www.softberry.com/berry ...


J. Biol. Chem
Vol. 279, Issue 34, 35183-35192, August 20, 2004

STAT6 and Ets-1 Form a Stable Complex That Modulates Socs-1 Expression by Interleukin-4 in Keratinocytes

Julia Travagli, Martine Letourneur, Jacques Bertoglio, and Josiane Pierre
From the INSERM U461, Faculte de pharmacie, 5 Rue J. B. Clement, 92296-Chatenay-Malabry, France

... The transcriptional start site was determined by computational analysis (TSSW using Softberry Software) and predicted to be located at nucleotide -16 from ...


Blood
1 July 2004, Vol. 104, No. 1, pp. 215-223

GILZ, a new target for the transcription factor FoxO3, protects T lymphocytes from interleukin-2 withdrawal–induced apoptosis

ML Asselin-Labat et al.,
From the Institut National de la Sante et de la Recherche Medicale (INSERM) U 461, Faculte de Pharmacie Paris XI, Chatenay-Malabry, France; and INSERM U 478, Faculte deMedecine X. Bichat, Paris, France.

... Consistent with this result, sequence analysis using TSSG and TSSW softwares ( http://www.softberry.com/berry.phtml?topic=index&group=programs&subgroup ...


Genomics
2004 Sep;84(3):577-86.

Cloning, genomic structure, and expression profiles of TULIP1 (GARNL1), a brain-expressed candidate gene for 14q13-linked neurological phenotypes, and its murine homologue

Schwarzbraun T et al.,
Institute of Medical Biology and Human Genetics, Medical University of Graz, Harrachgasse 21/8, A-8010 Graz, Austria.

... Putative promoter regions were detected from human and murine genomic sequences using the eukaryotic promoter prediction program TSSW from Softberry, Inc., http ...


Archives of Biochemistry and Biophysics
Volume 409, Issue 2, 15 January 2003, Pages 287-297

Mitochondrial and nucleocytoplasmic isoforms of O-linked GlcNAc transferase encoded by a single mammalian gene

Hanover et al.,
Laboratory of Cell Biochemistry and Biology, NIDDK, National Institutes of Health, Building 8, Room 402, 8 Center Drive, MSC 0850, NIH, Bethesda, MD 20892-0850, USA

... Ensembl, Fgenesh ++, and the TSSW Promoter Prediction algorithms (http://www.softberry.com/berry.phtml) were initially employed. ...



©2001-2025   www.softberry.com